Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Étude de l'expression génétique régulée par un cycle cellulaire par deux protocoles complémentaires de synchronisation cellulaire

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

Nous rapportons deux protocoles de synchronisation cellulaire qui fournissent un contexte pour étudier les événements liés à des phases spécifiques du cycle cellulaire. Nous montrons que cette approche est utile pour analyser la régulation de gènes spécifiques dans un cycle cellulaire non perturbé ou lors de l'exposition à des agents affectant le cycle cellulaire.

Abstract

Le programme d'expression génique du cycle cellulaire représente une étape critique pour la compréhension des processus dépendants du cycle cellulaire et leur rôle dans des maladies telles que le cancer. L'analyse d'expression génique régulée par un cycle cellulaire dépend de la synchronisation cellulaire en phases spécifiques. Nous décrivons ici une méthode utilisant deux protocoles de synchronisation complémentaires qui sont couramment utilisés pour étudier la variation périodique de l'expression des gènes pendant le cycle cellulaire. Les deux procédures sont basées sur le blocage transitoire du cycle cellulaire dans un point défini. Le protocole de synchronisation par le traitement par l'hydroxyurée (HU) conduit à une arrestation cellulaire à la phase G1 / début S en retard, et la libération de l'arrestation médiée par l'HU fournit une population cellulaire progressant uniformément à travers S et G2 / M. Le protocole de synchronisation par le traitement par la thymidine et le nocodazole (Thy-Noc) bloque les cellules dans la mitose précoce et la libération de l'arrestation médiée par Thy-Noc fournit une population cellulaire synchronisée adaptée à la phase G1 et à la phase S-enEssayer des études. L'application des deux procédures nécessite une surveillance des profils de distribution du cycle cellulaire, qui est habituellement effectuée après la coloration par l'iodure de propidium (PI) des cellules et l'analyse de la teneur en ADN par cytométrie en flux. Nous montrons que l'utilisation combinée de deux protocoles de synchronisation est une approche robuste pour déterminer clairement les profils transcriptionnels des gènes qui sont différentiellement réglementés dans le cycle cellulaire ( c.-à-d. E2F1 et E2F7) et par conséquent avoir une meilleure compréhension de leur rôle dans le cycle cellulaire Processus. En outre, nous montrons que cette approche est utile pour l'étude des mécanismes sous-jacents aux thérapies à base de médicaments ( c'est-à-dire la mitomycine C, un agent anticancéreux), car elle permet de discriminer les gènes qui réagissent à l'agent génotoxique de ceux qui sont uniquement affectés par des perturbations du cycle cellulaire Imposé par l'agent.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La transition à travers toutes les phases du cycle cellulaire est couplée à un programme d'expression génique étroitement réglementé. Ce «aller et à quitter» coordonné de la transcription des gènes tout au long du cycle cellulaire est censé être sous le contrôle de systèmes de régulation transcriptionnels complexes, en régulant non seulement le moment mais aussi les niveaux d'expression des gènes. La dérégulation des composants clés du cycle cellulaire est connue pour contribuer au développement de plusieurs maladies et est une caractéristique bien établie de la tumorigénèse 1 , 2 . Les analyses transcriptomiques à l'échelle du génome réalisées dans des cellules de levure et de mammifères ont révélé qu'un grand nombre de gènes présentent des schémas périodiques d'expression des gènes dans le cycle cellulaire, ce qui suggère que la fluctuation de la transcription pendant le cycle cellulaire reflète l'exigence temporelle d'un produit génique donné Dans une phase précise 3 , 4 , 5 .

Une tâche majeure dans l'étude de l'expression des gènes régulés par un cycle cellulaire est la synchronisation des cellules dans des phases spécifiques du cycle cellulaire. La synchronisation cellulaire aide à interpréter l'association d'un motif d'expression génique à une transition de phase de cycle cellulaire particulière et a permis de mieux comprendre la régulation et la fonction de nombreux gènes. La synchronisation cellulaire est également importante pour étudier le mécanisme d'action des médicaments anticancéreux, car les agents chimiothérapeutiques sont connus pour affecter à la fois l'expression des gènes ainsi que la cinétique du cycle cellulaire 6 , 7 . Néanmoins, il est souvent difficile de déterminer si les différences d'expression des gènes résultant du traitement avec ces agents sont une réponse directe au traitement ou sont simplement la conséquence de changements dans les profils du cycle cellulaire. Pour distinguer ces possibilités, l'expression des gènes doit être analysée dans les cellules qui ont été sYnchronisé avant l'addition du médicament chimiothérapeutique.

À l'exception de certaines cellules primaires telles que les cellules lymphoïdes fraîchement isolées - qui constituent une population cellulaire homogène synchronisée dans G0 8 -, les lignées cellulaires établies in vitro croissent de manière asynchrone en culture. Dans des conditions de croissance régulières, ces cellules cycliques asynchrones se retrouvent dans toutes les phases du cycle cellulaire mais, de préférence, dans G1 9 . Par conséquent, ce contexte ne fournit pas un scénario optimal pour les analyses d'expression fonctionnelle ou génétique dans une phase de cycle cellulaire spécifique ( p. Ex. G1, S, etc.). Les lignées cellulaires immortalisées non transformées ( p. Ex . Les fibroblastes) peuvent être synchronisées avec les méthodes dites physiologiques 10 . Ces méthodes sont basées sur les caractéristiques de cellules primaires retenues des cellules non transformées, telles que l'inhibition du contact cellulaire et la dépendance du facteur de croissance afin de continuer à faire du vélo. SuppressionDe sérum en combinaison avec une inhibition de contact rend les cellules non transformées arrêtées à G0 / G1. Cependant, l'entrée et la progression du cycle cellulaire synchronisée nécessitent souvent une sous-culture, qui implique également un détachement artificiel des cellules et une régénération 10 . Plus important encore, cette méthode n'est pas adaptée à la synchronisation des lignées cellulaires transformées, la grande majorité des lignées cellulaires établies actuellement utilisées, caractérisées par manque d'inhibition de la croissance médiée par contact cellulaire ou de réponse au retrait du facteur de croissance. Ainsi, il est clair que des méthodes alternatives sont nécessaires pour une synchronisation cellulaire efficace dans des phases spécifiques du cycle cellulaire. En termes généraux, les méthodes de synchronisation les plus fréquemment utilisées sont basées sur une inhibition chimique ou pharmacologique transitoire d'un point défini du cycle cellulaire, typiquement la synthèse de l'ADN ou la formation de la broche mitotique. L'inhibition de la synthèse de l'ADN synchronise les cellules en les arrêtant à la fin de la phase G1 ou début de la S. Cela peut être achevéPar addition de composés tels que la mimosine, un inhibiteur de la biosynthèse des nucléotides 11 , 12 , de l'aphidicoline, un inhibiteur des ADN polymerases 13 , 14 , de l'hydroxyurée, un inhibiteur de la ribonucléotide réductase 15 , 16 ou des quantités excessives de thymidine 17 , 18 . D'autre part, les inhibiteurs de la polymérisation des microtubules, tels que la colchicine ou le nocodazole, peuvent bloquer la formation de la broche mitotique conduisant à une synchronisation cellulaire au début de la phase M 19 , 20 , 21 .

Dans ce travail, nous décrivons une méthode impliquant deux protocoles de synchronisation complémentaires basés sur l'inhibition chimique transitoire pour étudier l'expression de gènes régulés par cycle cellulaire à l'ARNmniveau. Cette méthode est fondamentale pour définir le rôle des gènes du cycle cellulaire dans les processus spécifiques du cycle cellulaire. En outre, il fournit un cadre général pour étudier l'impact des traitements anticancéreux afin de détecter avec précision les gènes sensibles aux médicaments et de minimiser les mauvaises interprétations dérivées des perturbations de la progression du cycle cellulaire générées par ces médicaments.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Synchronisation cellulaire, libération et surveillance de la progression du cycle cellulaire

  1. Synchronisation à base de thymidine et de nododazole (Thy-Noc) et libération de cellules U2OS à partir de la mitose
    1. Préparer le milieu de culture cellulaire requis. Les cellules U2OS sont habituellement cultivées dans du milieu DMEM-Glutamine complété par 10% (vol / vol) FBS (facultatif: 1% de pénicilline / streptomycine). Effectuer toute la préparation et la manipulation du milieu dans des conditions stériles et réchauffer le support complémentaire (désormais appelé «support complet») à 37 ° C avant utilisation.
    2. Graine 2 x 10 6 cellules U2OS par plat 100 mm dans 10 mL de milieu de culture complet. Pour calculer le nombre de vaisselles nécessaires, prenez en compte que chaque plat 100 mm fournit généralement suffisamment de cellules mitotiques pour recharger environ 5 puits d'une plaque de 6 puits (0,2 à 0,25 x 10 6 cellules / puits) (voir la figure 1B ). Deux puits par point de temps sélectionné sont requisDans l'expérience (1 puits pour l'extraction de l'ARN et 1 puits pour la surveillance du cycle cellulaire). En outre, un troisième puits peut être collecté par point de temps pour l'analyse des protéines.
      REMARQUE: les cellules de plaque dans la soirée (vers 19 heures) afin que les étapes suivantes puissent être effectuées pendant les heures de travail les jours suivants. Inclure 2 puits supplémentaires de cellules de croissance asynchrone pour définir les paramètres de compensation d'analyse FACS.
    3. Laisser les cellules se fixer en incubant des plats de 100 mm à 37 ° C dans une atmosphère humidifiée avec 5% de CO 2 pendant 24 h.
    4. Pour le bloc de thymidine, préparer une solution mère de thymidine 200 mM en dissolvant 145,2 mg de poudre de thymidine dans 3 ml de H2O (ou des quantités équivalentes) et stériliser la solution par filtration à travers un filtre de taille de pores de 0,2 μm. Un léger réchauffement pourrait aider à dissoudre la thymidine. Ajouter 100 μL du stock 200 mM fraîchement préparé à chaque plat de culture 100 mm (concentration finale 2 mM). Incuber les cellules avec de la thymidine pendant 20 h à 37 ° C76; C dans une atmosphère humidifiée avec 5% de CO 2 .
      REMARQUE: traiter les cellules le soir (vers 19 heures), avoir le temps d'effectuer la libération de la thymidine et le blocage du nocodazole le lendemain.
    5. Pour libérer du bloc de thymidine, retirer le milieu de croissance contenant de la thymidine dans l'après-midi du lendemain (15 heures); Laver les cellules deux fois avec 1x PBS préchauffé et ajouter 10 ml de milieu complet à chaque plat de 100 mm. Incuber les cellules pendant 5 h à 37 ° C dans une atmosphère humidifiée avec 5% de CO 2 .
    6. Pour l'arrêt des cellules mitotiques, ajouter du nocodazole à une concentration finale de 50 ng / mL (20 h). Préparer une solution mère en dissolvant la poudre de nocodazole dans du DMSO ( par ex. 5 mg / mL) et conserver congelé à -20 ° C. Incuber les cellules avec du nocodazole pendant plus de 10 à 11 h à 37 ° C dans une atmosphère humidifiée avec 5% de CO 2 .
    7. Libération de l'arrestation médiée par nocodazole au début de la phase M (mitotic shake-off) et collecte d'échantillons à plusieurs reprises poiNts (à partir de 6-7 heures).
      1. Détachez les cellules arrondies (mitotiques) en secouant chaque plaque et en pipetteant doucement le milieu de croissance contenant du nocodazole. Recueillir le milieu avec des cellules détachées de chaque plaque de 100 mm dans des tubes stériles de 50 ml, centrifuger (300 xg, 5 min, température ambiante (RT)) et les cellules de lavage deux fois en ajoutant 1x PBS puis centrifuger. L'utilisation de PBS froid ou PBS plus nocodazole est recommandée pour éviter le glissement mitotique (voir la section Discussion).
      2. Remettre en suspension les cellules mitotiques recueillies à partir de chaque plaque de 100 mm dans 10 ml de milieu complet. Économisez 2 mL pour l'extraction de l'ARN et 2 mL pour l'analyse FACS pour le point de temps 0 h (environ 0,2-0,25 x 10 6 cellules par échantillon).
      3. Remplacer les cellules mitotiques restantes pour les points de temps suivants dans des plaques à 6 puits (2 ml / puits, 0,2-0,25 x 10 6 cellules / puits).
        REMARQUE: Rappelez-vous que 2 puits sont requis par point de temps sélectionné (1 pour l'ARN et 1 pour l'analyse FACS).
    8. Collecter des échantillons à selPoints de temps écoulés. Toutes les 1,5 à 3 h sont recommandées afin d'obtenir un profil adéquat de la progression du cycle cellulaire.
      1. Pour l'extraction de l'ARN, retirer le milieu, rincer bien avec 2 mL de préchauffage 1x PBS et ajouter 1 mL de réactif d'isolement d'ARN approprié ( p. Ex . TRIzol) dans le puits (effectuer cette dernière étape dans une armoire de sécurité pour les produits chimiques). Pipeter vers le haut et vers le bas pour détacher et lyse les cellules, transférer le lysat cellulaire dans un tube de microcentrifugeuse de 1,5 mL, incuber 5 min à la RT et conserver le tube à -80 ° C jusqu'à l'utilisation ultérieure.
      2. Pour l'analyse FACS, rincer bien avec 2 mL de pré-chaud 1x PBS, ajouter une solution de trypsine-EDTA préalablement chauffée (0,3 mL / puits) pour détacher les cellules, bloquer la trypsine-EDTA en ajoutant 1 mL de milieu complet et collecter chaque échantillon séparément Tube de 15 mL.
        1. Centrifuger les cellules (300 xg, 5 min, RT), sauver la granulation cellulaire et éliminer le surnageant. Afin de corriger les cellules, remettre à neuf les cellules dans 1 ml d'éthanol refroidi à 70% (v / v) dans 1x PBS par des tubes à vortex doux et les placer sur la glace pour l'applicationEnviron 15 min avant le stockage à 4 ° C ou à la coloration pour une analyse plus approfondie par FACS (décrit dans les étapes 1.4 à 1.5).
  2. Synchronisation et publication de cellules U2OS basées sur HU à partir de la frontière G1 / S
    1. Préparer un milieu de culture cellulaire complet comme décrit à l'étape 1.1.
    2. Graine 0,25 x 10 6 cellules U2OS par puits dans des plaques à 6 puits (2 ml de milieu de culture complet par puits). Afin de calculer le nombre de puits nécessaires à l'expérience, prendre en compte que 2 puits seront requis par point de temps sélectionné (1 puits pour l'extraction de l'ARN et 1 puits pour la surveillance du cycle cellulaire) et que 2 puits supplémentaires de cellules de croissance asynchrone sont Nécessaire pour définir les paramètres de compensation d'analyse FACS.
    3. Laisser les cellules se fixer en incubant des plaques à 6 puits pendant une nuit (O / N) à 37 ° C dans une atmosphère humidifiée avec 5% de CO 2 .
    4. Enlever le milieu complet des puits le lendemain matin et ajouter 2 mLDe milieu DMEM-Glutamine pré-réchauffé sans FBS par puits. Incuber les cellules pendant 24 h supplémentaires à 37 ° C dans une atmosphère humidifiée avec 5% de CO 2 .
      REMARQUE: effectuez cette étape dans tous les puits à l'exception de 2 (ceux sauvegardés pour définir les paramètres FACS). L'étape de retrait du sérum peut être omise si une synchronisation efficace est obtenue en incubant simplement des cellules avec HU.
    5. Arrêt du cycle cellulaire G1 / S avec HU.
      1. Préparer une solution mère de HU fraîche (500 mM) avant chaque utilisation. Ajouter 2 mL de H 2 O à 76,06 mg de poudre HU et mélanger jusqu'à dissolution complète. Stériliser la solution par filtration à travers un filtre de taille de pores de 0,2 μm. Mélanger 50 mL de milieu complet avec 400 μL de solution mère HU stérilisée pour une concentration finale en HU de 4 mM.
      2. Supprimez le milieu de tous les puits, à l'exception des 2 puits nécessaires à la définition des paramètres FACS et remplacez-les par un milieu complet 4 mM contenant de l'HU (2 ml / puits).
      3. Incuber les cellules pendant 24 h dansLe milieu contenant HU à 37 ° C dans une atmosphère humidifiée avec 5% de CO 2 .
    6. Libération des cellules de l'arrestation médiée par l'HU. Retirer le milieu contenant HU des puits et rincer les puits deux fois avec 1x PBS préchauffé (2 ml à chaque fois). Ajouter 2 ml de milieu complet par puits. Collectez 2 échantillons pour le point de temps de 0 h (1 pour l'extraction de l'ARN et 1 pour la vérification de l'arrêt du cycle cellulaire par FACS) ainsi que 2 échantillons sauvegardés pour les paramètres FACS. Placez les puits restants dans l'incubateur.
    7. Recueillir des échantillons tous les 1,5 à 3 h afin d'obtenir une répartition adéquate de la progression du cycle cellulaire. À chaque fois, effectuez un traitement d'échantillons (pour l'extraction de l'ARN et pour l'analyse FACS) comme décrit au 1.1.8.1-1.1.8.2.
  3. Traitement avec des agents nuisibles à l'ADN
    REMARQUE: chaque fois que l'objectif est d'élucider l'effet d'un composé ( par exemple , des agents nuisibles à l'ADN) dans les événements du cycle cellulaire, l'une des méthodes de synchronisation décrites précédemment peut êtreCombiné avec le traitement des cellules avec l'agent génotoxique. Afin de sélectionner la méthode de synchronisation, il est important de considérer la phase du cycle cellulaire que nous aimerions analyser. En général, la procédure Thy-Noc peut être appropriée pour étudier l'effet d'un composé en phase G1 ou en entrée de phase S, tandis que la synchronisation médiée par l'HU peut être plus appropriée pour étudier l'impact dans les phases S à G2 ou dans l'entrée à la mitose.
    1. Analyse de l'effet des agents génotoxiques en phase G1 ou en entrée de phase S
      1. Synchronisez les cellules comme décrit dans 1.1.2. À 1.1.6.
      2. Libérer les cellules du nocodazole et les re-plaquer comme décrit au 1.1.7. Incuber les à 37 ° C dans une atmosphère humidifiée avec 5% de CO 2 pendant 3 h pour les laisser s'attacher avant l'ajout d'agent (la période d'incubation requise peut varier en fonction de la ligne cellulaire).
      3. Ajouter un agent et collecter des échantillons comme décrit précédemment au 1.1.8.
    2. Analyse de l'effet des agents génotoxiques dans SG2 phases ou M entrée
      1. Synchronisez les cellules comme décrit dans 1.2.2. À 1.2.5.
      2. Libérer les cellules de HU comme décrit dans 1.2.6. Et ajoutez immédiatement l'agent.
      3. Recueillir des échantillons comme décrit précédemment dans 1.8.
  4. Surveillance de la synchronisation cellulaire et de la progression à travers le cycle cellulaire par coloration au iodure de propidium (PI) et analyse FACS
    REMARQUE: les échantillons collectés en tous les temps avec ceux requis pour définir les paramètres FACS peuvent être conservés à 4 ° C une fois qu'ils ont été corrigés (comme indiqué au 1.1.8.2). Effectuer une coloration avec une solution PI suivie d'une analyse FACS pour tous les échantillons de l'expérience simultanément. L'IP s'accumule dans la rainure principale de l'ADN bicaténaire produisant un signal fortement fluorescent lorsqu'il est excité à 535 nm avec un pic d'émission large autour de 600 nm. Puisque l'IP peut également se lier à l'ARN bicaténaire, il est nécessaire de traiter les cellules avec RNase pour une résolution optimale de l'ADN.
    1. Préparez une solution de coloration IP fraîchement préparée. Une solution mère PI peut être préparée en dissolvant de la poudre PI dans du PBS ( par exemple 5 mg / mL). Conserver la solution stock à 4 ° C (dans l'obscurité). La solution de coloration est composée de PI (140 μM), de citrate de sodium (38 mM) et de Triton X-100 (0,01% v / v).
    2. Réchauffer une surface appropriée ( par exemple un four) à 37 ° C.
    3. Centrifuger les cellules fixées (450 xg, 5 min, RT), décanter le surnageant (éthanol) et laver une fois avec 1x PBS.
    4. Centrifuger les cellules à nouveau, enlever PBS et ajouter 300 μL de solution de coloration PI par échantillon (sauf à l'un des échantillons pour les paramètres FACS, ajouter PBS à cet échantillon).
    5. Transférer des cellules dans des tubes FACS (5 ml de tubes en polystyrène à fond rond).
    6. Ajouter 1 μL de RNase A à chaque échantillon, mélanger et incuber les échantillons pendant 30 min dans l'obscurité à 37 ° C. Les échantillons peuvent être stockés protégés contre la lumière à 4 ° C pendant un maximum de 2 à 3 jours.
    7. Analyser le contenu d'ADN dans les échantillons par fluxLa cytométrie. Définir les paramètres de compensation d'analyse FACS avec un échantillon asynchrone coloré par PI. Utilisez un échantillon vide (sans solution de coloration IP) pour vérifier l'autofluorescence. Les bases de l'analyse de la teneur en ADN par la cytométrie en flux ont été décrites précédemment 9 .
  5. Détermination de l'indice mitotique par double coloration phospho-H3 (Ser 10) / PI
    NOTE: Les cellules soumises à la mitoses peuvent être facilement détectées par cytométrie en flux avec des anticorps spécifiques de phospho-histone H3 dans Serine 10 (pH3). Une coloration concomitante de PI est utile pour déterminer la distribution basée sur l'ADN de la population cellulaire. 5 échantillons sont nécessaires pour les configurations optimales des paramètres FACS: blanc, PI-seulement, pH3 seulement, anticorps secondaire et double coloration.
    1. Centrifuger les cellules fixées (450 xg, 5 min, 4 ° C) et jeter le surnageant. Les étapes suivantes sont décrites pour effectuer une coloration dans des tubes de 15 mL.
    2. Nettoyer les cellules en ajoutant 1Ml de PBS-T (PBS + 0,05% de Tween-20) sur la pastille et la centrifugeuse (450 xg, 5 min, 4 ° C). Retirer le surnageant.
    3. Ajouter un anticorps anti-pH3 dilué (1: 500) dans 100-200 μL de PBS-T + 3% de BSA, et incuber avec un balancement pendant 2 h à TA (ou O / N à 4 ° C).
    4. Ajouter 2 ml de PBS-T (PBS + 0,05% de Tween-20) et centrifuger (450 xg, 5 min, 4 ° C). Retirer le surnageant.
    5. Laver encore une fois en ajoutant 2 ml de PBS-T à la pastille, centrifuger et jeter le surnageant.
    6. Ajouter un anticorps secondaire (AlexaFluor 488 anti-lapin dans le cas d'un anticorps pH3 sélectionné) dilué (1: 500) dans 100-200 μL de PBS-T + 3% BSA et incuber avec un balancement pendant 1 h à TA (ou O / N À 4 ° C). Protégez les échantillons de la lumière.
    7. Laver deux fois avec du PBS-T (2 ml) par centrifugation comme décrit à l'étape 1.5.4.
    8. Effectuez la coloration PI comme décrit (étapes 1.4.1 à 1.4.6).

2. Collecte et traitement des échantillons pour l'analyse des expressions génétiques

  1. PrendreDes échantillons de microcentrifugation de 1,5 mL dans le réactif d'isolement de l'ARN hors du congélateur et les laisser décongeler à la RT à l'intérieur d'une armoire de sécurité pour les produits chimiques.
  2. Ajouter 400 μL de chloroforme à chaque échantillon et agiter vigoureusement (mais ne pas tourbillonner) jusqu'à mélange complet. Incuber les échantillons pendant 5 min à la RT.
  3. Centrifuger les tubes pendant 15 min (≥8,000 xg, 4 ° C) dans une microcentrifugeuse de banc.
  4. Transférer la phase aqueuse (supérieure) à un nouveau tube de microcentrifugeuse de 1,5 mL et enregistrer le volume transféré (afin de simplifier la procédure, il est recommandé de collecter des volumes égaux dans tous les échantillons de l'expérience).
  5. Ajouter 1 volume d'éthanol à 100% lentement (goutte à goutte) à la phase aqueuse tout en mélangeant. Ne pas centrifuger.
  6. Effectuez les prochaines étapes avec le kit de préparation mini RNA commercial. Pipeter jusqu'à 700 μl de chaque échantillon, y compris tout précipité qui s'est formé, dans une colonne de spin dans un tube de collecte de 2 mL (fourni par le fabricant).
  7. Fermer laCouvercle et centrifugeuse (≥ 8 000 g, RT) pendant 15 s. Jeter l'écoulement. Répétez l'étape précédente avec l'échantillon restant (le cas échéant).
  8. Suivre les instructions de fabrication pour le lavage et l'élimination d'ARN (élucider chaque échantillon dans 30 à 40 μl d'H 2 O sans nucléase pour obtenir une concentration d'ARN appropriée pour l'étape suivante).
  9. Déterminer la concentration d'ARN et la pureté des échantillons par des mesures d'absorbance (un rapport 260/280 de 2,0-2,1 indique une bonne pureté de l'échantillon d'ARN). Stocker les échantillons d'ARN à -80 ° C jusqu'à l'utilisation pour l'analyse RT-qPCR.
  10. Pour la conversion de l'ARN en ADNc et la PCR quantitative subséquente, prendre 1 μg d'ARN par échantillon et préparer une réaction rétrotranscriptase selon les instructions du fabricant. Les échantillons d'ADNc obtenus peuvent être stockés à 4 ° C (pendant quelques jours) ou à -20 ° C (pour de plus longues périodes).
    REMARQUE: la préparation des échantillons, la conception des amorces et d'autres considérations pour le PCR en temps réel ont été exDécrite de manière résolue dans la littérature 22 , 23 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Représentation schématique des protocoles Thy-Noc et HU pour la synchronisation des cellules.

La figure 1 résume les étapes requises pour la synchronisation des cellules U2OS et la collecte ultérieure des échantillons afin de vérifier la progression à travers le cycle cellulaire et d'effectuer des analyses d'expression des gènes.

Les colorants Phospho-H3 et PI sont de bons paramètres d'évaluation pour sélectionner les méthodes de synchronisation.

Les procédures de synchronisation des cellules doivent être évaluées et optimisées pour chaque ligne cellulaire en raison de l'hétérogénéité inhérente des cellules cultivées. La synchronisation dans la mitose est généralement obtenue avec le protocole Thy-Noc, et l'enrichissement des cellules mitotiques après traitement par le nocodazole peut être évalué avec des anticorps spécifiques de l'histone H3 phosphorylée (pH3), un marqueur mitotique typique. Ide La neutralisation des cellules positives au pH3 permet de discriminer les cellules mitotiques et celles ayant une teneur en ADN 4C qui ne subissent pas de mitoses (toutes considérées comme une population "G2" par coloration PI). Dans les cellules U2OS, le protocole Thy-Noc conduit à un enrichissement significatif d'une population avec un contenu d'ADN 4C (figure 2A, graphique supérieur gauche, population bleue par coloration PI) et la fraction relative de cellules mitotiques dans cette population était habituellement assez pure (approximativement 91% par rapport à 2% dans les cellules asynchrones). La libération de nocodazole entraîne une progression synchronisée des cellules vers la phase G1 suivante, déterminée par l'accumulation d'une population avec une teneur en ADN 2C ( figure 2A , graphique supérieur droit, population verte par coloration PI) et la disparition prochaine de la mitotique positive pH3 Cellules ( figure 2A , graphique inférieur droit). Ainsi, les résultats de coloration pH3 ont confirmé l'adéquation du protocole Thy-Noc pour la synchronisation mitotique des cellules U2OS.

E_content "fo: keep-together.within-page =" 1 "> La synchronisation des cellules U2OS dans G1 / S a été testée avec de la thymidine et de l'hydroxyurée, deux synchronyzers largement utilisés. L'enrichissement dans différentes phases du cycle cellulaire a été déterminé par coloration PI et L'analyse de FACS et le pourcentage de cellules résumées dans un tableau ( Figure 2B ). Une exposition de 24 h des cellules U2OS à Thy (2mM) était inefficace pour arrêter les cellules dans la limite G1 / S ( Figure 2B ), alors que le traitement avec HU ou avec un double Le rythme de la thymidine (DT) a entraîné une arrêt satisfaisant. Toutefois, seules les cellules traitées par HU se sont complètement récupérées de l'arrestation et ont progressé de manière adéquate par le cycle cellulaire. En revanche, le bloc DT a induit une arrêt G1 permanent dans une fraction significative de la population cellulaire ( 13,3% des cellules dans G1 à 6 h point de temps avec DT contre 3,1% avec protocole basé sur HU), ce qui a eu une incidence négative sur la synchronisation des cellules. Ainsi, l'exposition à l'HU est recommandée comme méthode de synchronisation G1 / S appropriéeOd pour les cellules U2OS.

Les protocoles basés sur Thy-Noc et HU sont complémentaires pour la synchronisation des cellules.

Comme le montre la figure 3A (0 h point horaire), le traitement par le protocole Thy-Noc a efficacement arrêté les cellules U2OS en entrée en phase M (population avec un contenu d'ADN 4C, montré en bleu) et le traitement par les cellules arrêtées par protocole HU dans la limite G1 / S (Population avec un contenu d'ADN 2C, montré en vert / rouge). Lors de l'élimination des médicaments, les cellules sont entrées et progressent dans le cycle cellulaire de manière synchronisée. Les cellules récupérées à partir du traitement Thy-Noc ont d'abord été observées au début de la phase G1 (population en vert) et ont ensuite été transférées par G1 et jusqu'à la phase S d'une manière uniforme. Les cellules récupérées du traitement HU ont progressé de manière synchrone par S (population en rouge) et G2 / M. La progression par le cycle cellulaire suivant était concomitante à la perte de synchronicité. ConséquemmentY, les points de temps sur 15 heures n'ont pas été inclus dans ces analyses en raison de la perte de synchronisme après ce point de temps.

L'analyse Western Blot de Cyclin E1 (une cycline G1 / S) et Cyclin B1 (une cycline G2 / M), deux protéines dont les niveaux sont étroitement réglementés dans le cycle cellulaire et du marqueur mitotique pH3 confirment la phase du cycle cellulaire de chaque Point de temps analysé par FACS ( Figure 3B ). Comme prévu, les cellules en phase M (correspondant au point de temps de 0 h des cellules synchronisées Thy-Noc) et les cellules en phase G2 à M (9 h à 12 h de temps de cellules HU-synchronyzedées) ont montré une accumulation dramatique de cycline B1 Et des niveaux indétectables de cycline E1. En outre, les taux de cycline B1 étaient faibles à indétectables dans la phase G1 (3 h après la libération du nocodazole) et une accumulation graduelle a été observée lorsque les cellules progressaient par S (après la libération de Thy-Noc) et dans G2 (après la libération de l'HU). Etiquetage pH3 robuste des cellules à 0 h sur Thy-Noc synchronizatiA confirmé l'enrichissement des cellules arrêtées à la mitose à ce moment-là. Une légère augmentation des niveaux de pH3 à 12 h après la libération de HU a révélé que la majorité des cellules ayant une teneur en ADN de 4C étaient encore dans G2 alors que la proportion de cellules dans la mitose était augmentée à 15 h. En revanche, le modèle d'expression de la cycline E1 a montré une accumulation progressive de l'entrée précoce de la phase G1 à la phase S (procédure Thy-Noc) et la disparition progressive dans la phase G2 / M (procédure HU).

L'expression des gènes qui sont différentiellement réglementés dans le cycle cellulaire peut être analysée avec précision grâce à une combinaison de synchronisation Thy-Noc et HU.

En tant que preuve de concept, l'analyse de l'expression du gène régulée par un cycle cellulaire est mieux analysée par une combinaison de deux méthodes de synchronisation cellulaire, expression d'ARNm de deux membres de la famille E2F connus pour avoir une cinétique d'expression différente dans le cycle cellulaire(E2F1 et E2F7) ont été examinés par PCR à transcriptase inverse (RT-qPCR). À cette fin, les protocoles de synchronisation Thy-Noc et HU ont été utilisés, comme résumé dans la figure 1 , et la distribution du cycle cellulaire a été surveillée par cytométrie en flux comme indiqué sur la figure 3A . La figure 4 montre les profils d'ARNm E2F1 (graphes supérieurs) et E2F7 (moins deux graphes) à travers le cycle cellulaire. Le profil de régulation transcriptionnelle du gène codant E2F1 a été mieux observé avec la procédure Thy-Noc, par laquelle l'expression d'E2F1 a progressivement augmenté depuis la phase G1 précoce pour atteindre un pic à la phase G1 tardive (9 h après la libération de Thy-Noc, fond vert). Ses niveaux ont diminué par la suite, en concomitance avec une entrée dans les phases S et G2 (milieux rouge et bleu). En revanche, la cinétique d'expression du gène E2F7 a été mieux détectée après la synchronisation basée sur HU (graphique inférieur, fond rouge), avec une expression maximale à 6 h de la libération (correspondant à la transition de phase S à G2). Thy-NocLa procédure, d'autre part, était appropriée pour observer l'induction d'E2F7, mais pas sa régulation négative. Il est à noter que l'extension de l'analyse au-delà des profils d'expression d'ARNm E2F1 et E2F7 reproduits dans les points antérieurs de temps de 15 h, bien que avec une variation diminuée de la variation de l'ARNm (données non représentées). Au total, ces résultats confirment l'importance de travailler avec une population de cellules correctement synchronisées pour évaluer non seulement la cinétique d'expression des gènes, mais aussi l'amplitude précise des changements dans les niveaux d'ARNm.

La synchronisation cellulaire offre une meilleure compréhension du programme d'expression génique impacté par la thérapie anticancéreuse.

Pour analyser l'effet du médicament antitumoral mitomycine C (MMC) dans la dynamique du cycle cellulaire ainsi que dans l'expression des gènes, les cellules U2OS ont d'abord été synchronisées avec HU et ensuite traitées avec MMC. L'exposition à cet agent génotoxique a activé un checkpoinT en phase G2 qui était évidente après 15 h d'exposition ( Figure 5A , rangée inférieure, pic bleu). En revanche, les cellules non traitées progressaient normalement par G1 à ce point de temps ( Figure 5A , rangée supérieure, pic vert). Le traitement MMC à long terme (36 h) a révélé une arrestation permanente des cellules en phase G2 alors que les cellules sans traitement MMC présentaient une distribution du cycle cellulaire similaire à celle de la population cellulaire asynchrone.

E2F1 et p21 Cip1 (CDKN1A) ont été choisis pour l'analyse de l'expression génique dans les cellules traitées par MMC ( Figure 5B ), compte tenu de leur différente régulation du cycle cellulaire. L'expression de E2F1 est dépendante de la phase G1, comme décrit dans la Figure 4 , alors que l'induction de l'expression de p21 Cip1 est couplée à l'activation de l'arrêt / contrôle du cycle cellulaire 24 . Comme le montre la figure 5B (graphique supérieur gauche), l'expression du gène E2F1 kiLes nétics étaient similaires en présence ou en absence de MMC, à mesure que les cellules progressaient par G1 / S et dans la phase S. Les différences dans l'expression du gène E2F1 chez les cellules traitées et non traitées par MMC ont été observées après 15 h d'exposition à MMC, dans lequel les cellules traitées par MMC ont exprimé des niveaux inférieurs d'ARNm E2F1 que les cellules témoins ( Figure 5B , comparer les lignes solides et pointillées). Cependant, en dépit de la nette différence d'expression, on ne peut pas conclure que la MMC minimise l'expression de l'E2F1, car les profils du cycle cellulaire des cellules traitées et non traitées MMC sont nettement différents dans ces derniers temps, en raison d'une attaque de phase G2 soutenue imposée par MMC. En fait, les niveaux d'ARNm E2F1 faibles après le point de temps de 15 heures dans les cellules exposées à la MMC reflètent vraisemblablement un effet du médicament dans la dynamique du cycle cellulaire plutôt qu'un effet de MMC dans la régulation transcriptionnelle E2F1.

Contrairement à E2F1, p21 Cip1 est un gène sensible à MMC. Niveaux élevés de p21 Cip1 ont été détectés lors de l'arrêt G1 / S imposé par HU, indiquant l'activation du point de contrôle G1 par HU ( Figure 5B , 0 h time point) et son expression a diminué par la suite dans les cellules traitées non MMC, compatible avec une progression du cycle cellulaire non perturbée après la libération de arrêter. En revanche, le traitement par MMC a conduit à des niveaux élevés d'ARNm de p21 Cip1 ( Figure 5B , graphique supérieur droit, ligne continue) tandis que les cellules s'accumulaient en phase G2 (9 h d'exposition MMC). Malgré le fait que les profils du cycle cellulaire étaient similaires au point de temps de contrôle de 9 h et de cellules traitées par MMC, l'analyse de l'expression des gènes montre une différence fondamentale. Les cellules exposées à MMC ont affiché un point de contrôle G2 activé, mis en évidence par l'induction de l'expression de p21 Cip1 , tandis que les cellules non traitées subissaient une transition non perturbée par G2, avec des niveaux inférieurs de p21 Cip1 .

Données obtenues par analyse de cytométrie en flux ( FiGure 5A) et les données résultant de RT-qPCR ( Figure 5B , graphiques supérieurs) ont été combinés dans un seul graphique pour chacun des gènes sélectionnés ( Figure 4B , graphiques inférieurs). Les niveaux d'expression de l'ARNm sont représentés par la hauteur relative des barres tandis que la répartition du cycle cellulaire de chaque échantillon a été illustrée par la proportion de couleurs: vert pour la phase G1 (contenu d'ADN 2C), bleu pour la phase G2 (contenu d'ADN 4C) et rouge Pour la phase S (teneur intermédiaire en ADN). Cette méthode combinée de représentation graphique peut être utile pour interpréter la distribution du cycle cellulaire et les analyses d'expression des gènes.

En résumé, l'analyse de l'expression des gènes couplée à une méthode de synchronisation de la culture a permis d'identifier un gène sensible aux agents génotoxiques (p21 Cip1 ) et a conduit à proposer que les changements observés dans l'expression d'E2F1 entre les cellules traitées et non traitées avec l'agent étaient indirects etÉventuellement liés aux différences dans la distribution du cycle cellulaire des cellules.

Figure 1
Figure 1: Vue d'ensemble de deux protocoles complémentaires de synchronisation cellulaire: Thymidine-Nocodazole et Hydroxyurea. ( A ) Représentation graphique du cycle cellulaire de mammifère indiquant les points où l'arrêt du cycle cellulaire est obtenu par des méthodes de synchronisation cellulaire. La procédure à base de Thy-Noc bloque les cellules dans la mitose précoce (M) tandis que l'HU bloque les cellules à la limite G1 / S. ( B ) Représentation schématique du protocole Thy-Noc de synchronisation cellulaire. Les étapes utilisées habituellement pour l'analyse de l'expression des gènes et la surveillance du cycle cellulaire dans les cellules U2OS sont les suivantes. ( C ) Représentation schématique du protocole de synchronisation cellulaire basé sur HU. Les étapes généralement utilisées pour l'analyse de l'expression des gènes et la surveillance du cycle cellulaire dans UCellules 2OS. Une procédure de synchronisation plus courte, en omettant une fuite de sérum, peut également être appliquée si une synchronisation optimale est déjà atteinte par une exposition de 24 h à HU. Cliquez ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2: évaluation des méthodes de synchronisation appropriées. ( A ) Les cultures de cellules U2OS synchronisées asynchrones et Thy-Noc ont été soumises à une coloration pH3 afin d'évaluer la fraction de cellules mitotiques dans chaque cas. La coloration SIM simultanée a permis la surveillance de la teneur en ADN des cellules. Dans la population asynchrone, seule une fraction minimale de cellules avec une teneur en ADN 4C (en bleu) était positive pour le marqueur de la mitose. En revanche, le protocole Thy-Noc gère efficacementCellules mâchées dans la mitose (positif pour la coloration pH3) et a permis une progression appropriée à la phase G1 suivante (en vert) après élimination du nocodazole (point de temps de 3 h). Le pourcentage de cellules dans chaque phase est résumée dans le tableau et marquée avec des couleurs selon celles utilisées dans les histogrammes PI: vert pour les cellules de contenu d'ADN 2C (G1), bleu pour les cellules avec une teneur en ADN 4C (y compris les cellules G2 et M et nommées comme G2 dans les histogrammes afin de simplifier la figure et rouge pour les cellules ayant une teneur en ADN intermédiaire (S). ( B ) La thymidine et l'HU ont été évaluées pour leur efficacité de synchronisation du cycle cellulaire dans les cellules U2OS. Les cellules ont été traitées avec de la thymidine (une ou deux Rounds), ou avec HU pendant 24 h, et la synchronisation des cellules a été examinée par coloration IP et analyse FACS. Summit a été utilisé pour l'analyse des données FACS. Cliquez ici pour voir une version plus grande de cette figure.

figure 3
Figure 3: Décrivant le cadre temporel pour la progression uniforme des cellules après la synchronisation à médiation Thy-Noc et HU. ( A ) Les cellules U2OS ont été synchronisées en phase M par le protocole Thy-Noc (rangée supérieure) ou en transition G1 / S par protocole HU (rang inférieur). La progression du cycle cellulaire a été surveillée par coloration par PI et analyse FACS de la teneur en ADN des cellules toutes les 3 h après la libération de produits chimiques. Le sommet a été utilisé pour l'analyse des données FACS. Les cellules sorties de l'arrestation médiée par Thy-Noc sont entrées de manière synchrone au début de la phase G1 après 3 h, et progressent uniformément jusqu'à la phase S aux points de temps ultérieurs. Les cellules libérées par l'arrestation médiée par HU ont été transférées de manière synchrone par les phases S et G2. Les cellules collectées 15 h après la libération représentaient les limites de la synchronisation cellulaire, car la progression vers la prochaine phase ne permettaitD par une fraction de la population. ( B ) La synchronisation cellulaire a été contrôlée par une analyse Western Blot en collectant des échantillons de protéines toutes les 3 h et jusqu'à 15 h après la libération. La cinétique d'expression de Cyclin E1 (CCNE1), une cycline principalement accumulée à travers la phase S, la cycline B1 (CCNB1), principalement présente de G2 à M phase et pH3, marqueur pour les cellules mitotiques, corroboré les profils de répartition du cycle cellulaire observés par cytométrie en flux. L'actine B (ACTB) a été utilisée comme contrôle de chargement endogène car ses niveaux ne dépendent pas du cycle cellulaire. (Modifié de Mitxelena et al ., 8 ). Cliquez ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4: étude du cycle cellulaire en fonction de la phase T Transcription des membres de la famille E2F par des méthodes complémentaires de synchronisation cellulaire. Les cellules U2OS ont été arrêtées dans G2 / M par le protocole Thy-Noc ou dans G1 / S par traitement HU, et des échantillons ont été prélevés pour l'extraction de l'ARN et l'analyse FACS toutes les 3 h jusqu'à 15 h après la libération de l'arrêt. L'analyse de l'expression génétique par RT-qPCR a révélé un profil d'expression E2F1 circonscrit principalement à G1 (graphique supérieur gauche), tandis que le profil d'expression du gène E2F7 a été déplacé vers la phase S, avec une régulation négative progressive par phase G2 (graphique inférieur droit). Le TBP a été utilisé comme gène endogène non régulé par un cycle cellulaire pour calculer les variations relatives des niveaux d'ARNm et les résultats ont été représentés comme valeurs moyennes et écart-type (SD). La progression par le cycle cellulaire a été déterminée par la coloration par PI et l'analyse FACS de la teneur en ADN des cellules. Les phases du cycle cellulaire ont été représentées sous forme de couleurs de fond en graphes: noir (arrêt à la mitose précoce), vert (phase G1), rouge (phase S) et bleu (phase G2)..com / files / ftp_upload / 55745 / 55745fig4large.jpg "target =" _ blank "> Cliquez ici pour voir une version plus grande de cette figure.

Figure 5
Figure 5: Impact de la MMC sur l'expression des gènes et la progression du cycle cellulaire. Les cellules U2OS ont été traitées avec HU pendant 24 h, et MMC (250 nM) a été ajouté immédiatement après la libération de l'arrêt de la G1 / S médiée par l'HU. Des échantillons pour l'analyse FACS et l'analyse de l'expression génétique ont été recueillis aux points de temps indiqués. ( A ) La progression à travers le cycle cellulaire a été déterminée par la coloration par PI et l'analyse FACS du contenu d'ADN par le logiciel Summit. MMC a induit un retard modéré dans la progression de la phase S (population rouge) et une arrestation permanente en phase G2 (population bleue), comme l'indique l'absence de cellules dans G1 (population verte) après 15 heures de traitement (rang inférieur) À la non-Traitées (rangée supérieure). ( B ) L'analyse de l'expression du gène E2F1 et p21 Cip1 dans des cellules traitées ou non traitées par MMC a été effectuée au niveau de l'ARNm par RT-qPCR. Oxa1L a été utilisé comme un gène endogène non sensible à MMC et les résultats ont été représentés comme valeurs moyennes et SD. Les graphiques supérieurs représentent les niveaux d'ARNm relatifs des gènes sélectionnés après la libération de HU et l'addition de MMC. Les graphiques inférieurs combinent les données obtenues par analyse FACS et RT-qPCR. Cliquez ici pour voir une version plus grande de ce chiffre.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'analyse des gènes régulés par ajustement précis impliqués dans des rôles transitoires et spécifiques dans le cycle cellulaire nécessite une population cellulaire uniforme. Beaucoup de chercheurs utilisent couramment des lignées de cellules tumorales établies de longue date à cette fin, et une variété de méthodes ont été développées pour obtenir des populations de cellules synchrones (ou partiellement synchrones), dans le but d'accumuler autant de cellules que possible dans des phases de cycle cellulaire définies. En outre, des efforts considérables ont été entrepris pour améliorer et optimiser les approches de synchronisation bien établies. Néanmoins, tous les protocoles de synchronisation présentent des inconvénients qui peuvent être attribués à l'hétérogénéité des cultures cellulaires, à une efficacité sous-optimale des procédures de synchronisation ou à des effets secondaires que les synchroniseurs chimiques ont dans la fonction cellulaire, entre autres. Ces limitations doivent être prises en compte lors de l'application des protocoles de synchronisation cellulaire. Les chercheurs doivent identifier les méthodes de synchronisation les plus appropriées pour leur spécificitéType de cellule ou expérience. Même en cultivant différentes lignées cellulaires exactement de la même manière, les taux de synchronisation qui en résultent peuvent être différents en raison de plusieurs raisons. D'une part, la durée du cycle cellulaire peut varier en fonction de la ligne cellulaire sélectionnée; D'autre part, le même inhibiteur peut avoir des effets contrastés sur différentes lignées cellulaires en raison de caractéristiques particulières de chaque ligne cellulaire 25 . En outre, la concentration d'inhibiteur et le temps d'exposition sélectionnés doivent toujours être ajustés à chaque ligne cellulaire afin d'éviter ou de minimiser la toxicité secondaire non souhaitable 26 . Même après l'optimisation de tous ces aspects, l'accumulation de cellules à 100% dans une phase de cycle cellulaire donnée n'est jamais atteinte, et l'asynchronie augmente progressivement après l'élimination du produit chimique 27 . Ainsi, il est important de comprendre que les méthodes de synchronisation obtiennent au mieux les enrichissements partiels de population cellulaire dans un intervalle de temps particulier.

Dans ce w Ork deux procédures de synchronisation (Thy-Noc et HU) ont été optimisées pour leur utilisation dans des cellules U2OS, qui sont largement utilisées pour les tests de synchronisation cellulaire 28 , 29 , 30 . Pour arrêter les cellules en phase M, une combinaison de thymidine et de nocodazole a fonctionné efficacement dans les cellules U2OS. Compte tenu de la nature cytotoxique du nocodazole, il était important de déterminer le temps d'exposition et la dose de cet inhibiteur afin d'obtenir non seulement une population cellulaire hautement synchronisée mais aussi une survie cellulaire optimale. L'exposition préalable à la thymidine (ou théoriquement tout autre composé similaire tel que l'hydroxyurée) a conduit à un enrichissement de la population cellulaire dans les phases G1 et S, ce qui a diminué le temps d'exposition nécessaire au nocodazole. Pour arrêter les cellules dans G1 / S, plusieurs possibilités ont été envisagées, y compris le double bloc de thymidine, une méthode qui est très efficace dans la synchronisation de plusieurs lignes de cellules"> 31 , 32. Cependant, la thymidine a été rejetée compte tenu de ses résultats décevants dans U2OS. Un cycle de traitement à la thymidine a simplement arrêté une fraction de cellules, alors que deux cycles de traitement à la thymidine ont efficacement bloqué la majorité des cellules dans G1 / S, mais un G1 La population a été maintenue après la libération de la thymidine et la progression du cycle cellulaire n'a pas été uniforme. En revanche, le traitement par l'hydroxyurée a fourni de bons résultats de blocage G1 / S et une progression uniforme des cellules par S et G2.

La distribution de la phase de cycle cellulaire devrait être examinée chaque fois que l'on effectue des expériences de synchronisation cellulaire ( p. Ex. Par coloration par iodure de propidium ou par étiquetage pH3 suivi d'une analyse FACS, ou par immunoblot de protéines spécifiques de phase de cycle cellulaire) 16 , 33 , 34 , afin de mieux interpréter l'expression des gènes résultats. Une efficacité de synchronisation incorrecteNyc ou légères différences inter-expérimentales dans la progression par le cycle cellulaire peuvent conduire à de mauvaises conclusions. Par exemple, le traitement par nocodazole est connu pour provoquer une défaillance de la fonction de contrôle mitotique sous certaines conditions. Cela donne lieu à une population de cellules avec une teneur en ADN 4C mais négative pour les marqueurs mitotiques 34 qui "glisse" la division mitotique et revient à l'interphase avec un contenu 4C 35 . L'émergence de ce sous-ensemble de cellules, qui peut être détecté par immunocoloration avec des anticorps anti-phospho-H3 (voir la figure 2A ), peut être minimisée par l'utilisation de PBS froid pour les étapes de lavage de nocodazole. Un autre effet associé à l'utilisation d'inhibiteurs chimiques qui a une incidence sur la synchronisation cellulaire est l'activation du point de contrôle associée à l'exposition à ces composés 36 , 37 , un mécanisme par lequel la cellule empêche activement la progression à travers le cycle cellulaire jusqu'à ce qu'il puisseAssurez-vous que les processus antérieurs à ce point précis (p. Ex. Réplication correcte de l'ADN, assemblage de la broche) sont résolus 38 . Pour qu'une méthode de synchronisation soit adéquate, l'arrestation doit être non seulement efficace mais aussi complètement réversible. Ainsi, après la libération des inhibiteurs du cycle cellulaire, il est important d'analyser si les effets de l'inhibiteur ont été inversés, par exemple en analysant l'expression des marqueurs de point de contrôle, tels que p21 CIP . La figure 5B montre que les cellules U2OS synchronisées avec l'hydroxyurée ont résolu efficacement le point de contrôle, car les niveaux de P21 CIP ont été réduits à l'expression basale après la libération.

Dans les cellules U2OS, les pourcentages d'enrichissement lors de l'arrêt du cycle cellulaire se situent dans la gamme rapportée par d'autres études sur la synchronisation cellulaire 29 , 30 , 39 : environ 85% des cellules avec une teneur en ADN 4C (coloration PI) et approxiEnviron 90% de ceux de la mitose (étiquetage positif au pH3) après traitement thymidine-nocodazole et environ 80 à 90% des cellules G1 / S après un traitement par l'hydroxyurée. La libération de l'arrêt du cycle cellulaire entraîne généralement une progression appropriée à travers une ou deux phases suivantes de manière uniforme, bien que la synchronisation soit toujours perdue après plusieurs heures et que les cellules ne puissent pas compléter complètement un cycle de division cellulaire de façon synchronisée. Par conséquent, afin d'obtenir une image complète de toutes les phases du cycle cellulaire, le protocole proposé dans ce travail utilise deux méthodes de synchronisation à partir de différentes parties du cycle cellulaire. Comme le montre la figure 3A , chaque protocole individuel n'a pas assuré la synchronicité sur un cycle cellulaire entier. La synchronisation basée à Thy-Noc a fourni une trame appropriée pour les processus se produisant dans les phases G1 à S, tandis que les cellules libérées par HU étaient adaptées à l'analyse des événements se déroulant pendant S et G2 / M. Les complémentarités des deux procédures sélectionnéesEst démontré par l'analyse de deux membres de la famille des facteurs de transcription E2F ( Figure 4 ), soutenant l'idée que la combinaison de deux méthodes qui se synchronisent dans différentes phases du cycle cellulaire est une approche puissante pour établir avec précision une expression de gène régulée par un cycle cellulaire Des modèles et pour mieux comprendre leur rôle physiologique.

Une application convaincante des procédures de synchronisation cellulaire se concentre sur l'évaluation de l'impact des agents thérapeutiques potentiels. L'effet des composés pharmaceutiques, tels que ceux qui ont une activité antitumorale, est souvent étudié dans des populations de cellules asynchrones. Dans ces paramètres, il est possible de déterminer l'implication du médicament sélectionné dans l'induction de plusieurs processus tels que la mort cellulaire , l' arrêt du cycle cellulaire ou la sénescence 7 , 40 . Cependant, la sélection des paramètres cellulaires asynchrones pour l'identification d'événements moléculaires précis régulantDe tels processus peuvent conduire à des conclusions incomplètes ou partiellement fausses. Ce point, qui est souvent négligé, a été illustré dans le présent travail en analysant l'effet de la MMC de médicament chimiothérapeutique sur l'expression du gène E2F1 et p21 Cip1 ( figure 5 ). Dans l'ensemble, la combinaison de la synchronisation cellulaire et du traitement avec des agents génotoxiques fournit un contexte approprié pour étudier l'expression des gènes sensibles à l'agent génotoxique et discriminer de ceux affectés par les perturbations du cycle cellulaire imposées par l'agent.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à dévoiler.

Acknowledgments

Nous remercions les membres des laboratoires Zubiaga et Altmeyer pour des discussions utiles et pour un soutien technique. Ce travail a été soutenu par des subventions du ministère espagnol (SAF2015-67562-R, MINECO / FEDER, UE), du gouvernement basque (IT634-13 et KK-2015/89) et de l'Université du Pays Basque UPV / EHU ( UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
Étude de l'expression génétique régulée par un cycle cellulaire par deux protocoles complémentaires de synchronisation cellulaire
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter