Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Studie af Cyklusreguleret Gen Expression af To Komplementære Celle Synkronisering Protokoller

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

Vi rapporterer to cellesynkroniseringsprotokoller, der giver en sammenhæng til at studere begivenheder relateret til specifikke faser af cellecyklussen. Vi viser, at denne tilgang er nyttig til analyse af reguleringen af ​​specifikke gener i en upertureret cellecyklus eller ved udsættelse for midler, som påvirker cellecyklussen.

Abstract

Gencyklusprogrammet for cellecyklussen repræsenterer et kritisk trin for forståelse af cellecyklusafhængige processer og deres rolle i sygdomme som kræft. Cellecyklusreguleret genekspression analyse afhænger af cellesynkronisering i specifikke faser. Her beskriver vi en metode, der benytter to komplementære synkroniseringsprotokoller, der almindeligvis anvendes til at studere periodisk variation af genekspression under cellecyklussen. Begge procedurer er baseret på forbigående blokering af cellecyklussen i et bestemt punkt. Synkroniseringsprotokollen ved hydroxyurea (HU) -behandling fører til cellulær arrest i sen G1 / tidlig S-fase, og frigivelse fra HU-medieret arrestation giver en cellulær population ensartet fremgang gennem S og G2 / M. Synkroniseringsprotokollen ved thymidin og nocodazol (Thy-Noc) -behandling blokerer celler i tidlig mitose, og frigivelse fra Thy-Noc-medieret arrest tilvejebringer en synkroniseret cellulær population egnet til G1-fase og S-fase-enPrøv studier. Anvendelse af begge procedurer kræver overvågning af cellecyklusfordelingsprofilerne, som typisk udføres efter propidiumiodid (PI) farvning af cellerne og flowcytometri-medieret analyse af DNA-indhold. Vi viser, at den kombinerede anvendelse af to synkroniseringsprotokoller er en robust tilgang til klart at bestemme transkriptionsprofilerne for gener, som er differentielt reguleret i cellecyklussen ( dvs. E2F1 og E2F7) og følgelig at have en bedre forståelse af deres rolle i cellecyklus processer. Desuden viser vi, at denne tilgang er nyttig til undersøgelse af mekanismer, der ligger til grund for lægemiddelbaserede terapier ( dvs. mitomycin C, et anticancermiddel), fordi det gør det muligt at diskriminere gener, der reagerer på det genotoksiske middel fra dem, der udelukkende er påvirket af cellecyklussystemforstyrrelser Pålagt af agenten.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Overgang gennem alle faser af cellecyklussen er koblet til et tæt reguleret genekspressionsprogram. Denne koordinerede "on og off" -genskription gennem hele cellecyklussen antages at være under kontrol af komplekse transkriptionsregulatorsystemer, der regulerer ikke blot timingen, men også niveauerne af genekspression. Deregulering af nøglecellecykluskomponenter er kendt for at bidrage til udviklingen af ​​flere sygdomme og er et veletableret kendetegn for tumorigenese 1 , 2 . Gennemgående transskriptomiske analyser udført i gær- og pattedyrsceller har vist, at et stort antal gener udviser periodiske genekspressionsmønstre i cellecyklussen, hvilket tyder på, at transkriptionelle udsving under cellecyklussen er en afspejling af det tidsmæssige krav for et givet genprodukt I en præcis fase 3 , 4 , 5 .

En vigtig opgave i undersøgelsen af ​​cellecyklusreguleret genekspression er synkroniseringen af ​​celler i specifikke cellecyklusfaser. Cellesynkronisering hjælper med at fortolke forening af et genekspressionsmønster til en bestemt cellecyklusfaseovergang, og det har ført til en bedre forståelse af reguleringen og funktionen af ​​adskillige gener. Cellesynkronisering er også vigtig for at studere virkningsmekanismen for anticancer-lægemidler, da kemoterapeutiske midler er kendt for at påvirke både genekspression såvel som cellecykluskinetik 6 , 7 . Ikke desto mindre er det ofte svært at afgøre, om genekspressionskomplikationer som følge af behandling med disse midler er et direkte respons på behandlingen eller blot er konsekvensen af ​​ændringer i cellecyklusprofiler. For at skelne mellem disse muligheder bør genekspression analyseres i celler, der har været sYnkroniseret forud for tilsætning af det kemoterapeutiske lægemiddel.

Med undtagelse af nogle primære celler, såsom frisk isolerede lymfoide celler - som udgør en homogen cellepopulation synkroniseret i G08 - vokser in vitro etablerede cellelinier asynkront i kultur. Under regelmæssige vækstbetingelser findes disse asynkrone cykelceller i alle faser af cellecyklussen, men fortrinsvis i G1 9 . Derfor tilvejebringer denne sammenhæng ikke et optimalt scenario for funktionelle eller genekspression analyser i en specifik cellecyklus fase ( fx G1, S etc.). Ikke-transformerede immortaliserede cellelinier ( fx fibroblaster) kan synkroniseres med såkaldte fysiologiske metoder 10 . Disse fremgangsmåder er baseret på de tilbageholdte primære celleegenskaber af ikke-transformerede celler, såsom cellekontaktinhibering og vækstfaktorafhængighed for at fortsætte cyklering. FjernelseAf serum i kombination med kontaktinhibering gør ikke-transformerede celler arresteret ved G0 / G1. Imidlertid kræver synkroniseret cellecyklusindgang og -progression ofte subkultur, hvilket også involverer kunstig frigørelse af cellerne og genplacering 10 . Vigtigst er denne metode ikke egnet til synkronisering af transformerede cellelinjer, det store flertal af etablerede cellelinier, som i øjeblikket er i brug, karakteriseret ved manglende cellekontakt-medieret væksthæmning eller respons på vækstfaktorudtagning. Det er således klart, at alternative metoder er nødvendige for effektiv cellesynkronisering i specifikke faser af cellecyklussen. Generelt er de mest anvendte synkroniseringsmetoder baseret på forbigående kemisk eller farmakologisk inhibering af et defineret punkt i cellecyklussen, typisk DNA-syntese eller mitotisk spindeldannelse. Inhibering af DNA-syntese synkroniserer celler ved at arrestere dem i sen G1 eller tidlig S-fase. Dette kan være achiVed hjælp af tilsætningen af ​​forbindelser som mimosin, en inhibitor af nukleotidbiosyntese 11 , 12 , aphidicolin, en inhibitor af DNA-polymeraser 13 , 14 , hydroxyurea, en inhibitor af ribonukleotidreduktase 15 , 16 eller ved overskydende mængder af thymidin 17 , 18 . På den anden side er inhibitorer af mikrotubulapolymerisation, såsom colchicin eller nocodazol, i stand til at blokere mitotisk spindeldannelse, der fører til cellesynkronisering ved tidlig M-fase 19 , 20 , 21 .

I dette værk beskriver vi en metode, der involverer to komplementære synkroniseringsprotokoller baseret på forbigående kemisk inhibering til undersøgelse af ekspressionen af ​​cellecyklusregulerede gener ved mRNA'etniveau. Denne metode er grundlæggende for at definere cellecyklusgenernes rolle i specifikke cellecyklusprocesser. Desuden tilvejebringer den en generel ramme til undersøgelse af virkningen af ​​anticancerbehandlinger for nøjagtigt at detektere lægemiddelresponsive gener og for at minimere misfortolkninger afledt af forstyrrelser i cellecyklusprogression genereret af disse lægemidler.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Cellulær synkronisering, frigivelse og overvågning af cellecyklusprogression

  1. Thymidin- og nocodazolbaseret (Thy-Noc) -synkronisering og frigivelse af U2OS-celler fra myosit
    1. Forbered det krævede cellekulturmedium. U2OS-celler dyrkes rutinemæssigt i DMEM-Glutamin-medium komplementeret med 10% (vol / vol) FBS (valgfrit: 1% penicillin / streptomycin). Udfør alt medium forberedelse og manipulation under sterile forhold og opvarmning komplementeret medium (fra nu af kaldt "komplet medium") til 37 ° C før brug.
    2. Frø 2 x 10 6 U2OS celler pr. 100 mm skål i 10 ml komplet dyrkningsmedium. For at beregne antallet af nødvendige skåle skal der tages højde for, at hver 100 mm skål typisk giver nok mitotiske celler til at omplatte ca. 5 brønde af en 6-brønds plade (0,2 - 0,25 x 106 celler / brønd) (se figur 1B ). To brønde pr. Valgt tidspunkt er requirEd i eksperimentet (1 brønd til RNA-ekstraktion og 1 brønd til cellecyklusovervågning). Derudover kan en tredje brønd indsamles pr. Tidspunkt for proteinanalyse.
      BEMÆRK: Pladerceller om aftenen (omkring kl. 19.00), så de efterfølgende trin kan udføres i løbet af arbejdstiden de følgende dage. Inkluder 2 yderligere brønde af asynkrone voksende celler for at definere FACS analyse kompensationsindstillinger.
    3. Lad cellerne vedhæfte ved at inkubere 100 mm retter ved 37 ° C i en befugtet atmosfære med 5% CO2 i 24 timer.
    4. For thymidinblokken fremstilles en 200 mM thymidin stamopløsning ved at opløse 145,2 mg thymidinpulver i 3 ml H20 (eller ækvivalente mængder) og sterilisere opløsningen ved filtrering gennem et 0,2 μm porestørrelsesfilter. Let opvarmning kan hjælpe med at opløse thymidin. Tilsæt 100 μl af den frisklavede 200 mM stamme til hver 100 mm dyrkningsskål (slutkoncentration 2 mM). Inkuber celler med thymidin i 20 timer ved 37 ° C76 ° C i en befugtet atmosfære med 5% C02.
      BEMÆRK: Behandle celler om aftenen (ca. 7 pm), for at få tid til at udføre både thymidinfrigivelse og nocodazolblok den følgende dag.
    5. For at frigive fra thymidinblokken fjerner man thymidinholdigt vækstmedium om eftermiddagen den følgende dag (3 pm); Vask celler to gange med forvarmet 1x PBS og tilsæt 10 ml komplet medium til hver 100 mm skål. Inkuber celler i 5 timer ved 37 ° C i en befugtet atmosfære med 5% CO2.
    6. Til mitotisk cellearrest tilsættes nocodazol til en slutkoncentration på 50 ng / ml (8 pm). Forbered en stamopløsning ved at opløse nocodazolpulver i DMSO ( f.eks. 5 mg / ml) og opbevar frosne ved -20 ° C. Inkuber celler med nocodazol i ikke mere end 10-11 timer ved 37 ° C i en befugtet atmosfære med 5% CO2.
    7. Frigivelse fra nocodazol-medieret arrest i tidlig M-fase (mitotisk shake-off) og samling af prøver på flere tidspunkterNts (starter kl. 6-7).
      1. Fjern afrundede (mitotiske) celler ved at ryste hver plade og forsigtigt pipettere nocodazolholdigt vækstmedium. Saml medium med løsne celler fra hver 100 mm plade i 50 ml sterile rør, centrifuge (300 xg, 5 min, stuetemperatur (RT)) og vask cellerne to gange ved at tilsætte 1x PBS efterfulgt af centrifugering. Brug af kold PBS eller PBS plus nocodazol anbefales for at undgå mitotisk glidning (se Diskussionsafsnittet).
      2. Resuspender mitotiske celler samlet fra hver 100 mm plade i 10 ml komplet medium. Gem 2 mL til RNA-ekstraktion og 2 mL for FACS-analyse for 0 h tidspunktet (ca. 0,2-0,25 x 106 celler pr. Prøve).
      3. Genplad de resterende mitotiske celler til efterfølgende tidspunkter i 6-brøndsplader (2 ml / brønd, 0,2-0,25 x 106 celler / brønd).
        BEMÆRK: Husk at 2 brønde er påkrævet pr. Valgt tidspunkt (1 for RNA og 1 for FACS analyse).
    8. Saml prøver på selEcted tidspunkter. Hver 1,5 til 3 timer anbefales for at opnå en passende profil af cellecyklusprogressionen.
      1. Ved RNA-ekstraktion fjernes medium, skylles godt med 2 ml forvarmende 1x PBS og tilsættes 1 mL egnet RNA-isolationsreagens ( f.eks. TRIzol) i brønden (udfør dette sidste trin i et sikkerhedsskabe til kemikalier). Pipetter op og ned for at løsne og lysceller, overføre cellysalat til et 1,5 ml mikrocentrifugerør, inkuber 5 minutter ved stuetemperatur og opbevar rør ved -80 ° C indtil yderligere brug.
      2. Til FACS analyse skylles godt med 2 ml forvarmende 1x PBS, tilsættes forvarmet trypsin-EDTA opløsning (0,3 ml / brønd) for at løsne celler, blokere Trypsin-EDTA ved at tilsætte 1 ml komplet medium og samle hver prøve i en separat 15 ml rør.
        1. Centrifuge celler (300 xg, 5 min, RT), gem cellulær pellet og kassere supernatant. For at fixe celler resuspender cellerne i 1 ml afkølet 70% (vol / vol) ethanol i 1x PBS ved forsigtigt hvirvlende rør og læg dem på is til appCa. 15 minutter før opbevaring ved 4 ° C eller farvning til yderligere analyse ved hjælp af FACS (beskrevet i trin 1.4-1.5).
  2. HU-baseret synkronisering og frigivelse af U2OS-celler fra G1 / S-grænsen
    1. Forbered fuldstændig cellekulturmedium som beskrevet i trin 1.1.
    2. Sæd 0,25 x 106 U2OS celler pr. Brønd i 6 brøndsplader (2 ml komplet dyrkningsmedium pr. Brønd). For at beregne antallet af brønde, der er nødvendige til eksperimentet, skal der tages hensyn til, at der skal kræves 2 brønde pr. Valgt tidspunkt (1 brønd til RNA-ekstraktion og 1 brønd til cellecyklusovervågning), og at 2 yderligere brønde af asynkrone voksende celler er Behov for at definere FACS analyse kompensation indstillinger.
    3. Lad celler vedhæfte ved at inkubere 6-brøndsplader natten over (O / N) ved 37 ° C i en befugtet atmosfære med 5% CO2.
    4. Fjern komplet medium fra brønde den følgende morgen og tilsæt 2 mlAf forvarmet FBS-frit DMEM-Glutamin-medium pr. Brønd. Inkuber celler i yderligere 24 timer ved 37 ° C i en befugtet atmosfære med 5% CO2.
      BEMÆRK: Udfør dette trin i alle brønde undtagen 2 (de gemte for at definere FACS-indstillinger). Serumoptagelsestrin kan udelades, hvis effektiv synkronisering opnås ved simpelthen at inkubere celler med HU.
    5. G1 / S cellecyklusarrest med HU.
      1. Forbered frisk HU stamopløsning (500 mM) forud for hver brug. Tilsæt 2 ml H20 til 76,06 mg HU pulver og bland til det er grundigt opløst. Steriliser opløsningen ved filtrering gennem et 0,2 μm porestørrelsesfilter. Bland 50 ml komplet medium med 400 μl filtersteriliseret HU stamopløsning til en endelig HU koncentration på 4 mM.
      2. Fjern medium fra alle brønde bortset fra de 2 brønde, der er nødvendige til at definere FACS-indstillinger og erstatte med et frisklavet 4 mM HU-holdigt komplet medium (2 ml / brønd).
      3. Inkubér celler i 24 timer iHU-holdigt medium ved 37 ° C i en befugtet atmosfære med 5% CO2.
    6. Frigivelse af celler fra HU-medieret arrest. Fjern HU-holdigt medium fra brønde og skyll brønde to gange med forvarmet 1x PBS (2 ml hver gang). Tilsæt 2 ml komplet medium pr. Brønd. Saml 2 prøver til 0 h tidspunktet (1 for RNA-ekstraktion og 1 for cellecyklusarrestation verifikation af FACS) samt 2 prøver gemt for FACS-indstillinger. Anbring resterende brønde i inkubatoren.
    7. Indsamle prøver hver 1.5 til 3 timer for at opnå en passende fordeling af cellecyklusprogression. På hvert tidspunkt skal du udføre prøvebehandling (til RNA-ekstraktion og FACS-analyse) som beskrevet i 1.1.8.1-1.1.8.2.
  3. Behandling med DNA-skadelige midler
    BEMÆRK: Når målet er at belyse effekten af ​​en forbindelse ( fx DNA-skadelige midler) i cellecyklushændelser, kan enhver af de tidligere beskrevne synkroniseringsmetoder væreKombineret med behandling af celler med det genotoksiske middel. For at kunne vælge synkroniseringsmetoden er det vigtigt at overveje fasen af ​​den cellecyklus, som vi gerne vil analysere. Generelt kan Thy-Noc-proceduren være egnet til at studere virkningen af ​​en forbindelse i G1-fase eller S-faseindtrængning, mens HU-medieret synkronisering kan være mere egnet til at studere virkningen i S til G2-faser eller i indgangen til mitose.
    1. Analyse af virkningen af ​​genotoksiske stoffer i G1 fase eller S fase indgang
      1. Synkroniser celler som beskrevet i 1.1.2. Til 1.1.6.
      2. Frigør celler fra nocodazol og genplacér dem som beskrevet i 1.1.7. Inkuber dem ved 37 ° C i en befugtet atmosfære med 5% CO2 i 3 timer for at lade dem vedhæfte før tilsætningsmiddel (den nødvendige inkubationsperiode kan variere afhængigt af cellelinjen).
      3. Tilsæt agent og indsamle prøver som tidligere beskrevet i 1.1.8.
    2. Analyse af virkningen af ​​genotoksiske stoffer i SG2 faser eller M-indgang
      1. Synkroniser celler som beskrevet i 1.2.2. Til 1.2.5.
      2. Frigør celler fra HU som beskrevet i 1.2.6. Og tilsæt agent straks.
      3. Saml prøver som tidligere beskrevet i 1.8.
  4. Overvågning af cellesynkronisering og progression gennem cellecyklussen ved hjælp af propidiumiodid (PI) farvning og FACS analyse
    BEMÆRK: Prøver indsamlet på alle tidspunkter sammen med dem, der kræves for at definere FACS-indstillinger, kan opbevares ved 4 ° C, når de er blevet rettet (som nævnt i 1.1.8.2). Udfør farvning med PI-opløsning efterfulgt af FACS-analyse for alle prøver af eksperimentet samtidigt. PI interkalkerer ind i hovedsporet af dobbeltstrenget DNA, der producerer et stærkt fluorescerende signal, når det ophidses ved 535 nm med en bred emissionstopp omkring 600 nm. Da PI også kan binde til dobbeltstrenget RNA, er det nødvendigt at behandle cellerne med RNase for optimal DNA-opløsning.
    1. Forbered frisklavet PI-farvningsløsning. En PI stamopløsning kan fremstilles ved at opløse PI-pulver i PBS ( f.eks. 5 mg / ml). Opbevar stamopløsningen ved 4 ° C (i mørke). Farveopløsning er sammensat af PI (140 μM), natriumcitrat (38 mM) og Triton X-100 (0,01% v / v).
    2. Opvarm en passende overflade ( f.eks. Ovn) til 37 ° C.
    3. Centrifuger faste celler (450 xg, 5 min, RT), dekanter supernatant (ethanol) og vask en gang med 1x PBS.
    4. Centrifuger cellerne igen, fjern PBS og tilsæt 300 μl PI-farvningsopløsning pr. Prøve (undtagen til en af ​​prøverne for FACS-indstillinger, tilføj PBS til denne prøve i stedet).
    5. Overfør celler til FACS-rør (5 ml runde polystyrenrør).
    6. Tilsæt 1 μL RNase A til hver prøve, bland og inkuber prøver i 30 minutter i mørke ved 37 ° C. Prøver kan opbevares beskyttet mod lys ved 4 ° C i maksimalt 2 - 3 dage.
    7. Analyser DNA-indhold i prøver ved flowcytometri. Definer FACS analyse kompensationsindstillinger med PI-farvet asynkron prøve. Brug blank prøve (uden PI-farvningsløsning) for at kontrollere autofluorescens. Grundlæggende om PI-farvningsmedieret analyse af DNA-indhold ved hjælp af flowcytometri er tidligere blevet beskrevet 9 .
  5. Bestemmelse af mitotisk indeks ved dobbelt phospho-H3 (Ser 10) / PI farvning
    BEMÆRK: Celler under mitose kan let registreres ved flowcytometri med antistoffer, der er specifikke for phospho-histon H3 i serin 10 (pH3). En samtidig PI-farvning er nyttig til bestemmelse af DNA-indholdsbaseret fordeling af cellepopulationen. Der kræves 5 prøver til de optimale konfigurationer af FACS-indstillinger: blankt, kun PI, kun pH3, sekundært antistof-kun og dobbelt farvning.
    1. Centrifuger faste celler (450 xg, 5 min, 4 ° C) og kasserer supernatanten. De følgende trin er beskrevet for at udføre farvning i 15 ml rør.
    2. Vask celler ved at tilføje 1Ml PBS-T (PBS + 0,05% Tween-20) til pelleten og centrifugen (450 xg, 5 min, 4 ° C). Fjern supernatanten.
    3. Tilsæt anti-pH3-antistof fortyndet (1: 500) i 100-200 μl PBS-T + 3% BSA og inkuber med rockning i 2 timer ved RT (eller O / N ved 4 ° C).
    4. Tilsæt 2 ml PBS-T (PBS + 0,05% Tween-20) og centrifuge (450 xg, 5 min, 4 ° C). Fjern supernatanten.
    5. Vask endnu engang ved at tilsætte 2 ml PBS-T til pelleten, centrifuge og kassere supernatanten.
    6. Tilsæt sekundært antistof (anti-kanin AlexaFluor 488 i tilfælde af valgt pH3-antistof) fortyndet (1: 500) i 100-200 μl PBS-T + 3% BSA og inkuber med rocking i 1 time ved RT (eller O / N Ved 4 ° C). Beskyt prøver fra lys.
    7. Vask to gange med PBS-T (2 ml) ved centrifugering som beskrevet i trin 1.5.4.
    8. Udfør PI-farvning som beskrevet (trin 1.4.1 til 1.4.6).

2. Prøveopsamling og procesbehandling til genuttryksanalyse

  1. Tage1,5 ml mikrocentrifugeprøver i RNA-isolationsreagenset ud af fryseren og lad dem optøne ved stuetemperatur inde i et sikkerhedsskabe til kemikalier.
  2. Tilsæt 400 μL chloroform til hver prøve og skak kraftigt (men ikke vortex) indtil fuldstændig blanding. Inkuber prøver i 5 minutter ved stuetemperatur.
  3. Centrifugerør i 15 minutter (≥8000 xg, 4 ° C) i en mikrobølgeovn.
  4. Overfør den vandige (øvre) fase til et nyt 1,5 ml mikrocentrifugerør og registrer det overførte volumen (for at forenkle proceduren anbefales det at samle lige mængder i alle prøver af eksperimentet).
  5. Tilsæt 1 volumen 100% ethanol langsomt (drop-by-drop) til den vandige fase under blanding. Må ikke centrifugeres.
  6. Udfør de næste trin med det kommercielle RNA mini prep kit. Pipet op til 700 μL af hver prøve, herunder eventuelt bundfald, der er dannet i en rotationssøjle i et 2 ml opsamlingsrør (leveret af fabrikanten).
  7. LukLåg og centrifuge (≥ 8.000 g, RT) i 15 s. Kassér gennemstrømningen. Gentag foregående trin med den resterende prøve (hvis nogen).
  8. Følg fremstillingsvejledning til RNA-vask og eluering (eluer hver prøve i 30-40 μl nukleasefri H20 for at opnå en passende RNA-koncentration for næste trin).
  9. Bestem RNA-koncentration og renhed af prøver ved absorbansmålinger (et A 260/280 forhold på 2,0-2,1 indikerer god renhed af RNA-prøven). Opbevar RNA prøver ved -80 ° C indtil anvendelse til RT-qPCR analyse.
  10. For RNA-omdannelse til cDNA og efterfølgende kvantitativ-PCR, tag 1 μg RNA pr. Prøve og forberede retrotranscriptase-reaktion i overensstemmelse med producentens instruktioner. Opnådde cDNA-prøver kan opbevares ved 4 ° C (i et par dage) eller ved -20 ° C (i længere perioder).
    BEMÆRK: Prøveforberedelse, primerdesign og andre overvejelser til realtids-PCR har været exTætsomt beskrevet i litteraturen 22 , 23 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Skematisk repræsentation af Thy-Noc og HU-baserede protokoller til cellesynkronisering.

Figur 1 opsummerer de trin, der kræves for U2OS-cellesynkronisering og efterfølgende prøveopsamling for at verificere progression gennem cellecyklussen og for at udføre genekspression analyser.

Phospho-H3 og PI-farvning er gode evalueringsparametre til at vælge synkroniseringsmetoder.

Cellesynkroniseringsprocedurer skal vurderes og optimeres for hver cellelinie på grund af iboende heterogenitet af dyrkede celler. Synkronisering i mitose opnås typisk med Thy-Noc-protokollen, og berigelse af mitotiske celler efter behandling med nocodazol kan vurderes med antistoffer, der er specifikke for phosphoryleret histon H3 (pH3), en typisk mitotisk markør. ide Ntificering af pH3-positive celler gør det muligt at diskriminere mellem mitotiske celler og dem med et 4C-DNA-indhold, der ikke undergår mitose (som alle betragtes som en "G2" -population ved PI-farvning). I U2OS-celler fører Thy-Noc-protokollen til en signifikant berigelse af en population med 4C DNA-indhold (figur 2A, øvre venstre graf, blå population ved PI-farvning), og den relative fraktion af mitotiske celler i denne population var rutinemæssigt ret ren (ca. 91% sammenlignet med 2% i asynkrone celler). Frigivelse fra nocodazol resulterer i en synkroniseret progression af celler til den næste G1-fase som bestemt ved akkumulering af en population med 2C DNA-indhold ( Figur 2A , øverste højre graf, grøn population ved PI-farvning) og den nærmeste forsvinden af ​​pH3-positive mitotiske Celler ( figur 2A , nederste højre graf). Således bekræftede pH3-farvningsresultater egnetheden af ​​Thy-Noc-protokollen til mitotisk synkronisering af U2OS-celler.

E_content "fo: keep-together.within-page =" 1 "> Synkronisering af U2OS-celler i G1 / S blev testet med thymidin og hydroxyurea, to udbredte synkroniseringsapparater. Berigelse i forskellige faser af cellecyklussen blev bestemt ved PI-farvning og FACS-analyse og procentdel af celler opsummeret i en tabel ( Figur 2B ). En 24-timers eksponering af U2OS-celler til Thy (2mM) var ineffektiv ved arrestering af celler i G1 / S-grænse ( figur 2B ), mens behandling med HU eller med en dobbelt Omdrejningstal af thymidin (DT) resulterede i en tilfredsstillende arrestering. Kun HU-behandlede celler blev imidlertid fuldstændigt genvundet fra anholdelsen og udviklet sig tilstrækkeligt gennem cellecyklussen. Derimod inducerede DT-blok en permanent G1-arrest i en signifikant del af cellepopulationen ( 13,3% af cellerne i G1 ved 6 h tidspunkt med DT vs 3,1% med HU-baseret protokol), hvilket negativt påvirket cellens synkronisering. Derfor anbefales eksponering for HU som en passende G1 / S synkroniseringsmetodeOd for U2OS-celler.

Thy-Noc- og HU-baserede protokoller er komplementære til cellesynkronisering.

Som vist i figur 3A (0 h tidspunkt) arresterede behandling med Thy-Noc-protokol effektivt U2OS-celler i M-fase-indgang (population med 4C DNA-indhold vist i blåt) og behandling ved HU-protokol-arresterede celler i G1 / S-grænsen (Population med 2C DNA-indhold, vist i grøn / rød). Efter fjernelse af lægemidlerne trådte celler ind og udviklede sig gennem cellecyklussen på en synkroniseret måde. Celler, der blev genvundet fra Thy-Noc-behandlingen, blev først observeret i den tidlige G1-fase (population i grønt) og efterfølgende overført gennem G1 og op til S-fasen på en ensartet måde. Celler, der blev genvundet fra HU-behandling, udviklede sig synkront gennem S (population i rødt) og G2 / M. Progression gennem den næste cellecyklus var samtidig med tabet af synkronicitet. ConsequentlY, tidspunkter over 15 timer blev ikke medtaget i disse analyser på grund af tab af synkronicitet efter dette tidspunkt.

Western blot-analyse af cyclin E1 (en G1 / S cyclin) og Cyclin B1 (en G2 / M cyclin), to proteiner, hvis niveauer er tæt reguleret i cellecyklussen og af den mitotiske markør pH3, bekræftede cellecyklusfasen af ​​hver Tidspunkt analyseret af FACS ( figur 3B ). Som forventet viste celler i M-fase (svarende til 0 h tidspunkt for Thy-Noc-synkroniserede celler) og celler i G2 til M fase (9 h til 12 h tidspunktspunkt for HU-synkroniserede celler) en dramatisk ophobning af cyclin B1 Og uopdagelige niveauer af cyclin E1. Endvidere var cyklin B1-niveauer lave til ikke detekterbare i G1-fase (3 timer efter frigivelse fra nocodazol), og gradvis akkumulering blev observeret, da cellerne blev fremskredet gennem S (efter Thy-Noc-frigivelse) og ind i G2 (efter HU-frigivelse). Sterk pH3-mærkning af celler ved 0 timer efter Thy-Noc synkroniseringPå bekræftet berigelsen af ​​celler arresteret ved mitose på dette tidspunkt. En lille stigning på pH3 niveauer ved 12 timer efter frigivelse fra HU viste, at størstedelen af ​​celler med 4C DNA-indhold stadig var i G2, mens andelen af ​​celler i mitose blev forøget ved 15 timer tidspunkt. I modsætning hertil viste ekspressionsmønsteret for cyclin E1 en progressiv akkumulation fra tidlig G1 til S-fase indgang (Thy-Noc procedure) og gradvis forsvinden i G2 / M fase (HU procedure).

Ekspression af gener, som er differentielt reguleret i cellecyklussen, kan analyseres nøjagtigt med en kombination af Thy-Noc- og HU-baserede synkronisering.

Som et bevis på, at cellecyklusreguleret genekspression analyse bedst analyseres ved en kombination af to celle synkroniseringsmetoder, mRNA ekspression af to E2F familiemedlemmer vides at have forskellig ekspressionskinetik i cellecyklussen(E2F1 og E2F7) blev undersøgt ved revers transkriptase kvantitativ PCR (RT-qPCR). Til dette formål blev Thy-Noc og HU-synkroniseringsprotokoller anvendt som opsummeret i figur 1 , og cellecyklusfordeling blev overvåget ved flowcytometri som vist i figur 3A . Figur 4 viser E2F1 (øvre to grafer) og E2F7 (nedre to grafer) mRNA profiler gennem cellecyklussen. Transkriptionsreguleringsprofilen af ​​E2F1-kodende gen blev bedst observeret ved Thy-Noc-proceduren, hvorved E2F1-ekspression begyndte gradvist at stige fra den tidlige G1-fase for at nå en top ved sen G1-fase (9 timer efter Thy-Noc-frigivelse, grøn baggrund). Dens niveauer faldt derefter, samtidig med at man kom ind i S og G2 faser (rød og blå baggrunde). I modsætning hertil blev E2F7-genekspressionskinetikken bedst registreret efter HU-baseret synkronisering (lavere graf; rød baggrund) med en spidsekspression på 6 timer fra frigivelse (svarende til S til G2-faseovergang). Thy-NocProceduren var på den anden side egnet til at observere induktion af E2F7, men ikke dens downregulering. Til gengæld reproducerede forlængelsen af ​​analysen ud over 15 timers tidpunkt E2F1- og E2F7-mRNA-ekspressionsprofiler af tidligere tidspunkter, skønt med en reduceret rækkevidde af mRNA-variation (data ikke vist). I alt bekræfter disse resultater betydningen af ​​at arbejde med en korrekt synkroniseret cellepopulation for at vurdere ikke kun genekspressionskinetikken, men også den nøjagtige amplitude af ændringer i mRNA-niveauerne.

Cellesynkronisering giver en bedre forståelse af genekspressionsprogrammet påvirket af kræftbehandling.

For at analysere effekten af ​​antitumormedicinet mitomycin C (MMC) i cellecykeldynamik såvel som i genekspression blev U2OS-celler først synkroniseret med HU og efterfølgende behandlet med MMC. Eksponering for dette genotoksiske middel aktiverede en checkpoinT i G2 fase, der var tydeligt efter 15 timers eksponering ( Figur 5A , nederste række, blå top). I modsætning hertil udviklede ubehandlede celler normalt gennem G1 på dette tidspunkt ( Figur 5A , øvre række, grønne top). Langsigtet MMC-behandling (36 timer) afslørede en permanent anholdelse af celler i G2-fase, mens celler uden MMC-behandling udviser en cellecyklusfordeling, der lignede den, der blev vist af asynkroncellepopulationen.

E2F1 og p21 Cip1 (CDKN1A) blev valgt til genekspression analyse i MMC-behandlede celler ( Figur 5B ), givet deres forskellige cellecyklusafhængige regulering. Ekspression af E2F1 er G1-faseafhængig som beskrevet i figur 4 , hvorimod induktion af p21- Cip1- ekspression er koblet til cellecyklusoptagelse / kontrolpunktsaktivering 24 . Som vist i figur 5B (øverste venstre graf), E2F1-genekspression kiNetik var ens i nærvær eller fravær af MMC, idet cellerne udviklede sig gennem G1 / S og i S-fase. Forskelle i E2F1-genekspression blandt MMC-behandlede og ubehandlede celler blev observeret efter 15 timers eksponering for MMC, hvorved MMC-behandlede celler udtrykte lavere E2F1-mRNA-niveauer end kontrolceller ( figur 5B , sammenligne faste og punkterede linjer). På trods af den klare forskel i udtryk kan det imidlertid ikke konkluderes, at MMC nedregulerer E2F1-udtryk, fordi cellecyklusprofiler af MMC-behandlede og ubehandlede celler klart er forskellige i disse senere tidspunkter på grund af en vedvarende G2-fasearrest pålagt af MMC. Faktisk afspejler lave E2F1-mRNA-niveauer efter 15-tiden i MMC-eksponerede celler sandsynligvis en virkning af lægemidlet i cellecykeldynamik, snarere end en virkning af MMC i E2F1-transkriptionel regulering.

I modsætning til E2F1 er p21 Cip1 et MMC-responsivt gen. Forhøjede niveauer på s21 Cip1 blev detekteret ved HU-pålagt G1 / S-arrestation, hvilket indikerer G1-kontrolpunktsaktivering ved HU ( Figur 5B , 0 timepunkt) og dets ekspression blev derefter reduceret i ikke-MMC-behandlede celler i overensstemmelse med en uperturbed cellecyklusprogression efter frigivelse fra anholdelse. I modsætning hertil førte MMC-behandling til forhøjede p21- Cip1- mRNA-niveauer ( Figur 5B , øverste højre graf, fast linje), mens cellerne akkumulerede i G2-fase (9 h MMC-eksponering). På trods af det faktum, at cellecyklusprofiler var ens i 9 h tidspunktet i kontrol- og MMC-behandlede celler, viser genekspression analyse en fundamental forskel. MMC-eksponerede celler viste et aktiveret G2-kontrolpunkt, der blev påvist ved induktion af p21 Cip1- ekspression, mens ubehandlede celler gennemgik en upertureret overgang gennem G2 med lave p21 Cip1- niveauer.

Data opnået ved flowcytometrianalyse ( FiGure 5A) og data resulterende fra RT-qPCR ( Figur 5B , øvre grafer) blev kombineret i en enkelt graf for hvert af de valgte gener ( Figur 4B , nedre grafer). MRNA ekspressionsniveauer, hvor den viste sig som den relative højde af stængerne, mens cellesykkelfordeling af celler for hver prøve blev illustreret med andelen af ​​farver: grønt til G1-fase (2C DNA-indhold), blå for G2-fase (4C DNA-indhold) og rødt For S-fase (mellemliggende DNA-indhold). Denne kombinerede metode til grafisk repræsentation kan være nyttig til at fortolke cellecyklusfordeling og genekspression analyser.

Sammenfattende tillod genekspressionanalyse koblet til en kultursynkroniseringsmetode identifikationen af ​​et genotoksisk middel-responsivt gen (p21 Cip1 ) og førte til at foreslå, at ændringer observeret ved E2F1-ekspression mellem celler behandlet og ubehandlet med midlet var indirekte, ogMuligvis relateret til forskelle i cellecyklusfordeling af celler.

figur 1
Figur 1: Oversigt over to komplementære cellesynkroniseringsprotokoller: Thymidin-Nocodazol og Hydroxyurea. ( A ) Grafisk repræsentation af pattedyrcellecyklussen, der angiver de punkter, ved hvilken cellecyklusarrest opnås ved cellesynkroniseringsmetoder. Thy-Noc-baseret procedure blokkerer celler i tidlig mitose (M), mens HU blokerer celler ved G1 / S-grænsen. ( B ) Skematisk repræsentation af Thy-Noc-protokol for cellesynkronisering. Vist er de trin, der typisk anvendes til genekspression analyse og celle cyklus overvågning i U2OS celler. ( C ) Skematisk repræsentation af HU-baseret protokol for cellesynkronisering. Vist er de trin, der typisk anvendes til genekspression analyse og cellecyklus overvågning i U2OS celler. En kortere synkroniseringsprocedure, der udelukker serumsultation, kan også anvendes, hvis optimal synkronisering allerede er opnået ved en 24 timers eksponering for HU. Klik her for at se en større version af denne figur.

Figur 2
Figur 2: Vurdering af egnede synkroniseringsmetoder. ( A ) Asynkrone og Thy-Noc-synkroniserede U2OS-cellekulturer blev udsat for pH3-farvning for at vurdere fraktionen af ​​mitotiske celler i hvert tilfælde. Samtidig PI-farvning tillod overvågning af DNA-indholdet i celler. I den asynkrone population var kun en minimal fraktion af celler med 4C DNA-indhold (i blåt) positive for mitosemarkøren. I modsætning hertil akkumuleres Thy-Noc-protokollen effektivtMulerede celler i mitose (positiv til pH3-farvningen) og tillod korrekt progression til den næste G1-fase (i grønt) ved fjernelse af nocodazol (3 timer tidspunkt). Procentdelen af ​​celler i hver fase opsummeres i tabellen og mærkes med farver i overensstemmelse med dem, der anvendes i PI histogrammerne: grøn for 2C DNA-indholdsceller (G1), blå for celler med 4C DNA-indhold (herunder G2 og M-celler og betegnet som G2 i histogrammerne for at forenkle figuren og rød for celler med mellemliggende DNA-indhold (S). ( B ) Thymidin og HU blev vurderet for deres cellecyklussynkroniseringseffektivitet i U2OS-celler. Celler blev behandlet med thymidin (en eller to Runder) eller med HU i 24 timer, og cellesynkronisering blev undersøgt ved PI-farvning og FACS-analyse. Summit blev brugt til FACS-dataanalyse. Klik her for at se en større version af denne figur.

Figur 3
Figur 3: Udformning af tidsrammen for ensartet fremgang af celler efter Thy-Noc- og HU-medieret synkronisering. ( A ) U2OS-celler blev synkroniseret i M-fase med Thy-Noc-protokollen (øverste række) eller i G1 / S-overgang ved HU-protokol (nederste række). Cellecyklusprogression blev overvåget ved PI-farvning og FACS-analyse af DNA-indholdet i celler hver 3. time efter frigivelsen fra kemikalier. Summit blev brugt til FACS data analyse. Celler frigivet fra Thy-Noc-medieret arrest anbragte synkront i den tidlige G1 fase efter 3 timer, og udviklede sig ensartet op til S-fase ved efterfølgende tidspunkter. Celler udgivet fra HU-medieret arrest blev overført synkront gennem S og G2 faser. Celler indsamlet 15 timer efter frigivelse repræsenterede grænserne for cellesynkronisering, da fremskridt til næste fase kun var opnåetD af en brøkdel af befolkningen. ( B ) Cellesynkronisering blev overvåget ved Western blot-analyse ved at samle proteinprøver hver 3. time og op til 15 timer efter frigivelse. Ekspressionskinetik af Cyclin E1 (CCNE1), en cyclin, der hovedsagelig akkumuleres gennem S-fasen, cyclin B1 (CCNB1), hovedsagelig til stede fra G2 til M-fase og pH3, en markør for mitotiske celler, bekræftede cellecyklusfordelingsprofiler observeret ved flowcytometri. Actin B (ACTB) blev anvendt som en endogen belastningskontrol, fordi dens niveauer ikke er cellecyklusafhængige. (Som modificeret fra Mitxelena et al . 8 ). Klik her for at se en større version af denne figur.

Figur 4
Figur 4: Undersøgelse af Cellecyklusfase-afhængighed T Transkription af E2F familiemedlemmer efter supplerende cellesynkroniseringsmetoder. U2OS-celler blev arresteret i G2 / M ved Thy-Noc-protokol eller i G1 / S ved HU-behandling, og prøver blev opsamlet til RNA-ekstraktion og FACS-analyse hver 3. time op til 15 timer ved frigivelse fra arrest. Gene-ekspressionsanalyse ved RT-qPCR afslørede en E2F1-ekspressionsprofil, der blev omtalt hovedsageligt til G1 (øverste venstre graf), mens E2F7-genekspressionsprofilen blev skiftet til S-fase med en gradvis nedregulering gennem G2-fasen (nederste højre graf). TBP blev anvendt som endogent, ikke-cellecyklusreguleret gen til beregning af relative ændringer i mRNA-niveauer, og resultater blev repræsenteret som middelværdierne og standardafvigelsen (SD). Progression gennem cellecyklus blev bestemt ved PI-farvning og FACS-analyse af DNA-indholdet i celler. Cellecyklusfaser blev repræsenteret som baggrundsfarver i grafer: sort (arrest ved tidlig mitose), grøn (G1 fase), rød (S fase) og blå (G2 fase)..com / files / ftp_upload / 55745 / 55745fig4large.jpg "target =" _ blank "> Venligst klik her for at se en større version af denne figur.

Figur 5
Figur 5: Virkning af MMC på genekspression og cellecyklusprogression. U2OS-celler blev behandlet med HU i 24 timer, og MMC (250 nM) blev tilsat umiddelbart efter frigivelse fra HU-medieret G1 / S-arrestation. Prøver til FACS analyse og genekspression analyse blev opsamlet ved angivne tidspunkter. ( A ) Progression gennem cellecyklussen blev bestemt ved PI-farvning og FACS-analyse af DNA-indhold ved hjælp af Summit-software. MMC inducerede en moderat forsinkelse i progressionen gennem S-fase (rød population) og en permanent anholdelse i G2-fase (blå befolkning) som vist ved fraværet af celler i G1 (grøn population) efter 15 timers behandling (nederste række) sammenlignet med Til ikke-Behandlede (øverste række) celler. ( B ) E2F1 og p21 Cip1 -genekspressionanalyse i MMC-behandlede eller ubehandlede celler blev udført på mRNA-niveauet med RT-qPCR. Oxa1L blev anvendt som et endogent ikke-MMC-responsivt gen, og resultater blev repræsenteret som middelværdier og SD. Øvre grafer repræsenterer relative mRNA-niveauer af udvalgte gener efter frigivelse fra HU og tilsætning af MMC. Nedre grafer kombinerer data opnået ved FACS analyse og RT-qPCR. Klik her for at se en større version af denne figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Analyse af finjusterede regulerede gener involveret i forbigående og specifikke roller i cellecyklussen kræver en ensartet cellepopulation. Mange forskere bruger rutinemæssigt langvarige tumorcellelinjer til disse formål, og der er udviklet en række metoder for at opnå synkroniserede (eller delvis synkrone) cellepopulationer med det formål at samle så mange celler som muligt i definerede cellecyklusfaser. Desuden er der gjort en stor indsats for at forbedre og optimere veletablerede synkroniseringsmetoder. Ikke desto mindre har alle synkroniseringsprotokoller ulemper, som kan henføres til heterogenitet af cellekulturer, til suboptimal effektivitet af synkroniseringsprocedurerne eller til sekundære virkninger, som kemiske synkronisatorer har i cellefunktion, blandt andre. Disse begrænsninger skal tages i betragtning ved anvendelse af celsynkroniseringsprotokoller. Forskere skal identificere de mest egnede synkroniseringsmetoder til deres specifikkeIscelle type eller eksperiment. Selv dyrkning af forskellige cellelinier på nøjagtig samme måde, resulterende synkroniseringshastigheder kan afvige på grund af flere grunde. På den ene side kan længden af ​​cellecyklusen variere afhængigt af den valgte cellelinie; På den anden side kan den samme inhibitor have kontrasterende virkninger på forskellige cellelinjer på grund af særlige karakteristika for hver cellelinie 25 . Desuden skal den valgte inhibitorkoncentration og eksponeringstid altid tilpasses hver cellelinie for at undgå eller minimere uønsket sidetoksicitet 26 . Selv efter optimering af alle disse aspekter opnås 100% ophobning af celler i en given cellecyklusfase aldrig, og asynkroni stiger gradvist efter fjernelse af kemikaliet 27 . Det er således vigtigt at forstå, at synkroniseringsmetoder opnår i bedste fald delcellepopulationer i en bestemt tidsramme.

I denne w Ork to synkroniseringsprocedurer (Thy-Noc og HU) er blevet optimeret til deres anvendelse i U2OS-celler, som begge er udbredt anvendt til cellesynkroniseringsassays 28 , 29 , 30 . Til at arrestere celler i M-fase fungerede en kombination af thymidin og nocodazol effektivt i U2OS-celler. I betragtning af nocodazols cytotoksiske karakter var det vigtigt at bestemme eksponeringstiden og dosen af ​​denne hæmmer for at opnå ikke blot en stærkt synkroniseret cellepopulation, men også optimal celleoverlevelse. Forudgående eksponering for thymidin (eller teoretisk enhver anden lignende forbindelse som hydroxyurea) førte til en berigelse af cellepopulationen i G1- og S-faser, hvorved den nødvendige nocodazoleksponeringstid blev reduceret. Til arrestation af celler i G1 / S blev flere muligheder overvejet, herunder dobbelt thymidinblok, en metode, der er meget effektiv ved synkronisering af flere cellelinier"> 31 , 32. Imidlertid blev thymidin kasseret givet sine skuffende resultater i U2OS. En runde af thymidinbehandling arresterede kun en brøkdel af celler, mens to runder af thymidinbehandling effektivt blokerede størstedelen af ​​cellerne i G1 / S, men en G1 Population blev opretholdt efter frigivelse fra thymidin, og cellecyklusprogressionen gik ikke ensartet. Til gengæld gav hydroxyurea-behandling gode G1 / S-blokeringsresultater og ensartet progression af celler gennem S og ind i G2.

Cellecyklusfasefordeling bør undersøges, når der udføres cellesynkroniseringsforsøg ( fx ved propidiumiodidfarvning eller pH3-mærkning efterfulgt af FACS-analyse eller ved immunblotting af cellecyklusfase-specifikke proteiner) 16 , 33 , 34 for bedre at fortolke genekspression resultater. En forkert synkroniseringseffektivitetNcy eller små inter-eksperimentelle forskelle i progressionen gennem cellecyklusen kan føre til forkerte konklusioner. For eksempel er nocodazolbehandling kendt for at forårsage svigt i mitotisk kontrolpunktsfunktion under visse betingelser. Dette giver anledning til en population af celler med 4C DNA-indhold, men negativ for mitotiske markører 34, der "slipper" mitotisk division og vender tilbage til interfase med et 4C-indhold 35 . Fremkomsten af ​​denne delmængde af celler, som kan detekteres ved immunfarvning med anti-phospho-H3-antistoffer (se figur 2A ), kan minimeres ved anvendelse af kold PBS til nocodazol-vaskningstrinnene. En anden effekt forbundet med brugen af ​​kemiske inhibitorer, der påvirker cellesynkroni er checkpunktaktivering associeret med eksponering for disse forbindelser 36 , 37 , en mekanisme, hvormed cellen aktivt arresterer progression gennem cellecyklussen, indtil den kanSikre, at processer tidligere til det præcise punkt (fx korrekt DNA replikation, spindel samling) er løst 38 . For at en synkroniseringsmetode skal være tilstrækkelig, skal anholdelsen ikke kun være effektiv, men også fuldstændig reversibel. Således er det efter frigivelse af cellecyklusinhibitorer vigtigt at analysere, hvorvidt inhibitorens virkninger er blevet vendt, for eksempel ved at analysere ekspression af kontrolpunktmarkører, såsom p21 CIP . Figur 5B viser, at hydroxyureasynkroniserede U2OS-celler effektivt løst kontrolpunktet, fordi p21- CIP- niveauer blev reduceret til basal ekspression efter frigivelse.

I U2OS-celler falder berigelsesprocenterne ved cellecyklusarrest inden for det interval, der er rapporteret af andre undersøgelser af cellesynkronisering 29 , 30 , 39 : ca. 85% af cellerne med 4C DNA-indhold (PI-farvning) og ca.Moderat 90% af dem i mitose (pH3 positiv mærkning) ved behandling med thymidin-nocodazol og omkring 80-90% af G1 / S celler efter hydroxyurea behandling. Frigivelse fra cellecyklusarrest kører typisk korrekt fremgang gennem den næste eller to faser på en ensartet måde, selvom synkronisering tabes uafbrudt efter flere timer, og celler ikke er i stand til at afslutte en hel celleopdelingscyklus på en synkroniseret måde. For at få et fuldstændigt billede af alle faser af cellecyklussen bruger derfor protokollen, der foreslås i dette værk, to synkroniseringsmetoder fra forskellige dele af cellecyklussen. Som vist i figur 3A sikrede hver enkelt protokol ikke synkronitet over en hel cellecyklus. Thy-Noc-baseret synkronisering tilvejebragte en passende ramme for processer, der forekom i G1 til S-faser, medens celler udgivet fra HU var egnede til analyse af hændelser, der fandt sted under S og G2 / M. Komplementariteten af ​​de valgte to procedurerEs blev demonstreret ved analysen af ​​to medlemmer af E2F transkriptionsfaktorfamilien ( figur 4 ), der understøtter ideen om, at kombination af to metoder, som synkroniseres i forskellige faser af cellecyklussen, er en kraftfuld tilgang til nøjagtigt at etablere cellecyklusreguleret genekspression Mønstre og bedre forstå deres fysiologiske rolle.

En overbevisende anvendelse af cellesynkroniseringsprocedurer fokuserer på evaluering af virkningen af ​​potentielle terapeutiske midler. Virkningen af ​​farmaceutiske forbindelser, såsom dem med antitumoraktivitet, studeres ofte i asynkrone cellepopulationer. Under disse indstillinger er det muligt at bestemme implikationen af ​​det valgte lægemiddel ved induktion af flere processer såsom celledød, cellecyklusarrest eller senescens 7 , 40 . Men udvælgelse af asynkrone celleindstillinger til identifikation af præcise molekylære begivenheder regulerendeSådanne processer kan føre til ufuldstændige eller delvis forkerte konklusioner. Dette punkt, som ofte overses, er blevet illustreret i det foreliggende arbejde ved at analysere effekten af ​​det kemoterapeutiske lægemiddel MMC på E2F1 og p21 Cip1 -genekspression ( Figur 5 ). Samlet set tilvejebringer kombinationen af ​​cellesynkronisering og behandling med genotoksiske midler en egnet kontekst til at studere ekspressionen af ​​gener, som reagerer på det genotoksiske middel og at diskriminere fra dem, der er ramt af cellecyklusforstyrrelser pålagt af agenten.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Vi takker medlemmerne af Zubiaga og Altmeyer laboratorierne for nyttige diskussioner og teknisk support. Dette arbejde blev støttet af tilskud fra det spanske ministerium (SAF2015-67562-R, MINECO / FEDER, UE), den baskiske regering (IT634-13 og KK-2015/89) og universitetet i Baskerlandet UPV / EHU UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
Studie af Cyklusreguleret Gen Expression af To Komplementære Celle Synkronisering Protokoller
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter