Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Estudio de la expresión genética regulada por el ciclo celular mediante dos protocolos complementarios de sincronización celular

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

Presentamos dos protocolos de sincronización celular que proporcionan un contexto para el estudio de eventos relacionados con fases específicas del ciclo celular. Mostramos que este enfoque es útil para analizar la regulación de genes específicos en un ciclo celular no perturbado o en la exposición a agentes que afectan el ciclo celular.

Abstract

El programa de expresión génica del ciclo celular representa un paso crítico para comprender los procesos dependientes del ciclo celular y su papel en enfermedades como el cáncer. El análisis de expresión de genes regulado por el ciclo celular depende de la sincronización celular en fases específicas. Aquí se describe un método que utiliza dos protocolos de sincronización complementarios que se utiliza comúnmente para estudiar la variación periódica de la expresión génica durante el ciclo celular. Ambos procedimientos se basan en el bloqueo transitorio del ciclo celular en un punto definido. El protocolo de sincronización mediante el tratamiento con hidroxiurea (HU) conduce a la detención celular en la fase tardía G1 / S temprana, y la liberación de la detención mediada por HU proporciona una población celular que progresa uniformemente a través de S y G2 / M. El protocolo de sincronización mediante el tratamiento con timidina y nocodazol (Thy-Noc) bloquea células en mitosis temprana y la liberación de la detención mediada por Thy-Noc proporciona una población celular sincronizada adecuada para la fase G1 y la fase SIntente estudios La aplicación de ambos procedimientos requiere la monitorización de los perfiles de distribución del ciclo celular, que se realiza típicamente después de la tinción con yoduro de propidio (PI) de las células y el análisis mediado por citometría de flujo del contenido de ADN. Se muestra que el uso combinado de dos protocolos de sincronización es un enfoque robusto para determinar claramente los perfiles transcripcionales de los genes que se regulan diferencialmente en el ciclo celular ( es decir, E2F1 y E2F7), y por lo tanto para tener una mejor comprensión de su papel en el ciclo celular Procesos. Además, se demuestra que este enfoque es útil para el estudio de los mecanismos subyacentes a las terapias basadas en fármacos ( es decir, la mitomicina C, un agente anticancerígeno), ya que permite discriminar los genes que responden al agente genotóxico de los afectados exclusivamente por las perturbaciones del ciclo celular Impuesto por el agente.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La transición a través de todas las fases del ciclo celular se acopla a un programa de expresión génica fuertemente regulado. Se supone que esta coordinación "en y fuera" de la transcripción de genes a lo largo del ciclo celular está bajo el control de sistemas reguladores transcripcionales complejos, regulando no sólo el momento sino también los niveles de expresión génica. Se sabe que la desregulación de los componentes clave del ciclo celular contribuye al desarrollo de varias enfermedades y es un sello bien establecido de la tumorigénesis 1 , 2 . Los análisis transcriptómicos de todo el genoma llevados a cabo en células de levadura y de mamífero han revelado que un gran número de genes exhiben patrones de expresión génica periódicos en el ciclo celular, lo que sugiere que la fluctuación transcripcional durante el ciclo celular es un reflejo del requisito temporal de un producto génico dado En una fase precisa 3 , 4 , 5 .

Una tarea importante en el estudio de la expresión de genes regulados por el ciclo celular es la sincronización de células en fases específicas del ciclo celular. La sincronización celular ayuda a interpretar la asociación de un patrón de expresión génica a una transición de fase particular del ciclo celular, y ha conducido a una mejor comprensión de la regulación y la función de numerosos genes. La sincronización celular también es importante para el estudio del mecanismo de acción de los fármacos contra el cáncer, ya que los agentes quimioterapéuticos se sabe que afectan tanto la expresión de genes, así como la cinética del ciclo celular [ 6 , 7] . Sin embargo, a menudo es difícil determinar si las diferencias de expresión génica resultantes del tratamiento con estos agentes son una respuesta directa al tratamiento o son meramente la consecuencia de cambios en los perfiles del ciclo celular. Para distinguir entre estas posibilidades, la expresión génica debe analizarse en células que han sido sYnchronized antes de la adición del fármaco quimioterapéutico.

Con la excepción de algunas células primarias tales como células linfoides recién aisladas -que constituyen una población celular homogénea sincronizada en G08-, las líneas celulares establecidas in vitro crecen asincrónicamente en cultivo. Bajo condiciones de crecimiento regular, estas células de ciclo asincrónico se encuentran en todas las fases del ciclo celular, pero, preferentemente en G1 9 . Por lo tanto, este contexto no proporciona un escenario óptimo para el análisis funcional o de expresión génica en una fase específica del ciclo celular ( por ejemplo , G1, S, etc.). Las líneas celulares inmortalizadas no transformadas ( por ejemplo, fibroblastos) pueden sincronizarse con los llamados métodos fisiológicos 10 . Estos métodos se basan en las características de células primarias retenidas de las células no transformadas, tales como la inhibición del contacto celular y la dependencia del factor de crecimiento con el fin de continuar el ciclo. EliminaciónDe suero en combinación con inhibición de contacto hace que las células no transformadas sean detenidas en G0 / G1. Sin embargo, la sincronización del ciclo celular de entrada y la progresión a menudo requiere de subcultura, que también implica el desprendimiento artificial de las células y re-chapado [ 10] . Más importante aún, este método no es adecuado para la sincronización de líneas celulares transformadas, la gran mayoría de líneas celulares establecidas actualmente en uso, caracterizado por carecer de inhibición del crecimiento mediada por contacto celular o respuesta a la retirada del factor de crecimiento. Por lo tanto, es evidente que se requieren métodos alternativos para la sincronización celular eficiente en fases específicas del ciclo celular. En términos generales, los métodos de sincronización más utilizados se basan en la inhibición química o farmacológica transitoria de un punto definido del ciclo celular, típicamente síntesis de ADN o formación de huso mitótico. La inhibición de la síntesis de ADN sincroniza las células deteniéndolas en fase G1 tardía o temprana. Esto puede hacerse12 , aphidicolin, un inhibidor de ADN polimerasas 13 , 14 , hidroxiurea, un inhibidor de ribonucleotide reductasa 15 , 16 o por cantidades en exceso de timidina 17 , 18 . Por otra parte, los inhibidores de la polimerización de los microtúbulos, tales como la colchicina o el nocodazol, son capaces de bloquear la formación del huso mitótico que conduce a la sincronización celular a principios de la fase M 19 , 20 , 21 .

En este trabajo se describe un método que implica dos protocolos de sincronización complementarios basados ​​en la inhibición química transitoria para el estudio de la expresión de los genes regulados por el ciclo celular en el mRNAnivel. Este método es fundamental para definir el papel de los genes del ciclo celular en procesos específicos del ciclo celular. Además, proporciona un marco general para estudiar el impacto de los tratamientos contra el cáncer con el fin de detectar con precisión genes fármacos sensibles y para minimizar las interpretaciones erróneas derivadas de las perturbaciones en la progresión del ciclo celular generado por estos fármacos.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Sincronización Celular, Liberación y Monitoreo de la Progresión del Ciclo Celular

  1. Timidina y nocodazol (Thy-Noc) sincronización y liberación de células U2OS de la mitosis
    1. Preparar el medio de cultivo celular requerido. Las células U2OS se cultivan rutinariamente en medio DMEM-Glutamina complementado con FBS al 10% (vol / vol) (opcional: penicilina al 1% / estreptomicina). Realizar toda la preparación y manipulación del medio en condiciones estériles y calentar el medio complementado (de ahora en adelante denominado "medio completo") a 37 ° C antes de su uso.
    2. Sembrar 2 x 106 células U2OS por placa de 100 mm en 10 ml de medio de cultivo completo. Para calcular el número de platos necesarios, tenga en cuenta que cada plato de 100 mm proporciona típicamente suficientes células mitóticas para volver a planchar aproximadamente 5 pocillos de una placa de 6 pocillos (0,2 - 0,25 x 106 células / pocillo) (véase la Figura 1B ). Se requieren dos pozos por punto de tiempo seleccionadoEd en el experimento (1 pozo para la extracción de ARN y 1 pozo para el control del ciclo celular). Además, un tercer pocillo puede ser recogido por punto de tiempo para el análisis de proteínas.
      NOTA: Coloque las celdas en la noche (alrededor de las 7 pm) para que los siguientes pasos se puedan llevar a cabo durante las horas de trabajo los días siguientes. Incluya 2 pozos adicionales de células de crecimiento asíncrono para definir la configuración de compensación de análisis FACS.
    3. Deje que las células se unan incubando platos de 100 mm a 37 ° C en una atmósfera humidificada con 5% de CO 2 durante 24 h.
    4. Para el bloque de timidina, preparar una solución madre de timidina 200 mM disolviendo 145,2 mg de polvo de timidina en 3 ml de H $$ O (o cantidades equivalentes) y esterilizar la solución por filtración a través de un filtro de tamaño de poro de 0,2 μm. Un ligero calentamiento podría ayudar a disolver la timidina. Añadir 100 μl del preparado recién preparado 200 mM a cada placa de cultivo de 100 mm (concentración final 2 mM). Incubar las células con timidina durante 20 h a 37ºC76; C en una atmósfera humidificada con 5% de CO 2 .
      NOTA: Tratar las células por la noche (alrededor de las 7 pm), para tener tiempo para realizar tanto la liberación de timidina como el bloqueo de nocodazol al día siguiente.
    5. Para liberar del bloque de timidina, eliminar el medio de crecimiento que contiene timidina en la tarde del día siguiente (3 pm); Lavar las células dos veces con 1x PBS precalentado y agregar 10 ml de medio completo a cada una de las placas de 100 mm. Incubar las células durante 5 h a 37 ° C en una atmósfera humidificada con 5% de CO 2 .
    6. Para detener las células mitóticas, añadir nocodazol a una concentración final de 50 ng / mL (8 pm). Preparar una solución madre disolviendo polvo de nocodazol en DMSO ( por ejemplo, 5 mg / ml) y almacenar congelado a -20 ° C. Incubar las células con nocodazol durante no más de 10 - 11 h a 37 ° C en una atmósfera humidificada con 5% de CO 2 .
    7. Liberación de la detención mediada por nocodazol en fase M temprana (sacudimiento mitótico) y recogida de muestras en poi tiempo(Comenzando a las 6-7 am).
      1. Separar las células redondeadas (mitóticas) agitando cada placa y pipeteando suavemente el medio de crecimiento que contiene nocodazol. Recoger el medio con células separadas de cada placa de 100 mm en tubos estériles de 50 ml, centrifugar (300 xg, 5 min, temperatura ambiente (RT)) y lavar las células dos veces añadiendo 1x PBS seguido de centrifugación. Se recomienda el uso de PBS frío o PBS más nocodazol para evitar el deslizamiento mitótico (ver sección de discusión).
      2. Resuspender las células mitóticas recogidas de cada placa de 100 mm en 10 ml de medio completo. Ahorre 2 ml para la extracción de ARN y 2 ml para el análisis FACS para el punto de tiempo 0 h (aproximadamente 0,2-0,25 x 10 6 células por muestra).
      3. Replantar las células mitóticas restantes para posteriores puntos de tiempo en placas de 6 pocillos (2 ml / pocillo, 0,2-0,25 x 106 células / pocillo).
        NOTA: Recuerde que se requieren 2 pozos por punto de tiempo seleccionado (1 para ARN y 1 para análisis FACS).
    8. Recoger muestras en selTiempo. Cada 1,5 a 3 h se recomienda para obtener un perfil adecuado de la progresión del ciclo celular.
      1. Para la extracción de ARN, retire el medio, enjuague bien con 2 mL de PBS 1x precalentado y agregue 1 mL de reactivo de aislamiento de ARN adecuado ( por ejemplo, TRIzol) en el pozo (realice este último paso en un gabinete de seguridad para productos químicos). Pipetar hacia arriba y hacia abajo para separar y lisar las células, transferir el lisado celular a un tubo de microcentrífuga de 1,5 ml, incubar 5 min a RT y almacenar el tubo a -80 ° C hasta su uso posterior.
      2. Para el análisis de FACS, enjuague bien con 2 mL de PBS 1x precalentado, añada una solución de tripsina-EDTA precalentada (0,3 mL / pocillo) para separar las células, bloquee Trypsin-EDTA añadiendo 1 mL de medio completo y recoja cada muestra en forma separada Tubo de 15 ml.
        1. Centrifugar las células (300 xg, 5 min, RT), excepto pellet celular y descartar el sobrenadante. Para fijar las células, resuspender las células en 1 ml de etanol enfriado al 70% (v / v) en 1x PBS agitando suavemente los tubos y colocarlos en hielo para aplicarlos.Aproximadamente 15 minutos antes de almacenar a 4ºC o para tinción para análisis posterior por FACS (descrito en los pasos 1.4 - 1.5).
  2. HU-based sincronización y liberación de células U2OS desde el límite G1 / S
    1. Preparar el medio de cultivo celular completo como se describe en el paso 1.1.
    2. Se añadieron 0,25 x 10 ^ { 6 } células U2OS por pocillo en placas de 6 pocillos (2 ml de medio de cultivo completo por pocillo). Para calcular el número de pozos necesarios para el experimento, tenga en cuenta que se necesitarán 2 pozos por punto de tiempo seleccionado (1 pozo para la extracción de RNA y 1 pozo para el monitoreo del ciclo celular) y que 2 pocillos adicionales de células asincrónicamente en crecimiento Necesarios para definir los ajustes de compensación de análisis FACS.
    3. Las células se unen incubando placas de 6 pocillos durante la noche (O / N) a 37ºC en una atmósfera humidificada con 5% de CO2.
    4. Retire el medio completo de los pozos la mañana siguiente y agregue 2 mLDe medio DMEM-Glutamina pre-calentado libre de FBS por pocillo. Incubar las células durante 24 h adicionales a 37 ° C en una atmósfera humidificada con 5% de CO 2 .
      NOTA: Realice este paso en todos los pozos excepto en 2 (los guardados para definir ajustes FACS). La etapa de retirada del suero se puede omitir si se logra una sincronización eficiente simplemente incubando células con HU.
    5. Cierre del ciclo celular G1 / S con HU.
      1. Preparar solución madre de HU fresca (500 mM) antes de cada uso. Añadir 2 ml de H $$ O a 76,06 mg de HU de polvo y mezclar hasta que se disuelva completamente. Esterilizar la solución por filtración a través de un filtro de tamaño de poro de 0,2 μm. Mezclar 50 ml de medio completo con 400 μl de solución madre HU esterilizada con filtro para una concentración final de HU de 4 mM.
      2. Eliminar el medio de todos los pocillos excepto de los 2 pocillos necesarios para definir los ajustes de FACS y reemplazarlos con un medio completo 4 mM HU recién preparado (2 ml / pocillo).
      3. Incubar las células durante 24 h enHU que contiene medio a 37 ° C en una atmósfera humidificada con 5% de CO 2 .
    6. Liberación de células de la detención mediada por HU. Quitar el medio que contiene HU de los pocillos y enjuagar los pocillos dos veces con 1x PBS precalentado (2 ml cada vez). Añadir 2 ml de medio completo por pocillo. Recoja 2 muestras para el punto de tiempo 0 h (1 para la extracción de RNA y 1 para la verificación de detención del ciclo celular por FACS), así como 2 muestras guardadas para los ajustes FACS. Coloque los pocillos restantes en la incubadora.
    7. Recoger las muestras cada 1,5 a 3 h con el fin de obtener una adecuada distribución de la progresión del ciclo celular. En cada punto de tiempo, realice el procesamiento de la muestra (para la extracción de ARN y para el análisis FACS) como se describe en 1.1.8.1-1.1.8.2.
  3. Tratamiento con agentes dañinos del ADN
    NOTA: Siempre que el objetivo sea elucidar el efecto de un compuesto ( por ejemplo , agentes dañinos del ADN) en eventos de ciclo celular, cualquiera de los métodos de sincronización descritos anteriormente puede serCombinado con el tratamiento de las células con el agente genotóxico. Con el fin de seleccionar el método de sincronización, es importante considerar la fase del ciclo celular que nos gustaría analizar. En general, el procedimiento Thy-Noc puede ser adecuado para estudiar el efecto de un compuesto en fase G1 o entrada en fase S, mientras que la sincronización mediada por HU puede ser más adecuada para estudiar el impacto en fases S a G2 o en la entrada a mitosis.
    1. Análisis del efecto de los agentes genotóxicos en la fase G1 o en la fase S
      1. Sincronice las celdas como se describe en 1.1.2. A 1.1.6.
      2. Liberar las células del nocodazol y re-plancharlas como se describe en 1.1.7. Incubarlos a 37 ° C en una atmósfera humidificada con 5% de CO 2 durante 3 h para dejar que se adhieren antes de agregar agente (período de incubación requerido puede variar dependiendo de la línea celular).
      3. Agregue el agente y recoja las muestras como se describió anteriormente en 1.1.8.
    2. Análisis del efecto de los agentes genotóxicos en SG2 fases o entrada M
      1. Sincronice las celdas como se describe en 1.2.2. A 1.2.5.
      2. Liberar las células de HU como se describe en 1.2.6. Y agregue el agente inmediatamente.
      3. Recoger las muestras como se describe anteriormente en 1.8.
  4. Seguimiento de la sincronización celular y la progresión a través del ciclo celular por tinción con yoduro de propidio (PI) y análisis FACS
    NOTA: Las muestras recogidas en todos los puntos de tiempo junto con las necesarias para definir ajustes FACS se pueden almacenar a 4 ° C una vez que se han fijado (como se menciona en 1.1.8.2). Realizar la tinción con solución PI seguido de análisis FACS para todas las muestras del experimento simultáneamente. PI se intercala en la ranura principal del ADN bicatenario produciendo una señal altamente fluorescente cuando se excita a 535 nm con un pico de emisión amplio alrededor de 600 nm. Puesto que PI también puede unirse a ARN de doble hebra, es necesario tratar las células con RNasa para una resolución óptima del ADN.
    1. Prepare una solución de tinción PI recién hecha. Se puede preparar una solución madre PI disolviendo el polvo PI en PBS ( por ejemplo, 5 mg / ml). Guarde la solución madre a 4 ° C (en la oscuridad). La solución de tinción se compone de PI (140 μM), citrato de sodio (38 mM) y Triton X-100 (0,01% v / v).
    2. Calentar una superficie adecuada ( por ejemplo, horno) a 37 ° C.
    3. Centrifugar las células fijas (450 xg, 5 min, RT), decantar el sobrenadante (etanol) y lavar una vez con 1x PBS.
    4. Centrifugar de nuevo las células, eliminar PBS y añadir 300 μ l de solución de tinción PI por muestra (excepto a una de las muestras para FACS ajustes, añadir PBS a esta muestra en su lugar).
    5. Transfiera las células a los tubos FACS (tubos de poliestireno de fondo redondo de 5 ml).
    6. Añadir 1 μl de RNasa A a cada muestra, mezclar e incubar las muestras durante 30 min en oscuridad a 37 ° C. Las muestras pueden almacenarse protegidas de la luz a 4 ° C durante un máximo de 2 - 3 días.
    7. Analizar el contenido de ADN en muestras por flujoCitometría. Defina los ajustes de compensación de análisis FACS con muestras asíncronas teñidas con PI. Utilice una muestra en blanco (sin la solución de tinción PI) para verificar la autofluorescencia. Fundamentos de la tinción PI mediada por el análisis de contenido de ADN por citometría de flujo se ha descrito anteriormente [ 9] .
  5. Determinación del índice mitótico por doble fosfo-H3 (Ser 10) / tinción PI
    NOTA: Las células sometidas a mitosis pueden detectarse fácilmente mediante citometría de flujo con anticuerpos específicos para la fosfo-histona H3 en Serina 10 (pH3). Una tinción concomitante de PI es útil para determinar la distribución basada en el contenido de ADN de la población celular. Se requieren 5 muestras para las configuraciones óptimas de las configuraciones FACS: blanco, sólo PI, sólo pH3, sólo anticuerpo secundario y doble tinción.
    1. Centrifugar las células fijas (450 xg, 5 min, 4 ° C) y descartar el sobrenadante. Se describen los siguientes pasos para realizar tinción en tubos de 15 mL.
    2. Lavar las células añadiendo 1Ml de PBS - T (PBS + Tween - 20 al 0,05%) al sedimento y centrífuga (450 xg, 5 min, 4ºC). Eliminar el sobrenadante.
    3. Añadir el anticuerpo anti-pH3 diluido (1: 500) en 100-200 μL de PBS-T + BSA al 3%, e incubar con balanceo durante 2 h a RT (o O / N a 4 ° C).
    4. Añadir 2 ml de PBS-T (PBS + 0,05% de Tween-20) y centrifugar (450 xg, 5 min, 4 ° C). Eliminar el sobrenadante.
    5. Lavar una vez más añadiendo 2 ml de PBS-T al sedimento, centrifugar y desechar el sobrenadante.
    6. Se añade un anticuerpo secundario (anti-conejo AlexaFluor 488 en el caso del anticuerpo pH3 seleccionado) diluido (1: 500) en 100-200 μL de PBS-T + BSA al 3% y se incuba con balanceo durante 1 h a RT (o O / N A 4 ° C). Proteger las muestras de la luz.
    7. Lavar dos veces con PBS-T (2 mL) por centrifugación como se describe en el paso 1.5.4.
    8. Realizar tinción PI como se describe (pasos 1.4.1 a 1.4.6).

2. Recolección y procesamiento de muestras para el análisis de la expresión génica

  1. Tomar1,5 mL microcentrífuga muestras en el reactivo de aislamiento de ARN fuera del congelador y dejarlos descongelar a RT dentro de un armario de seguridad para los productos químicos.
  2. Añada 400 μl de cloroformo a cada muestra y agite vigorosamente (pero no vórtice) hasta completar la mezcla. Incubar las muestras durante 5 min a RT.
  3. Centrifugar los tubos durante 15 min (≥8.000 xg, 4 ° C) en una microcentrífuga de sobremesa.
  4. Transferir la fase acuosa (superior) a un nuevo tubo de microcentrífuga de 1,5 ml y registrar el volumen transferido (para simplificar el procedimiento, se recomienda recoger volúmenes iguales en todas las muestras del experimento).
  5. Añadir 1 volumen de etanol 100% lentamente (gota a gota) a la fase acuosa mientras se mezcla. No centrifugar.
  6. Lleve a cabo los siguientes pasos con el kit de mini preparación para ARN comerciales. Pipetee hasta 700 μl de cada muestra, incluyendo cualquier precipitado que se haya formado, en una columna giratoria en un tubo de recogida de 2 ml (suministrado por el fabricante).
  7. Cierra elTapa y centrifugadora (≥ 8.000 g, RT) durante 15 s. Deseche el flujo. Repita el paso anterior con la muestra restante (si existe).
  8. Siga las instrucciones del fabricante para el lavado y la elución de ARN (eluir cada muestra en 30-40 μl de H 2 O libre de nucleasa para lograr una concentración de ARN apropiada para el siguiente paso).
  9. Determine la concentración de ARN y la pureza de las muestras mediante mediciones de absorbancia (una relación A 260/280 de 2,0-2,1 indica una buena pureza de la muestra de ARN). Almacene muestras de ARN a -80 ° C hasta su uso para el análisis RT-qPCR.
  10. Para la conversión de ARN en ADNc y PCR cuantitativa subsiguiente, tomar 1 μg de ARN por muestra y preparar la reacción de retrotranscriptasa de acuerdo con las instrucciones del fabricante. Las muestras de ADNc obtenidas se pueden almacenar a 4ºC (durante un par de días) oa -20ºC (durante períodos de tiempo más prolongados).
    NOTA: La preparación de la muestra, el diseño del cebador y otras consideraciones para la PCR en tiempo real han sido exTensivamente descrito en la literatura 22 , 23 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Representación esquemática de los protocolos Thy-Noc y HU para la sincronización celular.

La Figura 1 resume los pasos requeridos para la sincronización de células U2OS y la posterior recogida de muestras con el fin de verificar la progresión a través del ciclo celular y realizar análisis de expresión génica.

Phospho-H3 y tinción PI son buenos parámetros de evaluación para seleccionar los métodos de sincronización.

Los procedimientos de sincronización celular deben ser evaluados y optimizados para cada línea celular debido a la heterogeneidad inherente de las células cultivadas. La sincronización en la mitosis se logra típicamente con el protocolo de Thy-Noc, y el enriquecimiento de células mitóticas después del tratamiento con nocodazol puede ser evaluado con anticuerpos específicos para la histona fosforilada H3 (pH3), un marcador mitótico típico. Ide Ntification de células positivas para pH3 permite discriminar entre las células mitóticas y aquellas con un contenido de ADN 4C que no sufren mitosis (todas las cuales se consideran una población "G2" por tinción PI). En las células U2OS el protocolo Thy-Noc condujo a un enriquecimiento significativo de una población con contenido de ADN 4C (Figura 2A, gráfico superior izquierdo, población azul por tinción PI) y la fracción relativa de células mitóticas dentro de esta población era rutinariamente bastante pura 91% comparado con 2% en células asíncronas). La liberación de nocodazol da como resultado una progresión sincronizada de las células a la siguiente fase G1, determinada por la acumulación de una población con contenido de ADN 2C ( Figura 2A , gráfico superior derecho, población verde por tinción PI) y la casi desaparición de mitosis positivas para pH3 ( Figura 2A , gráfico inferior derecho). Por tanto, los resultados de tinción con pH3 confirmaron la idoneidad del protocolo Thy-Noc para la sincronización mitótica de células U2OS.

La sincronización de células U2OS en G1 / S se ensayó con timidina e hidroxiurea, dos synchronyzers ampliamente utilizados.El enriquecimiento en diferentes fases del ciclo celular se determinó por tinción de PI y FACS análisis y el porcentaje de las células se resumen en una tabla ( Figura 2B ) .A 24 h exposición de las células U2OS Thy (2mM) fue ineficiente en la detención de las células G1 / S frontera ( Figura 2B ], mientras que el tratamiento con HU o con un doble Sin embargo, sólo las células tratadas con HU se recuperaron completamente de la detención y progresaron adecuadamente a través del ciclo celular, mientras que el bloque DT indujo una detención G1 permanente en una fracción significativa de la población celular ( 13,3% de las células en G1 a las 6 h con DT vs 3,1% con HU-based protocolo), lo que afectó negativamente a la sincronía celular.Por lo tanto, la exposición a HU se recomienda como una adecuada G1 / S sincronización methOd para las celdas U2OS.

Los protocolos basados ​​en Thy-Noc y HU son complementarios para la sincronización celular.

Como se muestra en la Figura 3A (0 h de tiempo), el tratamiento por el protocolo Thy-Noc detenido eficazmente las células U2OS en fase M entrada (población con contenido de ADN 4C, se muestra en azul) y el tratamiento por protocolo HU detenido células en G1 / S límite (Población con contenido de ADN 2C, mostrada en verde / rojo). Tras la eliminación de los fármacos, las células entraron y progresaron a través del ciclo celular de una manera sincronizada. Las células recuperadas del tratamiento Thy-Noc se observaron por primera vez en la fase G1 temprana (población en verde) y posteriormente se hicieron la transición a través de G1 y hasta la fase S de una manera uniforme. Las células recuperadas del tratamiento con HU progresaron sincrónicamente a través de S (población en rojo) y G2 / M. La progresión a través del siguiente ciclo celular fue concomitante con la pérdida de sincronía. ConsejeroY, los puntos de tiempo de más de 15 horas no se incluyeron en estos análisis debido a la pérdida de sincronía después de este punto de tiempo.

El análisis de transferencia de Western de la ciclina E1 (una ciclina G1 / S) y de la ciclina B1 (una ciclina G2 / M), dos proteínas cuyos niveles están estrictamente regulados en el ciclo celular y del marcador mitótico pH3 confirmaron la fase del ciclo celular de cada uno Punto temporal analizado por FACS ( Figura 3B ). Como era de esperar, las células en fase M (que corresponden a 0 h de tiempo de Thy-Noc-células sincronizadas) y las células en fase G2 a M (9 h a 12 h tiempo de HU-synchronyzed células) mostró una dramática acumulación de ciclina B1 Y niveles indetectables de ciclina E1. Además, los niveles de ciclina B1 fueron bajos a indetectables en fase G1 (3 h después de la liberación de nocodazol) y se observó acumulación gradual a medida que las células avanzaban a través de S (después de la liberación de Thy-Noc) y en G2 (después de la liberación de HU). Fuerte pH3 etiquetado de las células a las 0 h Thy-Noc synchronizatiConfirmó el enriquecimiento de las células detenidas en la mitosis en este momento. Un ligero aumento en los niveles de pH3 a las 12 h después de la liberación de HU reveló que la mayoría de las células con contenido de ADN 4C estaban todavía en G2 mientras que la proporción de células en mitosis aumentaba a las 15 horas. Por el contrario, el patrón de expresión de la ciclina E1 mostró una acumulación progresiva desde la entrada temprana de la fase G1 a la fase S (procedimiento Thy-Noc) y la desaparición gradual en la fase G2 / M (procedimiento HU).

La expresión de genes que se regulan diferencialmente en el ciclo celular puede analizarse con precisión con una combinación de sincronización basada en Thy-Noc y HU.

Como una prueba de concepto de que el ciclo celular regulado análisis de la expresión génica es mejor analizados por una combinación de dos métodos de sincronización celular, mRNA expresión de dos miembros de la familia E2F que se sabe que tienen diferentes cinética de expresión en el ciclo celular(E2F1 y E2F7) se examinaron mediante PCR cuantitativa de transcriptasa inversa (RT-qPCR). Para este fin, Thy-Noc y HU protocolos de sincronización se utilizaron, como se resume en la Figura 1 , y la distribución del ciclo celular se controló por citometría de flujo como se muestra en la Figura 3A . La Figura 4 muestra los perfiles de ARNm de E2F1 (dos grá- ficos superiores) y E2F7 (dos grafos inferiores) a través del ciclo celular. El perfil de regulación transcripcional del gen que codifica E2F1 se observó mejor con el procedimiento de Thy-Noc, con lo que la expresión de E2F1 comenzó a aumentar gradualmente desde la fase G1 temprana hasta alcanzar un pico en la fase G1 tardía (9 h después de la liberación de Thy-Noc. Sus niveles disminuyeron después, concomitante con una entrada en las fases S y G2 (fondos rojos y azules). Por el contrario, la cinética de expresión del gen E2F7 se detectó mejor después de la sincronización basada en HU (gráfico inferior, fondo rojo), con una expresión máxima a las 6 h desde la liberación (correspondiente a la transición de fase S a G2). Thy-NocProcedimiento, por otra parte, era adecuado para observar la inducción de E2F7, pero no su regulación negativa. De nota, la extensión del análisis más allá de 15 h de tiempo reproducido E2F1 y E2F7 ARNm perfiles de expresión de los puntos de tiempo anteriores, aunque con una disminución del rango de mRNA variación (datos no presentados). En conjunto, estos resultados confirman la importancia de trabajar con una población de células adecuadamente sincronizada para evaluar no sólo la cinética de expresión génica, sino también la amplitud exacta de los cambios en los niveles de mRNA.

La sincronización celular proporciona una mejor comprensión del programa de expresión génica afectado por la terapia anticancerígena.

Para analizar el efecto del fármaco antitumoral mitomicina C (MMC) en la dinámica del ciclo celular así como en la expresión génica, las células U2OS se sincronizaron primero con HU y posteriormente se trataron con MMC. La exposición a este agente genotóxico activó un checkpoinT en fase G2 que fue evidente después de 15 h de exposición ( Figura 5A , fila inferior, pico azul). Por el contrario, las células no tratadas progresaron normalmente a través de G1 en este punto de tiempo ( Figura 5A , fila superior, pico verde). El tratamiento a largo plazo con MMC (36 h) reveló una detención permanente de células en fase G2 mientras que las células sin tratamiento con MMC mostraron una distribución del ciclo celular similar a la mostrada por la población de células asíncronas.

E2F1 y p21 Cip1 ( CDKN1A ) fueron elegidos para el análisis de la expresión génica en MMC-células tratadas ( Figura 5B ], dado su diferente ciclo celular dependiente de la regulación. La expresión de E2F1 es G1 dependiente de la fase, como se describe en la Figura 4 , mientras que la inducción de la expresión de p21 Cip1 se acopla a la detención del ciclo celular / activación del punto de control 24 . Como se muestra en la Figura 5B (gráfico de la parte superior izquierda), expresión de genes E2F1 kiNetics fueron similares en la presencia o ausencia de MMC, a medida que las células progresaron a través de G1 / S y en fase S. Se observaron diferencias en la expresión génica de E2F1 entre células MMC tratadas y no tratadas después de 15 h de exposición a MMC, con lo que las células tratadas con MMC expresaron niveles de mRNA de E2F1 más bajos que las células de control ( Figura 5B , comparación de líneas sólidas y discontinuas). Sin embargo, a pesar de la clara diferencia en la expresión, no se puede concluir que la MMC regula negativamente la expresión de E2F1, debido a que los perfiles de ciclo celular de células MMC tratadas y no tratadas son claramente diferentes en estos últimos tiempos, debido a una detención de fase G2 sostenida impuesta por MMC. De hecho, los niveles bajos de ARNm de E2F1 después del punto de tiempo de 15 h en las células expuestas a MMC probablemente reflejan un efecto del fármaco en la dinámica del ciclo celular, en lugar de un efecto de MMC en la regulación transcripcional de E2F1.

En contraste con E2F1, p21 Cip1 es un gen MMC-responsivo. Niveles elevados de p21 Cip1 fueron detectados en HU impuesto G1 / S de detención, lo que indica G1 activación de punto de control por HU ( Figura 5B , 0 h tiempo) y su expresión disminuyó a partir de entonces en las células no MMC tratados, compatible con un unperturbed ciclo celular progresión después de la liberación de arrestar. Por el contrario, el tratamiento con MMC condujo a niveles elevados de mRNA de C21 de p21 ( Figura 5B , gráfico de la parte superior derecha, línea continua) mientras que las células se acumulaban en la fase G2 (9 h de exposición a MMC). A pesar del hecho de que los perfiles de ciclo celular eran similares en el punto de tiempo de 9 h en el control y MMC células tratadas, el análisis de expresión génica muestra una diferencia fundamental. Las células MMC expuestas mostraron un punto de control G2 activado, evidenciado por la inducción de la expresión de p21 Cip1 , mientras que las células no tratadas estaban experimentando una transición no perturbada a través de G2, con bajos niveles de p21 Cip1 .

Los datos obtenidos por análisis de citometría de flujo ( FiGura 5A) y los datos resultantes de RT-qPCR ( Figura 5B , gráficos superiores) se combinaron en un solo gráfico para cada uno de los genes seleccionados ( Figura 4B , gráficos inferiores). Los niveles de expresión de mRNA se muestran como altura relativa de las barras, mientras que la distribución del ciclo celular de las células para cada muestra se ilustra con la proporción de colores: verde para la fase G1 (contenido de ADN 2C), azul para la fase G2 (contenido de ADN 4C) y rojo Para la fase S (contenido intermedio de ADN). Este método combinado de representación gráfica puede ser útil para interpretar la distribución del ciclo celular y el análisis de la expresión génica.

En resumen, el análisis de la expresión génica acoplado a un método de sincronización del cultivo permitió la identificación de un gen genotóxico sensible a los agentes (p21 Cip1 ) y llevó a proponer que los cambios observados en la expresión de E2F1 entre las células tratadas y no tratadas con el agente fueron indirectos,Posiblemente relacionado con las diferencias en la distribución del ciclo celular de las células.

Figura 1
Figura 1: Visión general de dos protocolos complementarios de sincronización celular: Timidina-Nocodazol e hidroxiurea. ( A ) Representación gráfica del ciclo celular de los mamíferos indicando los puntos en los que se consigue la detención del ciclo celular mediante métodos de sincronización celular. El procedimiento basado en Thy-Noc bloquea células en mitosis temprana (M) mientras que HU bloquea células en el límite G1 / S. ( B ) Representación esquemática del protocolo Thy-Noc de sincronización celular. Se muestran los pasos típicamente usados ​​para el análisis de la expresión génica y el monitoreo del ciclo celular en células U2OS. ( C ) Representación esquemática del protocolo de sincronización celular basado en HU. Se muestran los pasos típicamente usados ​​para el análisis de la expresión génica y el monitoreo del ciclo celular en U2OS. También se puede aplicar un procedimiento de sincronización más corto que omita la inanición de suero si la sincronización óptima ya se consigue mediante una exposición de 24 h a HU. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2: Evaluación de métodos adecuados de sincronización. ( A ) Cultivos de células U2OS sincronizados asíncronos y Thy-Noc se sometieron a tinción con pH 3 con el fin de evaluar la fracción de células mitóticas en cada caso. La tinción PI simultánea permitió controlar el contenido de ADN de las células. En la población asíncrona sólo una fracción mínima de células con contenido de ADN 4C (en azul) fueron positivas para el marcador de mitosis. Por el contrario, Thy-Noc protocolo eficientemente accu(Positivo para la tinción pH3) y permitió la progresión adecuada a la siguiente fase G1 (en verde) tras la eliminación de nocodazol (3 h de tiempo). El porcentaje de células en cada fase se resume en la tabla y se etiquetan con colores de acuerdo con los empleados en los histogramas PI: verde para células de contenido de ADN 2C (G1), azul para células con contenido de ADN 4C (incluyendo células G2 y M y denominadas como G2 en los histogramas con el fin de simplificar la figura, y rojo para las células con contenido de ADN intermedio (S) ( B ) Thymidine y HU fueron evaluados para su eficiencia de sincronización del ciclo celular en células U2OS.Las células fueron tratados con timidina (uno o dos Rondas), o con HU durante 24 h, y la sincronización celular se examinó por tinción PI y análisis FACS.Capitalización se utilizó para el análisis de datos FACS.Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3: Esquema del marco temporal para la progresión uniforme de las células después de la sincronización mediada por Thy-Noc y HU. ( A ) Las células U2OS se sincronizaron en fase M por el protocolo Thy-Noc (fila superior) o en transición G1 / S por protocolo HU (fila inferior). La progresión del ciclo celular se monitorizó mediante tinción PI y análisis FACS del contenido de ADN de las células cada 3 h después de la liberación de productos químicos. Summit se utilizó para el análisis de datos FACS. Las células liberadas de la detención mediada por Thy-Noc entraron sincrónicamente en la fase G1 temprana después de 3 h, y progresaron uniformemente hasta la fase S en puntos de tiempo subsiguientes. Las células liberadas de la detención mediada por HU transicionaron de forma sincrónica a través de las fases S y G2. Las células recogidas 15 h después de la liberación representaron los límites para la sincronización celular, ya que la progresión a la siguiente fase sólo se alcanzóD por una fracción de la población. ( B ) La sincronización celular se monitorizó mediante análisis de transferencia Western mediante la recogida de muestras de proteína cada 3 hy hasta 15 horas después de la liberación. Cinética de expresión de la ciclina E1 (CCNE1), una ciclina predominantemente acumulada a través de la fase S, ciclina B1 (CCNB1), presente principalmente de fase G2 a M y pH3, marcador de células mitóticas, perfiles de distribución del ciclo celular corroborados observados por citometría de flujo. Actina B (ACTB) se utilizó como un control de carga endógena porque sus niveles no dependen del ciclo celular. (Como modificado de Mitxelena et al ., 8 ). Haga clic aquí para ver una versión más grande de esta figura.

Figura 4
Figura 4: Estudio del ciclo celular Phase-dependen T Transcripción de miembros de la familia E2F mediante métodos complementarios de sincronización celular. Las células U2OS fueron detenidas en G2 / M por el protocolo Thy-Noc o en G1 / S por tratamiento HU y las muestras se recogieron para extracción de ARN y análisis FACS cada 3 h hasta 15 h después de la liberación de la detención. El análisis de la expresión génica por RT-qPCR reveló un perfil de expresión E2F1 circunscrito principalmente a G1 (gráfico superior izquierdo) mientras que el perfil de expresión del gen E2F7 se desplazó a la fase S, con una regulación descendente gradual a través de la fase G2 (gráfico inferior derecho). El TBP se utilizó como gen endógeno no regulado por el ciclo celular para calcular los cambios relativos en los niveles de mRNA y los resultados se representaron como los valores medios y la desviación estándar (DE). La progresión a través del ciclo celular se determinó por tinción PI y análisis FACS del contenido de ADN de las células. Las fases del ciclo celular se representaron como colores de fondo en los gráficos: negro (detención en mitosis temprana), verde (fase G1), rojo (fase S) y azul (fase G2)..com / files / ftp_upload / 55745 / 55745fig4large.jpg "target =" _ blank "> Haga clic aquí para ver una versión más grande de esta figura.

Figura 5
Figura 5: Impacto de MMC en la expresión génica y la progresión del ciclo celular. Las células U2OS se trataron con HU durante 24 h, y se añadió MMC (250 nM) inmediatamente después de la liberación de la detención de G1 / S mediada por HU. Las muestras para el análisis de FACS y el análisis de la expresión génica se recogieron en los puntos de tiempo indicados. ( A ) La progresión a través del ciclo celular se determinó mediante tinción de PI y análisis FACS del contenido de ADN por el software Summit. MMC indujo un retraso moderado en la progresión a través de la fase S (población roja) y una detención permanente en la fase G2 (población azul), como se muestra por la ausencia de células en G1 (población verde) después de 15 h de tratamiento A no-Tratadas (fila superior). ( B ) E2F1 y p21 El análisis de expresión de genes Cip1 en células MMC tratadas o no tratadas se realizó a nivel de ARNm mediante RT-qPCR. Se utilizó Oxa1L como un gen endógeno no sensible a MMC y los resultados se representaron como valores medios y SD. Gráficos superiores representan los niveles de mRNA relativa de los genes seleccionados después de la liberación de HU y la adición de MMC. Los gráficos más bajos combinan los datos obtenidos por análisis FACS y RT-qPCR. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El análisis de la regulación fina de los genes regulados implicados en papeles transitorios y específicos en el ciclo celular requiere una población celular uniforme. Muchos investigadores usan rutinariamente líneas de células tumorales establecidas desde hace mucho tiempo para estos propósitos, y se han desarrollado una variedad de métodos para obtener poblaciones de células síncronas (o parcialmente sincrónicas), con el objetivo de acumular tantas células como sea posible en fases definidas de ciclo celular. Además, se han realizado grandes esfuerzos para mejorar y optimizar los enfoques de sincronización bien establecidos. Sin embargo, todos los protocolos de sincronización tienen inconvenientes, que pueden atribuirse a la heterogeneidad de los cultivos celulares, a la eficiencia subóptima de los procedimientos de sincronización, oa los efectos secundarios que tienen los sincronizadores químicos en la función celular, entre otros. Estas limitaciones deben tenerse en cuenta al aplicar protocolos de sincronización de células. Los investigadores necesitan identificar los métodos de sincronización más adecuados para susIc o el experimento. Incluso cultivando diferentes líneas celulares exactamente de la misma manera, las tasas de sincronización resultantes pueden diferir debido a varias razones. Por un lado, la duración del ciclo celular puede variar dependiendo de la línea celular seleccionada; Por otro lado, el mismo inhibidor puede tener efectos contrastantes sobre diferentes líneas celulares debido a características particulares de cada línea celular 25 . Además, la concentración de inhibidor y el tiempo de exposición seleccionados siempre deben ajustarse a cada línea celular para evitar o minimizar la toxicidad secundaria no deseable 26 . Incluso después de la optimización de todos estos aspectos, el 100% de acumulación de células en una determinada fase del ciclo celular nunca se logra, y asincronía aumenta gradualmente después de la eliminación de la sustancia química [ 27] . Por lo tanto, es importante comprender que los métodos de sincronización obtienen en el mejor de los casos enriquecimientos de población de células parciales en un marco de tiempo particular.

En este Ork dos procedimientos de sincronización (Thy-Noc y HU) se han optimizado para su uso en células U2OS, ambos de los cuales se utilizan ampliamente para los ensayos de sincronización celular [ 28 , 29 , 30] . Para detener las células en fase M, una combinación de timidina y nocodazol trabajó eficientemente en células U2OS. Dada la naturaleza citotóxica del nocodazol, era importante determinar el tiempo de exposición y la dosis de este inhibidor con el fin de obtener no sólo una población celular altamente sincronizada sino también una supervivencia celular óptima. La exposición previa a timidina (o teóricamente cualquier otro compuesto similar tal como hidroxiurea) condujo a un enriquecimiento de la población celular en fases G1 y S, disminuyendo así el tiempo de exposición requerido de nocodazol. Para detener las células en G1 / S, se consideraron varias posibilidades, incluido el bloqueo doble de timidina, un método que es muy eficiente en la sincronización de varias líneas celulares"31 , 32. Sin embargo, la timidina fue descartada debido a sus resultados decepcionantes en U2OS.Una ronda de tratamiento con timidina sólo arrestó una fracción de células, mientras que dos rondas de tratamiento con timidina bloquearon eficientemente la mayoría de las células en G1 / S, pero una G1 La población se mantuvo después de la liberación de la timidina y la progresión del ciclo celular no procedió de manera uniforme.En contraste, el tratamiento con hidroxiurea proporcionó buenos resultados de bloqueo G1 / S y progresión uniforme de las células a través de S y en G2.

La distribución de fase del ciclo celular debe ser examinada cada vez que se realizan experimentos de sincronización celular ( por ejemplo, mediante tinción con yoduro de propidio o marcaje pH3 seguido por análisis FACS o por inmunotransferencia de proteínas específicas de fase de ciclo celular) 16 , 33 , 34 con el fin de interpretar mejor la expresión génica Resultados. Una eficacia de sincronización incorrectaNcy o ligeras diferencias inter-experimentales en la progresión a través del ciclo celular pueden conducir a conclusiones erróneas. Por ejemplo, se sabe que el tratamiento con nocodazol causa fallo de la función de control mitótico bajo ciertas condiciones. Esto da lugar a una población de células con contenido de ADN 4C pero negativa para marcadores mitóticos 34 que "desliza" la división mitótica y vuelve a interfase con un contenido 4C 35 . La aparición de este subconjunto de células, que puede detectarse mediante inmunotinción con anticuerpos anti-fosfo-H3 (véase la Figura 2A ), puede minimizarse mediante el uso de PBS frío para las etapas de lavado con nocodazol. Otro efecto asociado con el uso de inhibidores químicos que afecta la sincronía celular es la activación del punto de control asociada con la exposición a estos compuestos 36 , 37 , un mecanismo mediante el cual la célula detiene activamente la progresión a través del ciclo celular hasta que puedeAsegurarse de que los procesos previos a ese punto preciso (por ejemplo, replicación correcta del ADN, montaje del huso), se resuelvan 38 . Para que un método de sincronización sea adecuado, la detención debe ser no sólo eficiente sino también completamente reversible. Por lo tanto, después de la liberación de inhibidores del ciclo celular es importante analizar si los efectos del inhibidor han sido revertidos, por ejemplo analizando la expresión de marcadores de punto de control, tales como p21 CIP . La Figura 5B muestra que las células U2OS sincronizadas con hidroxiurea resolvieron eficazmente el punto de control, porque los niveles de p21 CIP se redujeron a expresión basal después de la liberación.

En las células U2OS, los porcentajes de enriquecimiento tras la detención del ciclo celular están dentro del rango reportado por otros estudios sobre la sincronización celular 29 , 30 , 39 : alrededor del 85% de células con contenido de ADN 4C (tinción PI) y aproxiAproximadamente el 90% de los que se encontraban en mitosis (marcado positivo con pH 3) en el tratamiento con timidina-nocodazol y alrededor del 80-90% de las células G1 / S después del tratamiento con hidroxiurea. La liberación de la detención del ciclo celular típicamente conduce la progresión apropiada a través de la siguiente o dos fases de una manera uniforme, aunque la sincronización se pierde invariablemente después de varias horas y las células son incapaces de completar un ciclo completo de división celular de una manera sincronizada. Por lo tanto, con el fin de obtener una imagen completa de todas las fases del ciclo celular, el protocolo propuesto en este trabajo hace uso de dos métodos de sincronización de diferentes partes del ciclo celular. Como se muestra en la Figura 3A , cada protocolo individual no garantizar la sincronicidad en todo un ciclo celular. La sincronización basada en Thy-Noc proporcionó un marco apropiado para los procesos que ocurren en fases G1 a S, mientras que las células liberadas de HU eran adecuadas para el análisis de los eventos que tenían lugar durante S y G2 / M. Las complementariedades de los dos procedimientos( Figura 4 ), apoyando la idea de que la combinación de dos métodos que se sincronizan en diferentes fases del ciclo celular es un poderoso enfoque para establecer con precisión la expresión de genes regulados por el ciclo celular Patrones y para comprender mejor su función fisiológica.

Una aplicación convincente de los procedimientos de sincronización celular se centra en la evaluación del impacto de agentes terapéuticos potenciales. El efecto de los compuestos farmacéuticos, tales como los que tienen actividad antitumoral, se estudia a menudo en poblaciones de células asíncronas. Bajo estos ajustes es posible determinar la implicación del fármaco seleccionado en la inducción de varios procesos tales como muerte celular, detención del ciclo celular o senescencia 7 , 40 . Sin embargo, la selección de la configuración de células asíncronas para la identificación de eventos moleculares precisos que regulanTales procesos pueden conducir a conclusiones incompletas o parcialmente erróneas. Este punto, que a menudo se pasa por alto, se ha ilustrado en el presente trabajo analizando el efecto del fármaco quimioterapéutico MMC en E2F1 y p21 expresión del gen Cip1 ( Figura 5 ]. En general, la combinación de sincronización celular y tratamiento con agentes genotóxicos proporciona un contexto adecuado para estudiar la expresión de genes que responden al agente genotóxico y para discriminar a partir de los afectados por las perturbaciones del ciclo celular impuestas por el agente.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Agradecemos a los miembros de los laboratorios Zubiaga y Altmeyer por sus útiles debates y por su apoyo técnico. Este trabajo ha contado con el apoyo del Ministerio Español (SAF2015-67562-R, MINECO / FEDER, UE), el Gobierno Vasco (IT634-13 y KK-2015/89) y la Universidad del País Vasco UPV / EHU UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
Estudio de la expresión genética regulada por el ciclo celular mediante dos protocolos complementarios de sincronización celular
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter