Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Hücre Çevrimiyle Düzenlenen Gen İfadesini İki Tamamlayıcı Hücre Senkronizasyon Protokolü İle Çalışmak

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

Hücre döngüsünün belirli evreleriyle ilgili olayları incelemek için bir bağlam sağlayan iki hücre senkronizasyon protokolünü bildiriyoruz. Bu yaklaşımın, pertürbüssüz bir hücre döngüsünde spesifik genlerin düzenlenişini analiz etmek için veya hücre döngüsünü etkileyen maddelere maruz kaldığında yararlı olduğunu göstermektedir.

Abstract

Hücre döngüsünün gen ekspresyon programı, hücre döngüsüne bağımlı süreçleri ve kanser gibi hastalıklarda rollerini anlamak için kritik bir aşamayı temsil eder. Hücre döngüsü düzenleyen gen ekspresyon analizi, belirli fazlara hücre senkronizasyonuna bağlıdır. Burada, hücre döngüsü boyunca gen ifadesinin periyodik değişimini incelemek için yaygın olarak kullanılan iki tamamlayıcı senkronizasyon protokolünü kullanan bir yöntemi açıklıyoruz. Her iki prosedür, tanımlanmış bir noktada hücre döngüsünün geçici olarak bloke edilmesine dayanır. Hidroksiüre (HU) muamelesiyle senkronizasyon protokolü geç G1 / erken S evresinde hücrenin durması ve HU aracılıklı tutuklamadan salınma, S ve G2 / M boyunca düzgün bir şekilde ilerleyen hücresel bir nüfusu sağlar. Timidin ve nokodazol (Thy-Noc) tedavisinin erken mitozda hücreleri bloke ettiği ve Thy-Noc aracılı arrestten salındığı senkronizasyon protokolü, G1 fazı ve S fazı için uygun senkronize edilmiş bir hücre popülasyonu sağlarÇalıştırmayı deneyin. Her iki prosedürün uygulanması, tipik olarak, hücrelerin propidyum iyodür (PI) boyaması ve akış sitometrisinin aracılık ettiği DNA içeriğinin analizinden sonra gerçekleştirilen hücre döngüsü dağıtım profillerinin izlenmesini gerektirir. İki senkronizasyon protokolünün kombine kullanımının, hücre döngüsünde ( örn. E2F1 ve E2F7) farklı şekilde regüle edilen genlerin transkripsiyonel profillerini açıkça belirlemek ve sonuç olarak hücre döngüsündeki rollerini daha iyi anlamak için sağlam bir yaklaşım olduğunu gösteriyoruz süreçler. Ayrıca, bu yaklaşımın, ilaç kökenli terapileri ( yani , bir anti-kanser ajanı olan mitomisin C) altında yatan mekanizmaların incelenmesi için yararlı olduğunu göstermekteyiz, çünkü genotoksik ajana yanıt veren genleri hücre döngüsünün bozulmalarından etkilenen genlerden ayırt etmeye imkan tanır Aracı tarafından dayatılan.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hücre döngüsünün tüm aşamalarına geçiş, sıkı düzenlenen bir gen ifade programı ile birleştirilir. Hücre döngüsü boyunca gen transkripsiyonunun "açık ve kapalı" koordine edilmesinin, kompleks transkripsiyon düzenleyici sistemlerin kontrolü altında olduğuna, sadece zamanlamayı değil aynı zamanda gen ifadesinin seviyelerini de düzenlediğine inanılmaktadır. Anahtar hücre döngüsü bileşenlerinin düzenlenmesinin çeşitli hastalıkların gelişimine katkıda bulunduğu bilinmektedir ve bu, tümörojenezin iyi bilinen bir özelliktir 1 , 2 . Maya ve memeli hücrelerinde gerçekleştirilen genom çapındaki transkriptomik analizler, çok sayıda genin hücre döngüsünde periyodik gen ekspresyonu modelleri sergilediğini ortaya koymuştur; bu, hücre döngüsü boyunca transkripsiyonel dalgalanmanın, belirli bir gen ürününün zamansal gereksiniminin bir yansıması olduğunu düşündürmektedir Kesin bir fazda 3 , 4 , 5 .

Hücre döngüsü düzenleyen gen ekspresyonu çalışmasında önemli bir görev, hücrelerin spesifik hücre döngüsü fazlarına senkronize edilmesidir. Hücre senkronizasyonu, bir gen ekspresyon modelinin belirli bir hücre döngüsü faz geçişine ilişkisini yorumlamaya yardımcı olur ve birçok genin düzenlenmesi ve işlevinin daha iyi anlaşılmasına yol açmıştır. Hücre senkronizasyonu, kemoterapötik ajanların hem gen ekspresyonunu hem de hücre döngüsü kinetiğini etkilediği için antikanser ilaçların etki mekanizmasını incelemek için de önemlidir 6 , 7 . Bununla birlikte, bu ajanlarla yapılan tedaviden kaynaklanan gen ekspresyon farklarının tedaviye doğrudan müdahale olup olmadığının veya sadece hücre döngüsü profillerinde meydana gelen değişimlerin sonucunun olup olmadığının belirlenmesi genellikle zordur. Bu olasılıkları birbirinden ayırmak için, gen ekspresyonu,Kemoterapötik ilacın ilavesinden önce senkronize edilmedi.

G08'de senkronize edilen homojen bir hücre popülasyonu oluşturan taze izole edilmiş lenfoid hücreler gibi bazı birincil hücreler dışında, in vitro olarak belirlenen hücre hatları kültürde eşzamansız olarak büyür. Normal büyüme koşulları altında, bu eşzamansız döngülü hücreler, hücre döngüsünün her aşamasında, ancak tercihen G1 9'da bulunur . Dolayısıyla, bu bağlam belirli bir hücre döngüsü fazında ( örn. G1, S vb.) Fonksiyonel veya gen ekspresyon analizleri için optimal bir senaryo sağlamamaktadır. Dönüştürülmemiş ölümsüzleştirilmiş hücre çizgileri ( örneğin fibroblastlar), fizyolojik yöntemlerle senkronize edilebilir10. Bu yöntemler, bisiklet sürmeye devam etmek için, hücre teması inhibisyonu ve büyüme faktörü bağımlılığı gibi dönüştürülmemiş hücrelerin tutulan birincil hücre özelliklerine dayanır. uzaklaştırmaTemas inhibisyonu ile kombinasyon halinde, G0 / G1'de tutulan transforme edilmemiş hücreler oluşturmaktadır. Bununla birlikte, senkronize hücre döngüsü girişi ve ilerlemesi, genellikle, hücrelerin yapay olarak ayrılması ve yeniden kaplama 10'u içeren alt-kültürü gerektirir. En önemlisi, bu yöntem, halihazırda kullanımda olan ve hücre kontak aracılı büyüme inhibisyonu ya da büyüme faktörü geri çekilmesine tepki bulunmayan karakterize edilen transforme edilmiş hücre hatlarının senkronizasyonu için uygun değildir. Böylece, hücre döngüsünün spesifik evrelerinde etkin hücre senkronizasyonu için alternatif yöntemlerin gerekli olduğu açıktır. Genel olarak, en sık kullanılan senkronizasyon yöntemleri, tipik olarak DNA sentezi veya mitotik iğ oluşumu gibi hücre döngüsünün tanımlanmış bir noktasının geçici kimyasal veya farmakolojik inhibisyonuna dayanır. DNA sentezinin engellenmesi, onları geç G1 veya erken S evresinde tutarak hücreleri senkronize eder. Bu olabilir achiBir nükleotid biyosentezi 11,12, afidikolin, DNA polimeraz 13 , 14 inhibitörü, hidroksiüre, ribonükleotid redüktaz 15 , 16'nın bir inhibitörü veya fazla miktarlarda timidin 17,18 ile imünosin gibi bileşiklerin ilavesi ile ortaya çıkar. Öte yandan, kolşisin ya da nokodazol gibi mikrotübül polimerizasyonu önleyicileri, M evresi 19 , 20 , 21'in erken evrelerinde hücre senkronizasyonuna yol açan mitotik iğ oluşumunu bloke edebilir.

Bu çalışmada mRNA'da hücre döngüsü düzenleyen genlerin ekspresyonunu incelemek için geçici kimyasal inhibisyona dayalı iki tamamlayıcı senkronizasyon protokolünü içeren bir yöntemi açıkladıkseviyesi. Bu yöntem, belirli hücre döngüsü süreçlerinde hücre döngüsü genlerinin rolünün tanımlanması için temel önemdedir. Ayrıca, ilaçla tepki veren genleri doğru bir şekilde saptamak ve bu ilaçlar tarafından üretilen hücre döngüsü ilerlemesindeki pertürbasyonlardan kaynaklanan yanlış yorumlamaları en aza indirgemek için antikanser tedavilerinin etkisini incelemek için genel bir çerçeve sağlar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Hücresel Senkronizasyon, Hücre Döngüsü Progresyonunun Yayımı ve İzlenmesi

  1. Timidin ve nokodazol esaslı (Thy-Noc) senkronizasyon ve Mitozdan U2OS hücrelerinin salınımı
    1. Gerekli hücre kültürü ortamı hazırlayın. U2OS hücreleri,% 10 (hac / hac) FBS ile tamamlanan DMEM-Glutamine ortamında rastgele büyütülür (isteğe bağlı olarak:% 1 penisilin / streptomisin). Tüm orta hazırlama ve manipülasyonu steril koşullar altında gerçekleştirin ve tamamlanıp hazırlanan ortamı (bundan böyle "eksiksiz ortam" olarak anılacaktır), kullanımdan önce 37 ° C'ye ısıtın.
    2. Tohum 10 ml komple kültür ortamında 100 mm çanak başına 2 x 10 6 U2OS hücreleri. Gerekli bulaşıkların sayısını hesaplamak için, her bir 100 mm'lik çanağın tipik olarak, 6 oyuklu bir plakanın yaklaşık 5 kuyucuğunu (0.2-0.25 x 10 6 hücre / oyuk) yeniden plaklamak için yeterli mitotik hücre sağladığını göz önünde bulundurun (bkz. Şekil 1B ). Seçilen zaman noktası başına iki kuyu requir(RNA ekstraksiyonu için 1, hücre döngüsü izlemesi için 1 kuyu). Ek olarak, protein analizi için zaman noktası başına üçüncü bir kuyu toplanabilir.
      NOT: Akşamları (yaklaşık 19:00) hücreleri plakalayın, böylece müteakip adımlar ertesi gün çalışma saatlerinde yapılabilir. FACS analiz kompanzasyonu ayarlarını tanımlamak için eşzamansız büyüyen hücrelerin 2 kuyucuğunu ekleyin.
    3. 100 mm yemekleri 37 ° C'de% 5 CO2 ile nemli bir atmosferde 24 saat inkübe ederek hücreleri 24 saat süreyle tutturun.
    4. Timidin bloğu için, 145.2 mg timidin tozunu 3 mL H20 (veya eşdeğer miktarda) eriterek 200 mM timidin stok solüsyonu hazırlayın ve solüsyonu, 0.2 um gözenekli bir filtreden süzerek sterilize edin. Hafif ısınma, timidin eritilmesine yardımcı olabilir. Her 100 mm kültür çanağına (nihai konsantrasyon 2 mM) yeni hazırlanmış 200 mM stoktan 100 uL ekleyin. Hücreleri timidin ile 20 saat 37 ° C'de inkübe edin76 ° C'de% 5 CO2 ile nemli bir atmosferde.
      NOT: Ertesi gün, timidin salınımını ve nokodazol blokunu gerçekleştirmek için vakit geçirmek için akşamları hücreleri (akşam 7'de) tedavi edin.
    5. Timidin bloğundan salınmak için ertesi gün öğleden sonra (3 pm) timidin içeren büyüme ortamını çıkarın; Hücreleri önceden ısıtılmış 1x PBS ile iki kez yıkayın ve her 100 mm çanağa 10 mL komple ortam ekleyin. Hücreleri 37 ° C'de 5% CO 2 ile nemli bir atmosferde inkübe edin.
    6. Mitotik hücre tutuklaması için, 50 ng / mL (8 pm) nihai konsantrasyona kadar nocodazole ekleyin. Nokodazol tozunu DMSO'ya ( örn. 5 mg / mL) eriterek stok solüsyonu hazırlayın ve -20 ° C'de dondurarak saklayın. % 5 CO 2 ile nemli bir atmosferde 37 ° C'de nukodazol ile hücreleri en az 10 - 11 saat inkübe edin.
    7. N evresindeki nokodazol aracılı tutuklamadan (mitotik salınma) serbest kalma ve numunelerin bir kaç saat poi'den toplanmasıNts (saat 06: 00'da başlayarak).
      1. Her plakayı sallayarak yuvarlak (mitoz) hücreleri ayırın ve nocodazole içeren büyüme ortamı nazikçe pipetle verin. Her bir 100 mm plakadan 50 mL steril tüplere ayrılan hücrelerle toplayın, santrifüjleyin (300 xg, 5 dakika, oda sıcaklığı (RT)) ve santrifüj ile takiben 1x PBS ekleyerek hücreleri iki kez yıkayın. Mitotik kaymanın önlenmesi için soğuk PBS veya PBS artı nokodazol kullanılması önerilir (bkz. Tartışma bölümü).
      2. Her bir 100 mm'lik plaktan toplanan mitotik hücreleri 10 mL komple ortamda tekrar süspanse edin. RNA ekstraksiyonu için 2 mL ve 0 saat zaman noktası için FACS analizi için 2 mL (örnek başına yaklaşık 0.2-0.25 x 106 hücre) kaydedin.
      3. 6 oyuklu plakalarda (2 mL / çukur, 0.2-0.25 x 10 6 hücre / çukur) sonraki zaman noktaları için geriye kalan mitotik hücreleri yeniden plaka haline getirin.
        NOT: Seçilen zaman noktası başına 2 oyuk bulunduğunu unutmayın (RNA için 1, FACS analizi için 1).
    8. Örnekleri toplamaZaman noktaları. Hücre döngüsü ilerlemesinin yeterli bir profilini elde etmek için her 1,5 ila 3 saat önerilir.
      1. RNA ekstraksiyonu için, ortamı çıkarın, 2 mL önceden ısıtılmış 1x PBS ile iyice durulayın ve 1 mL uygun RNA izolasyon reaktifinin ( örn. TRIzol) kuyuya koyun (kimyasallar için bir güvenlik kabinindeki son adımı yapın). Plaka yukarı ve aşağı ayırın ve lizoz hücreleri, hücre lizatını 1.5 mL'lik bir mikrosantrifüj tüpüne aktarın, RT'de 5 dakika inkübe edin ve sonraki kullanıma kadar -80 ° C'de tüp saklayın.
      2. FACS analizi için, 2 mL ön ısıtma 1x PBS ile iyice durulayın, hücreleri ayırmak için önceden ısıtılmış Trypsin-EDTA solüsyonu (0.3 mL / kuyu) ekleyin, 1 mL komple ortam ilave ederek tripsin-EDTA'yı bloke edin ve her numuneyi ayrı bir 15 mL tüp.
        1. Hücreleri (300 xg, 5 dakika, RT) santrifüjleyin, hücresel pelet kaydedin ve süpernatant atın. Hücreleri düzeltmek için yavaşça vorteksleyen tüplerle 1x PBS içinde soğutulmuş 70% (v / v) etanolün 1 mL'sindeki hücreleri tekrar süspansiyon haline getirin ve uygulama için buz üzerine yerleştirin4 ° C'de depolamadan yaklaşık 15 dakika önce veya FACS ile daha ileri analiz için boyama (adım 1.4 - 1.5'de tarif edildiği gibi).
  2. HU tabanlı senkronizasyon ve U1OS hücrelerinin G1 / S sınırından çıkarılması
    1. Adım 1.1'de tarif edildiği gibi komple hücre kültürü ortamı hazırlayın.
    2. 6 oyuklu plakalarda oyuk başına 0.25 x 10 6 U2OS hücresi (oyuk başına 2 mL eksiksiz kültür ortamı). Deney için gerekli kuyuların sayısını hesaplamak için, seçilen zaman noktasına (kuyucuğa RNA ekstraksiyonu için 1, hücre döngüsü izlemesi için 1 kuyucuk) 2 oyuk gerekeceğini ve eşzamansız olarak büyümekte olan hücrelerin 2 kuyusunun FACS analiz kompanzasyonu ayarlarını tanımlamak gerekiyordu.
    3. 6-kuyucuklu plakaları gece boyunca (O / N) 37 ° C'de% 5 CO2 ile nemli bir atmosferde kuluçka ederek hücreleri bağlayın.
    4. Ertesi sabah kuyulardan komple ortamı çıkarın ve 2 mLBaşına önceden ısıtılan FBS içermeyen DMEM-Glutamine ortamı. 37 ° C'de,% 5 CO2 ile nemli bir atmosferde 24 saat daha inkübe edin.
      NOT: Bu adımı 2 dışındaki bütün kuyularda yapın (FACS ayarlarını tanımlamak için kaydedilenler). Hücrelerin basitçe HU ile inkübe edilmesiyle etkin senkronizasyon sağlandıysa, serum geri çekme basamağı atlanabilir.
    5. H1 ile G1 / S hücre döngüsü tutuklanması.
      1. Her kullanımdan önce taze HU stok solüsyonu (500 mM) hazırlayın. 76.06 mg HU tozuna 2 mL H20 ilave edin ve iyice çözünene kadar karıştırın. Çözeltiyi, 0.2 um gözenekli bir filtreden süzerek sterilize edin. 4 mM son HU konsantrasyonu için filtre ile sterilize edilmiş HU stok solüsyonu 400 mcL olan komple ortamın 50 mL'si karıştırın.
      2. FACS ayarlarını tanımlamak için gerekli olan 2 kuyudan hariç tüm kuyucuklardan ortamı çıkarın ve yeni hazırlanmış 4 mM HU ihtiva eden komple ortam (2 mL / çukur) ile değiştirin.
      3. Hücreleri 24 saat inkübe edin.HU içeren ortamı 37 ° C'de% 5 CO 2 ile nemli ortamda kurutun.
    6. HU aracılıklı tutuklamadan hücrelerin salınımı. HU içeren ortamı çukurlardan çıkarın ve önceden ısıtılmış 1x PBS (her seferinde 2 mL) ile çukurları iki kez durulayın. Kuyu başına 2 mL komple ortam ekleyin. 0 saat nokta için (RNA ekstraksiyonu için 1, FACS tarafından hücre döngüsü tutuklama doğrulaması için 1) yanı sıra FACS ayarları için kaydedilen 2 örnek için 2 numune toplayın. Kalan kuyuları kuluçka odasına yerleştirin.
    7. Hücre döngüsü ilerlemesinin yeterli bir dağılımını elde etmek için her 1.5 ila 3 saatte bir örnekleri toplayın. Her zaman noktasında, 1.1.8.1-1.1.8.2'de açıklandığı gibi örnek işleme (RNA ekstraksiyonu ve FACS analizi için) uygulayın.
  3. DNA hasar ajanları ile tedavi
    NOT: Amaç, bir bileşiğin ( örneğin DNA'ya zarar veren ajanlar) hücre döngüsü olaylarındaki etkisini aydınlatmak olduğunda, daha önce tarif edilen senkronizasyon yöntemlerinden herhangi biriHücrelerin genotoksik ajan ile tedavisi ile kombine edilmiştir. Senkronizasyon yöntemini seçmek için, analiz etmek istediğiniz hücre döngüsünün evresini düşünmek önemlidir. Genel olarak Thy-Noc prosedürü, bir bileşiğin G1 fazı veya S fazı girişindeki etkisini incelemek için uygun olabilirken, HU aracılıklı senkronizasyon, S ila G2 fazlarındaki etkiyi incelemek veya mitoz girişinde daha uygun olabilir.
    1. Genotoksik ajanların G1 fazı veya S fazı girişindeki etkisinin analizi
      1. Hücreleri 1.1.2'de açıklandığı gibi senkronize edin. 1.1.6'ya.
      2. Nocodazole'den hücreleri serbest bırakın ve 1.1.7'de tarif edildiği gibi yeniden plakaya yerleştirin. Nemlendirilmiş bir atmosferde 37 ° C'de% 5 CO 2 ile 3 saat inkübe edin ve ajan ilavesinden önce ekleyin (gerekli inkübasyon süresi hücre hattına bağlı olarak değişebilir).
      3. Madde 1.1.8'de anlatıldığı gibi ajan ekleyin ve örnekleri toplayın.
    2. SG'de genotoksik ajanların etkisinin analizi2 faz veya M girişi
      1. Hücreleri 1.2.2'de açıklandığı gibi senkronize edin. 1.2.5'e.
      2. 1.2.6'da açıklandığı gibi HU'dan hücreleri serbest bırakın. Ve ajan hemen ekleyin.
      3. Daha önce 1.8'de açıklanan şekilde örnekleri toplayın.
  4. Propidyum iyodür (PI) boyama ve FACS analizi ile hücre döngüsü boyunca hücre senkronizasyonu ve ilerlemesinin izlenmesi
    NOT: FACS ayarlarını tanımlamak için gerekli olanlarla birlikte tüm zaman noktalarında toplanan numuneler, düzeltildikten sonra 4 ° C'de saklanabilir (1.1.8.2'de belirtildiği gibi). Aynı anda deneyin tüm numuneleri için PI çözeltisi ile lekelenmeyi ve bunu takiben FACS analizi uygulayın. PI, 600 nm civarında geniş bir emisyon pikiyle 535 nm'de uyarıldığında yüksek derecede floresan bir sinyal üreten çift sarmallı DNA'nın ana oluk içine interkale yapar. PI, aynı zamanda çift sarmallı RNA'ya bağlanabildiğinden optimal DNA çözünürlüğü için hücreleri RNaz ile tedavi etmek gerekir.
    1. Yeni yapılmış PI boyama özümü hazırlayın. PI stok solüsyonu PI tozu PBS'de ( örn. 5 mg / mL) çözülerek hazırlanabilir. Stok solüsyonunu 4 ° C'de (karanlıkta) saklayın. Boyama çözeltisi PI (140 uM), sodyum sitrat (38 mM) ve Triton X-100 (% 0.01 v / v) içerir.
    2. Uygun bir yüzeyi ( örn. Fırın) 37 ° C'ye ısıtın.
    3. Sabit hücreleri (450 xg, 5 dak, RT), çökelti süpernatant (etanol) santrifüjleyin ve 1x PBS ile bir kez yıkayın.
    4. Hücreleri tekrar santrifüjleyin, PBS'yi çıkarın ve numune başına 300 pL PI boyama çözeltisi ekleyin (FACS ayarları için örneklerden biri hariç, bunun yerine bu örneği PBS ekleyin).
    5. Hücreleri FACS Tüplerine aktarın (5 mL yuvarlak tabanlı polistren tüpleri).
    6. Her bir numuneye 1 uL RNaz A ekleyin, 37 ° C'de karanlıkta 30 dakika boyunca numuneleri karıştırın ve inkübe edin. Numuneler 4 ° C'de ışığa karşı maksimum 2 - 3 gün saklanabilir.
    7. Akışa göre örneklerdeki DNA içeriğini analiz etmesitometrisi. FACS analiz kompanzasyonu ayarlarını PI boyalı asenkron numune ile tanımlayın. Otofloresansı kontrol etmek için boş örnek (PI boyama çözümü olmadan) kullanın. Akış sitometrisi ile DNA içeriğinin PI boyama aracılı analizinin temelleri daha önce anlatılmıştır 9 .
  5. Çift fosfo-H3 (Ser 10) / PI boyama ile mitotik indeksin belirlenmesi
    NOT: Mitozdan geçen hücreler, Serin 10'da (pH3) fosfo-histon H3'e spesifik antikorlar ile akış sitometrisi ile kolayca tespit edilebilir. Birbirine eşlik eden PI boyaması hücre popülasyonunun DNA içeriğine dayalı dağılımını belirlemek için yararlıdır. FACS ayarlarının en uygun konfigürasyonları için 5 numune gereklidir: boş, yalnızca PI-sadece pH-3, ikincil antikor-only ve çift boyama.
    1. Sabit hücreleri (450 xg, 5 dakika, 4 ° C) santrifüjleyin ve süpernatantı atın. Aşağıdaki adımlar, 15 mL'lik tüplerde boyamanın gerçekleştirilmesi için tanımlanmıştır.
    2. Hücreleri 1Pellet ve santrifüjde (450 xg, 5 dakika, 4 ° C) bir mL PBS-T (PBS +% 0.05 Tween-20) ilave edin. Süpernatanı alın.
    3. 100-200 μL PBS-T +% 3 BSA içinde seyreltilmiş (1: 500) anti-pH3 antikoru ilave edin ve oda sıcaklığında 2 saat boyunca sallanan ile inkübe edin (veya 4 ° C'de O / N).
    4. 2 mL PBS-T (PBS +% 0.05 Tween-20) ve santrifüj (450 xg, 5 dakika, 4 ° C) ekleyin. Süpernatanı alın.
    5. Pelet içine 2 mL PBS-T ekleyerek bir kez daha yıkayın, santrifüjleyin ve süpernatantı atın.
    6. 100-200 μL PBS-T +% 3 BSA içerisinde seyreltilmiş (1: 500) ikincil antikor (seçilen pH3 antikoru için anti-tavşan AlexaFluor 488) ilave edin ve oda sıcaklığında 1 saat süreyle sallanan kuluçkaya yatırın 4 ° C'de). Örnekleri ışığa karşı koruyun.
    7. Adım 1.5.4'te tarif edildiği gibi santrifüjleme ile iki kez PBS-T (2 mL) ile yıkayın.
    8. Tarif edilen şekilde PI boyanmasını yapın (basamaklar 1.4.1 ila 1.4.6).

2. Gen Ekspresyon Analizi için Örnek Toplama ve İşleme

  1. almak1.5 mL'lik mikrosantrifüj numunelerini, RNA izolasyon reaktifini dondurucudan çıkarın ve kimyasallar için bir emniyet dolabı içerisinde oda sıcaklığında çözdürün.
  2. Her bir numuneye 400 μL kloroform ekleyin ve karıştırma tamamlanıncaya kadar kuvvetli bir şekilde sallayın (ancak vorteks kullanmayın). Numuneleri oda sıcaklığında 5 dakika inkübe edin.
  3. Tezgah üstü bir mikrosantrifüjde 15 dakika tüpleri (≥8,000 xg, 4 ° C) santrifüjleyin.
  4. Sulu (üst) fazı yeni bir 1.5 mL'lik mikrosantrifüj tüpüne aktarın ve aktarılan hacmi kaydedin (prosedürü basitleştirmek için deneyin tüm numunelerinde eşit hacimlerin toplanması önerilir).
  5. Karıştırırken yavaş yavaş sulu faza (damla damla) 1 hacim% 100 etanol ilave edin. Santrifüj etmeyin.
  6. Ticari RNA mini hazırlık seti ile bir sonraki adımları gerçekleştirin. Oluşmuş olabilecek herhangi bir çökelti de dahil olmak üzere, her numuneden 700 μL'ye kadar bir pik ekleyin (üretici tarafından sağlanan) 2 mL'lik bir toplama tüpünde bir döner kolona yerleştirilir.
  7. KapatKapak ve santrifüj (≥ 8,000 g, RT) 15 s. Akışı atın. Kalan numuneyle (varsa) önceki adımları tekrarlayın.
  8. RNA yıkama ve elüsyon için üreticilerin talimatlarını uygulayın (bir sonraki adım için uygun bir RNA konsantrasyonu elde etmek için her bir örneği 30 - 40 μl nükleaz içermeyen H20 ile elüe edin).
  9. Absorpsiyon ölçümleri ile örneklerin RNA konsantrasyonunu ve saflığını belirleyin ( 2.0-2.1 A 260/280 oranı, RNA örneğinin iyi saflığını gösterir). RT-qPCR analizi için kullanılacak kadar RNA örnekleri -80 ° C'de saklayın.
  10. RNA'ya cDNA'ya dönüştürmek ve ardından niceliksel PCR için örnek başına 1 μg RNA alın ve imalatçıların talimatlarına göre retrotranscriptase reaksiyonu hazırlayın. Elde edilen cDNA örnekleri 4 ° C'de (birkaç gün için) veya -20 ° C'de (daha uzun süreyle) saklanabilir.
    NOT: Örnek hazırlama, primer tasarımı ve gerçek zamanlı PCR için diğer hususlar eski olmuşturLiteratürde yoğun bir şekilde anlatılmıştır 22,23.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hücre senkronizasyonu için Thy-Noc ve HU tabanlı protokollerin şematik gösterimi.

Şekil 1 , hücre döngüsü boyunca ilerlemeyi doğrulamak ve gen ekspresyon analizleri gerçekleştirmek için U2OS hücre senkronizasyonu ve takip eden örnek toplanması için gerekli olan aşamaları özetlemektedir.

Phospho-H3 ve PI boyama, senkronizasyon yöntemlerini seçmek için iyi bir değerlendirme parametreleridir.

Kültür hücrelerinin doğal heterojenliği nedeniyle hücre senkronizasyon prosedürleri her hücre hattı için değerlendirilmeli ve optimize edilmelidir. Mitozda senkronizasyon tipik olarak Thy-Noc protokolüyle sağlanır ve nokodazol ile muamele edildikten sonra mitotik hücrelerin zenginleştirilmesi, tipik bir mitotik işaretleyici olan fosforile edilmiş histon H3 (pH3) için spesifik antikorlarla değerlendirilebilir. ide PH3 pozitif hücrelerin ntifikasyonu, mitotik hücreler ile mitoz geçirmeyen 4C-DNA içeriği (hepsi PI boyaması ile "G2" popülasyonu olarak düşünülür) arasında ayrım yapılmasına izin verir. U2OS hücrelerinde Thy-Noc protokolü, 4C DNA içeriğine sahip bir nüfusun önemli bir zenginleşmesine yol açar (Şekil 2A, üst sol grafik, PI boyaması ile mavi popülasyon) ve bu popülasyon içindeki mitotik hücrelerin görece fraksiyonu rutin olarak oldukça saftır (yaklaşık olarak % 91, asenkron hücrelerde% 2'ye kıyasla). Nocodazole'den salınım, 2C DNA içeriğine sahip bir popülasyonun birikimiyle belirlendiği gibi ( Şekil 2A , sağ üst grafik, PI boyaması ile yeşil popülasyon) ve pH3 pozitif mitotik maddenin neredeyse kaybolmasıyla senkronize bir şekilde sonraki G1 fazına ilerleme ile sonuçlanır Hücreler ( Şekil 2A , sağ alt grafik). Böylece, pH3 boyama sonuçları, U2OS hücrelerinin mitotik senkronizasyonu için Thy-Noc protokolünün uygunluğunu doğrulamıştır.

G1 / S'deki U2OS hücrelerinin senkronizasyonu, yaygın olarak kullanılan iki senkronizör olan timidin ve hidroksiüre ile test edildi.Hücre döngüsü farklı evrelerde zenginleştirme PI boyama ile belirlendi ve FACS analizi ve bir tabloda özetlenen hücre yüzdesi ( Şekil 2B ) U2OS hücrelerinin Thy'ye (2mM) 24 saat maruz kalması, G1 / S sınırındaki hücrelerin durması için yetersizdi ( Şekil 2B ), buna karşılık HU veya bir çift (DT) tatmin edici bir tutuklama ile sonuçlandı.Ancak, sadece HU ile tedavi edilen hücreler tutuklamadan tamamen kurtarıldı ve hücre döngüsü boyunca yeterince ilerledi.Deneyle DT bloğu, hücre popülasyonunun önemli bir bölümünde kalıcı bir G1 tutuklamaya neden oldu ( 6 saatlik zaman noktasında G1 hücrelerinde% 13.3, DT ile % 3.1; HU tabanlı protokol ile% 3.1) hücre senkronizasyonunu olumsuz yönde etkilediğinden uygun G1 / S senkronizasyon metodu olarak HU'ya maruz kalma önerilirOd U2OS hücreleri için.

Thy-Noc ve HU tabanlı protokoller hücre senkronizasyonu için tamamlayıcıdır.

Şekil 3A'da gösterildiği gibi (0 saat zaman noktası), Thy-Noc protokolü ile muamele, M faz girişinde (4C DNA içeriği olan, mavi ile gösterilen popülasyonda) U2OS hücrelerini etkin bir şekilde tutukladı ve HU protokolü ile tutulan hücreler, G1 / S sınırında tutuklanmış hücreler tarafından (Yeşil / kırmızı gösterilen, 2C DNA içeriğine sahip nüfus). İlaçların giderilmesiyle, hücreler senkronize şekilde hücre döngüsüne girdi ve ilerledi. Thy-Noc muamelesinden toplanan hücreler, ilk başta G1 evresinde (yeşil popülasyonda) gözlemlenir ve daha sonra G1 boyunca ve S evresine kadar düzgün bir biçimde modifiye edilir. HU tedavisinden toplanan hücreler, S (kırmızı popülasyon) ve G2 / M vasıtasıyla eşzamanlı olarak ilerledi. Sonraki hücre döngüsü boyunca ilerleme eşzamanlılık kaybına eşlik ediyordu. ConsequentlY, bu zaman noktasından sonra eşzamanlılık kaybından dolayı 15 saatin üzerindeki zaman noktaları bu analizlere dahil edilmedi.

Hücre döngüsünde seviyeleri sıkı bir şekilde regüle edilen iki protein olan Cyclin E1 (bir G1 / S siklin) ve Siklin B1'in (bir G2 / M siklin), ve mitotik işaretleyici pH3'ün Western blot analizi, her birinin hücre döngüsü fazını teyit etti Zaman noktası FACS ile analiz edildi ( Şekil 3B ). Beklendiği gibi, M fazındaki hücreler (Thy-Noc senkronize hücrelerin 0 saat zaman noktasına karşılık gelir) ve G2'den M fazına hücreler (HU-senkronize edilmiş hücrelerin 9 saat ila 12 saatlik zaman noktası), siklin B1'in dramatik bir birikimini gösterdi Ve siklin E1'in saptanamayan düzeyleri. Ayrıca, Siklin B1 seviyeleri, G1 fazında (nokodazolden 3 saat sonra) tespit edilemeyecek kadar düşük bulunmuştur ve hücreler S (Thy-Noc serbest bırakıldıktan sonra) ve G2'ye (HU bırakıldıktan sonra) ilerledikçe yavaş yavaş birikim gözlemlenmiştir. Thy-Noc eşzamanlamasında 0 saat boyunca hücrelerin güçlü pH3 etiketlenmesiBu noktada mitozda tutulan hücrelerin zenginleştirilmesini doğruladı. HU'dan serbest bırakıldıktan sonra 12 saatte pH3 düzeylerinde hafif artış, 4C DNA içeriğine sahip hücrelerin büyük kısmının halen G2'de olduğunu, ancak mitozdaki hücrelerin oranı 15 saatlik zaman noktasında arttığını ortaya koymuştur. Buna karşılık, Siklin E1'in ifade örüntüsü, erken G1'den S fazına girişe (Thy-Noc prosedürü) ve G2 / M fazında kademeli olarak ortadan kaybolmaya (HU prosedürü) ilerleyici bir birikim göstermiştir.

Hücre döngüsünde farklı şekilde düzenlenen genlerin ifadesi, Thy-Noc ve HU bazlı senkronizasyon kombinasyonu ile doğru analiz edilebilir.

Hücre döngüsü düzenleyici gen ekspresyon analizinin, iki hücre senkronizasyon yönteminin bir kombinasyonu tarafından en iyi şekilde denendiği bir kavramın kanıtı olarak, hücre döngüsünde farklı ifade kinetiklerine sahip olduğu bilinen iki E2F ailesinin mRNA ekspresyonu(E2F1 ve E2F7), ters transkriptaz kantitatif PCR (RT-qPCR) ile incelendi. Bu amaçla, Şekil 1'de özetlendiği gibi Thy-Noc ve HU senkronizasyon protokolleri kullanıldı ve hücre döngüsü dağılımı, Şekil 3A'da gösterildiği gibi akış sitometrisi ile izlendi. Şekil 4 , hücre döngüsü boyunca E2F1 (üst iki grafikler) ve E2F7 (alttaki iki grafikler) mRNA profillerini göstermektedir. E2F1 kodlayan genin transkripsiyonel regülasyon profili, Thy-Noc prosedürüyle en iyi gözlendi; burada E2F1 ekspresyonu, geç G1 evresinde (Thy-Noc serbest bırakıldıktan sonra 9 saat sonra yeşil arka plan) bir tepeye ulaşmak için erken G1 evresinden kademeli olarak artmaya başladı. Bundan sonra, S ve G2 safhalarına girişi ile birlikte (kırmızı ve mavi arka planlar), seviyeleri azaldı. Aksine, E2F7 geni ifade kinetiği serbest bırakıldıktan 6 saat sonra zirve ifadesi ile (S'den G2'ye geçiş aşamasına karşılık gelen) HU'ya dayalı senkronizasyondan sonra en iyi tespit edildi (alt grafik; kırmızı arka plan). Thy-NocProsedür, diğer taraftan, E2F7'nin indüksiyonunu izlemek için uygun, ancak aşağı düzenlenmesinde uygun değildi. Not, analizin 15 saatlik zaman noktasının ötesine uzatılması, azaltılmış mRNA varyasyonu aralığında olmasına rağmen, erken zaman noktalarının E2F1 ve E2F7 mRNA ekspresyon profillerini çoğaltır (veriler gösterilmemiştir). Sonuç olarak, bu sonuçlar, yalnızca gen ekspresyon kinetiklerini değil, aynı zamanda mRNA düzeylerindeki doğru genlik değişimini değerlendirmek için düzgün senkronize edilmiş bir hücre popülasyonu ile çalışmanın önemini teyit eder.

Hücre senkronizasyonu, antikanser terapisinden etkilenen gen ekspresyon programının daha iyi anlaşılmasını sağlar.

Hücre döngüsü dinamikleri ve gen ifadesinde antitümör ilaç mitomisin C (MMC) etkisini analiz etmek için, U2OS hücreleri önce HU ile senkronize edildi ve daha sonra MMC ile tedavi edildi. Bu genotoksik ajana maruz kalma, bir kontrol çağrısı başlattı.T, G2 fazında 15 saat maruz kaldıktan sonra belirgindi ( Şekil 5A , alt sıra, mavi tepe). Buna karşılık, işlenmemiş hücreler normalde bu zaman noktasında G1 boyunca ilerledi ( Şekil 5A , üst sıra, yeşil pik). Uzun süreli MMC tedavisi (36 saat), G2 fazında kalıcı bir hücre tutuklamasına neden olurken, MMC tedavisi olmayan hücreler, asenkron hücre popülasyonu tarafından gösterilen hücre döngüsü dağılımı ile benzerdi.

E2F1 ve p21 Cip1 (CDKN1A), farklı hücre döngüsüne bağlı düzenlemeye göre MMC ile işlem gören hücrelerde ( Şekil 5B ) gen ekspresyon analizi için seçildi. E2F1'in ekspresyonu, Şekil 4'te tarif edildiği gibi G1'e faz bağımlıdır; oysa p21 Cip1 ekspresyonunun indüksiyonu, hücre döngüsü durdurma / kontrol noktası aktivasyonuna 24 bağlanır. Şekil 5B'de (sol üst grafik) gösterildiği gibi, E2F1 gen ifadesi kiHücreler G1 / S ve S fazına doğru ilerledikçe MMC varlığında veya yokluğunda benzerdi. MMC ile işleme tabi tutulmuş hücrelerin 15 saat boyunca maruz bırakıldıktan sonra, MMC ile muamele edilen hücrelerin kontrol hücrelerine kıyasla daha düşük E2F1 mRNA düzeyleri eksprese ettikleri ( Şekil 5B , kesikli ve kesikli çizgileri karşılaştırmak), MMC ile muamele edilmiş ve edilmemiş hücreler arasında E2F1 gen ekspresyonundaki farklılıklar gözlendi. Bununla birlikte, ifadedeki belirgin farklılığa rağmen, MMC'nin E2F1 ekspresyonunu indirgediği sonucuna varamazsınız, çünkü MMC ile işlenmiş ve tedavi edilmemiş hücrelerin hücre döngüsü profilleri, MMC'nin uyguladığı sürekli bir G2 fazı tutuklaması nedeniyle bu sonraki zaman noktalarında açıkça farklıdır. Aslında, MMC'ye maruz kalmış hücrelerdeki 15 saatlik zaman noktasından sonra düşük E2F1 mRNA seviyeleri, E2F1 transkripsiyonel regülasyonunda MMC'nin bir etkisinden ziyade ilacın hücre döngüsü dinamiklerindeki bir etkisini muhtemelen yansıtmaktadır.

E2F1'in aksine, p21 Cip1, bir MMC-yanıt genidir. Yüksek p seviyeleri21 Cip1, HU tarafından empoze edilen G1 / S arrest'te tespit edildi ve bu, HU ( Şekil 5B , 0 saat zaman noktası) ile G1 kontrol noktası aktivasyonunu gösterdi ve bundan sonra, MMC ile işlem görmeyen hücrelerde ekspresyonu azaldı ve bu hücrenin serbest bırakılmasından sonra süpervizyonsuz bir hücre döngüsü ilerlemesi ile tutarlı bir şekilde azaldığı bulundu. tutuklamak. Buna karşılık, MMC tedavisi, hücreler G2 fazında (MMC maruziyetinden 9 saat sonra) biriktikçe, p21 Cip1 mRNA seviyelerinin yükselmesine neden olmuştur ( Şekil 5B , sağ üst grafik, düz çizgi). Kontrol ve MMC ile tedavi edilen hücrelerde hücre döngüsü profillerinin 9 saatlik zaman noktasında benzer olmasına rağmen, gen ekspresyon analizi temel bir farklılık göstermektedir. MMC'ye maruz bırakılan hücreler, aktive edilmiş bir G2 kontrol noktasını gösterdiler; bu, p21 Cip1 ekspresyonunun indüklenmesi ile kanıtlandı; oysa, işlemden geçirilmemiş hücreler, düşük p21 Cip1 seviyeleri ile, G2 yoluyla bir pertürbasyonsuz geçiş yaşıyordu.

Akış sitometrisi analizi ile elde edilen veriler ( FiGure 5A) ve RT-qPCR'den ( Şekil 5B , üst grafikler) kaynaklanan veriler, seçilen her bir gen için tek bir grafikte birleştirildi ( Şekil 4B , alt grafikler). MRNA ekspresyon seviyeleri, her bir numune için hücrelerin hücre döngüsü dağılımı, renklerin oranı ile gösterilmiştir: G1 fazı için yeşil (2C DNA içeriği), G2 fazı için mavi (4C DNA içeriği) ve kırmızı S fazı için (ara DNA içeriği). Bu grafiksel gösterim yöntemi, hücre döngüsü dağılımı ve gen ekspresyon analizlerini yorumlamak için yardımcı olabilir.

Özetle, bir kültür senkronizasyon yöntemiyle birleştirilmiş gen ekspresyonu analizi, bir genotoksik ajan-tepki veren genin (p21 Cip1) tanımlanmasına izin vermiş ve bu ajan ile muamele edilmiş ve edilmemiş hücreler arasında E2F1 ekspresyonunda gözlemlenen değişikliklerin dolaylı olduğunu öne sürmüştür veMuhtemelen hücrelerin hücre döngüsü dağılımındaki farklılıklarla ilgilidir.

Şekil 1
Şekil 1: İki Tamamlayıcı Hücre Senkronizasyon Protokolüne Genel Bakış: Timidin-Nokodazol ve Hidroksiüre. ( A ) Hücre siklüsünün durduğu noktaları belirten memeli hücre döngüsünün grafiksel gösterimi, hücre senkronizasyon yöntemleri ile gerçekleştirilir. Thy-Noc tabanlı prosedür erken mitozda hücreleri bloke ederken (M), HU blok G1 / S hücrelerini bloke eder. ( B ) Thy-Noc hücre senkronizasyon protokolünün şematik gösterimi. Gösterilen U2OS hücrelerinde gen ekspresyon analizi ve hücre döngüsü izleme için tipik olarak kullanılan adımlardır. ( C ) Hücresel senkronizasyonun HÜ tabanlı protokolünün şematik gösterimi. U'da gen ekspresyon analizi ve hücre döngüsü izlemesi için tipik olarak kullanılan adımlar gösterilmiştir2OS hücreleri. Serum açlığı atlayan daha kısa bir senkronizasyon prosedürü, optimal senkronizasyon HU'ya 24 saat maruz kalma durumunda zaten elde edilmişse de uygulanabilir. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

şekil 2
Şekil 2: Uygun Senkronizasyon Yöntemlerinin Değerlendirilmesi. ( A ) Asenkron ve Thy-Noc eşzamanlı U2OS hücre kültürleri, her durumda mitotik hücrelerin fraksiyonunu değerlendirmek için pH3 boyamaya tabi tutuldu. Eşzamanlı PI boyaması, hücrelerin DNA içeriğini izlemeye izin verdi. Eşzamansız popülasyonda, 4C DNA içeriğine (mavi) sahip olan hücrelerin yalnızca minimal bir kısmı mitoz markörü için pozitifti. Buna karşılık, Thy-Noc protokolü verimli bir şekilde hesaplar(PH3 boyama için pozitif) ve nokodazol çıkarıldıktan sonra (yeşil renkte) bir sonraki G1 fazına doğru ilerlemesine izin verildi (3 saat zaman noktası). Her fazdaki hücrelerin yüzdesi tabloda özetlenmekte ve PI histogramlarında kullanılanlara göre renklerle etiketlenmektedir: 2C DNA içerik hücreleri (G1) için yeşil, 4C DNA içeriğine sahip hücreler için mavi (G2 ve M hücreleri dahil ve G2 ve ara DNA içeriği (S) olan hücreler için kırmızı olarak gösterildi. ( B ) Thymidine ve HU, U2OS hücrelerinde hücre döngüsü senkronizasyon verimliliği açısından değerlendirildi. Hücreler, timidinle (bir veya iki Yuvarlak) veya HU ile 24 saat süreyle hücre senkronizasyonu PI boyama ve FACS analizi ile incelendi .FAKS veri analizi için Zirve kullanıldı , bu rakamın daha büyük sürümünü görmek için lütfen buraya tıklayınız .

Şekil 3
Şekil 3: Thy-Noc ve HU aracılıklı Senkronizasyon Sonrası Hücrelerin Düzgün İlerlemesi için Geçici Çerçevenin Anahatları. ( A ) U2OS hücreleri, M-fazında Thy-Noc protokolüyle (üst sıra) veya H1 protokolü ile G1 / S geçişinde (alt sıra) senkronize edildi. Hücre döngüsü ilerlemesi, kimyasallardan salınmadan her 3 saat sonra hücrelerin DNA içeriğinin PI boyaması ve FACS analizi ile izlendi. Zirve FACS veri analizi için kullanılmıştır. Thy-Noc aracılıklı tutuklamadan salınan hücreler 3 saat sonra erken G1 safhasında eşzamanlı olarak girdi ve sonraki zaman noktalarında homojen bir şekilde S fazına ilerledi. HU aracılıklı tutuklamadan salınan hücreler, S ve G2 fazları boyunca eşzamanlı olarak değişti. Serbest bırakıldıktan 15 saat sonra toplanan hücreler hücre senkronizasyonu için sınırları temsil ettiler, çünkü sonraki aşamaya doğru ilerleme sadece başarıldıD artırabilir. ( B ) Hücre senkronizasyonu, her 3 saatte bir ve serbest bırakıldıktan sonra 15 saate kadar protein örnekleri toplayarak Western blot analizi ile izlendi. Genellikle S fazı yoluyla biriktirilen Siklin E1'in (CCNE1), esas olarak G2'den M fazına ve siklik B1'den (CCNB1), mitotik hücreler için bir markör olan ifade 3'te ifade edilen kinetik, akış sitometrisi ile gözlemlenen hücre döngüsü dağılım profillerini doğrulamıştır. Aktin B (ACTB), seviyeleri hücre döngüsüne bağımlı olmadığı için bir endojen yükleme kontrolü olarak kullanılmıştır. (Mitxelena ve diğerleri 8'den modifiye edildiği gibi). Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Şekil 4
Şekil 4: Hücre döngüsü Faz bağımlılığı çalışması Tamamlayıcı Hücre Senkronizasyon Yöntemleri ile E2F ailesindeki Üyelerin Transkripsiyonu. U2OS hücreleri, Thy-Noc protokolü ile G2 / M'de veya HU tedavisi ile G1 / S'de tutuklanmış ve tutuklamadan kurtulmaları üzerine her 3 saatten 15 saate kadar RNA ekstraksiyonu ve FACS analizi için örnekler toplanmıştır. RT-qPCR ile gen ekspresyonu analizi, E2F7 geni ifade profili G2 evresi boyunca kademeli bir downregülasyonla (sağ alt grafiğe) geçirilirken esas olarak G1'e (üst sol grafik) sınırlanan bir E2F1 ekspresyon profili ortaya çıkardı. TBP, mRNA düzeylerindeki nispi değişiklikleri hesaplamak için endojen olmayan hücre döngüsü regüle geni olarak kullanıldı ve sonuçlar, ortalama değerler ve standart sapma (SD) olarak gösterildi. Hücre döngüsü boyunca ilerleme PI boyama ve hücrelerin DNA içeriğinin FACS analizi ile belirlendi. Siyah (erken mitozda tutuklama), yeşil (G1 faz), kırmızı (S fazı) ve mavi (G2 fazı) grafiklerdeki hücre döngüsü fazları arka plan renkleri olarak gösterildi..com / files / ftp_upload / 55745 / 55745fig4large.jpg "target =" _ blank "> Bu şekli daha geniş bir sürümünü görmek için lütfen buraya tıklayınız .

Şekil 5
Şekil 5: MMC'nin Gen Ekspresyonu ve Hücre Döngüsü Progresyonu Üzerindeki Etkisi. U2OS hücreleri 24 saat süreyle HU ile muamele edildi ve HU aracılıklı G1 / S tutuklamadan salınmadan hemen sonra MMC (250 nM) ilave edildi. FACS analizi ve gen ekspresyon analizi için örnekler, belirtilen zaman noktalarında toplandı. ( A ) Hücre döngüsü boyunca ilerleme, Sumit yazılımıyla DNA içeriğinin PI boyaması ve FACS analizi ile belirlendi. MMC, S fazı boyunca (kırmızı popülasyon) progresyonda orta dereceli bir gecikmeye ve 15 saatlik tedaviden sonra (alttaki sıra) G1'deki hücrelerin bulunmadığı (yeşil popülasyon) gösterildiği gibi G2 evresinde (mavi popülasyonda kalıcı bir tutuklama) endüklendi Non-(Üst sıra) hücreler. ( B ) E2F1 ve p21 MMC ile muamele edilmiş veya muamele edilmemiş hücrelerdeki Cip1 geni ekspresyon analizi, RT-qPCR ile mRNA seviyesinde gerçekleştirildi. Oxa1L, MMC'ye cevap vermeyen bir endojen gen olarak kullanıldı ve sonuçlar ortalama değerler ve SD olarak gösterildi. Üstteki grafikler, HU'dan serbest bırakıldıktan ve MMC'nin eklenmesinden sonra seçilen genlerin göreli mRNA düzeylerini temsil etmektedir. Daha düşük grafikler, FACS analizi ve RT-qPCR ile elde edilen verileri birleştirir. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hücre döngüsünde geçici ve spesifik rollerde bulunan ince ayarlı regüle genlerin analizi, hücre popülasyonunun düzgünlüğünü gerektirir. Birçok araştırmacı, bu amaçlar için uzun süredir kurulmuş tümör hücresi çizgileri rutin olarak kullanmaktadır ve belirli hücre döngüsü evrelerinde mümkün olduğunca çok hücre biriktirmek amacıyla senkron (veya kısmen senkron) hücre popülasyonları elde etmek için çeşitli yöntemler geliştirilmiştir. Dahası, iyi kurulmuş senkronizasyon yaklaşımlarını iyileştirmek ve optimize etmek için çok çaba sarf edilmiştir. Bununla birlikte, tüm senkronizasyon protokolleri, hücre kültürlerinin heterojenliğinden, senkronizasyon proseslerinin optimal olmayan verimliliğinden veya kimyasal senkronizatörlerin hücre fonksiyonlarında olduğu ikincil etkilerden kaynaklanabilecek dezavantajlara sahiptir. Hücre senkronizasyon protokollerini uygularken bu sınırlamalar dikkate alınmalıdır. Araştırmacılar, spesifikasyonları için en uygun senkronizasyon yöntemlerini belirlemelidirİC hücre tipi veya deney. Hatta farklı hücre hatlarını aynı şekilde üretmek, sonuçta ortaya çıkan senkronizasyon oranları çeşitli nedenlerden dolayı farklılık gösterebilir. Bir yandan hücre döngüsünün uzunluğu seçilen hücre çizgisine bağlı olarak değişebilir; Öte yandan, aynı inhibitör, her bir hücre hattının 25 belirli özelliklerinden dolayı farklı hücre hatları üzerinde zıt etkiler gösterebilir. Ayrıca, arzu edilmeyen yan toksisiteyi önlemek veya en aza indirgemek için seçilen inhibitör konsantrasyonu ve maruz kalma süresi her hücre çizgisine ayarlanmalıdır 26 . Tüm bu özelliklerin optimizasyonundan sonra bile belirli bir hücre döngüsü fazında% 100 hücre birikimi elde edilemez ve kimyasal çıkarıldıktan sonra asenkronizasyon yavaşça artar. Bu nedenle, senkronizasyon yöntemlerinin belirli bir zaman diliminde en iyi kısmi hücre popülasyon zenginleştirmelerini elde ettiğini anlamak önemlidir.

Bu w'de Ork iki senkronizasyon prosedürü (Thy-Noc ve HU), her ikisi de hücre senkronizasyonu tahlilleri 28 , 29 , 30 için yaygın olarak kullanılan U2OS hücrelerinde kullanımları için optimize edilmiştir. Hücreleri M fazında tutmak için, timidin ve nokodazolün bir kombinasyonu U2OS hücrelerinde etkili bir şekilde çalıştı. Nokodazolün sitotoksik doğası göz önünde bulundurulduğunda, bu sınıra senkronize edilmiş bir hücre popülasyonunun değil optimum hücre canlılığının elde edilmesi için bu inhibitörün maruz kalma süresi ve dozunun belirlenmesi de önemlidir. Timidin'e (veya teorik olarak hidroksiüre gibi başka benzer bileşiklere) maruz kalma, hücre popülasyonunun G1 ve S fazlarında zenginleştirilmesine ve dolayısıyla gerekli nokodazol maruziyet süresinin azalmasına neden olmuştur. G1 / S hücrelerini tutuklamak için birçok hücre çizgisinin senkronizasyonunda çok etkili olan bir yöntem olan çift timidin bloğu da dahil olmak üzere çeşitli olasılıklar düşünüldü."> 31 , 32. Bununla birlikte, timidin, U2OS'da hayal kırıklığı yaratan sonuçlarla atıldı. Timidin tedavisinin bir turu sadece bir kısım hücre tutukladı, oysa iki kez timidin tedavisi, G1 / S'deki hücrelerin çoğunu etkili bir şekilde bloke etti, ancak bir G1 Timidin salımından sonra nüfus korunmuş ve hücre döngüsü ilerlemesi düzgün şekilde ilerlememiştir Buna karşın, hidroksiüre uygulaması, iyi G1 / S blokaj sonuçları ve hücrelerin S ve G2 arasında düzgün ilerlemesi sağlıyordu.

Hücre döngüsü faz dağılımı, hücre senkronizasyonu deneylerini gerçekleştirirken ( örn. , Propidyum iyodür boyaması veya bunu izleyen FACS analizi veya ardından hücre döngüsü fazına spesifik proteinlerin immünoblotlanması ile) 16 , 33 , 34 gen ekspresyonunu daha iyi yorumlamak için incelenmelidir Sonuçlar. Yanlış senkronizasyon etkinliğiHücre döngüsü boyunca progresyonda ncy veya hafif deneyler arası farklılıklar yanlış sonuçlara neden olabilir. Örneğin, nokodazol tedavisinin belirli koşullar altında mitotik kontrol noktası işlevinin başarısızlığa neden olduğu bilinmektedir. Bu, 4C DNA içeriğine sahip, ancak mitotik bölünmeyi "kaydıran" ve mitoksik belirteçler 34 için negatif bir hücre popülasyonuna neden olur ve bu, 4C içeriği 35 ile fazlar arası döner. Anti-fosfo-H3 antikorları ile immün boyama ile tespit edilebilen bu hücre alt kümesinin ortaya çıkması (bakınız Şekil 2A ) nocodazole yıkama adımları için soğuk PBS kullanılarak minimize edilebilir. Hücrenin eşzamanlılığını etkileyen kimyasal inhibitörlerin kullanımı ile bağlantılı bir diğer etki de, bu bileşiklerin 36 , 37'ye maruz kalma ile bağlantılı kontrol noktası aktivasyonudur; bu mekanizma, hücrenin hücre döngüsü boyunca aktif olarak ilerlemesini tuttuğu bir mekanizma olabilirBu hassas noktadan önceki süreçlerin (örneğin, doğru DNA replikasyonu, mil düzeneği) çözümlenmesini sağlayın 38 . Senkronizasyon yönteminin yeterli olması için, tutuklama sadece verimli değil, aynı zamanda tamamen tersine çevrilebilir olmalıdır. Bu nedenle, hücre döngüsü inhibitörlerinin salgılanmasından sonra, örneğin p21 CIP gibi kontrol noktası belirteçlerinin ekspresyonunu analiz ederek, inhibitörün etkilerinin geri döndürülerek çözülüp çözülmediğini analiz etmek önemlidir. Şekil 5B , hidroksiüre senkronize U2OS hücrelerinin, kontrol noktasını etkin bir şekilde çözdüğünü göstermektedir, çünkü p21 CIP seviyeleri serbest bırakıldıktan sonra bazal ekspresyona düşürülmüştür.

U2OS hücrelerinde, hücre döngüsünün durması üzerine zenginleşme yüzdeleri hücre senkronizasyonu 29,30,39'daki diğer çalışmalar tarafından bildirilen aralıkta kalmaktadır: 4C DNA içeriğine sahip hücrelerin yaklaşık% 85'i (PI boyaması) ve yaklaşık olarakTimidin-nokodazol tedavisi üzerine mitozdaki (pH3 pozitif etiketlemede)% 90 ve hidroksiüre tedavisinden sonra G1 / S hücrelerinin yaklaşık% 80-90'ı. Hücre döngüsünün durdurulmasından salınım, tipik olarak, bir kaç saat sonra senkronizasyonun sürekli olarak kaybolmasına ve hücrelerin tümüyle bir hücre bölme döngüsünü senkronize şekilde tamamlayamamasına rağmen, tipik olarak bir veya iki faz boyunca düzgün ilerlemeyi düzgün bir şekilde ilerletir. Bu nedenle, hücre döngüsünün tüm aşamalarının tam bir resmini elde etmek için, bu çalışmada önerilen protokol, hücre döngüsünün farklı bölümlerinden gelen iki senkronizasyon yöntemini kullanır. Şekil 3A'da gösterildiği gibi, her bir protokol, tüm bir hücre döngüsü boyunca eşzamanlılığı sağlamadı. Thy-Noc tabanlı senkronizasyon, G1 - S evrelerinde oluşan süreçler için uygun bir çerçeve oluştururken, HU'dan salınan hücreler S ve G2 / M sırasında gerçekleşen olayların analizi için uygundu. Seçilen iki usulün tamamlayıcılıklarıE2F transkripsiyon faktör ailesinin iki üyesinin analizi ile gösterildi ( Şekil 4 ), hücre döngüsünün farklı evrelerinde senkronize olan iki yöntemin kombinasyonunun, hücre döngüsü düzenleyen gen ifadesinin doğru bir şekilde oluşturulması için güçlü bir yaklaşım olduğunu destekledi Ve onların fizyolojik rolünü daha iyi anlamak için.

Hücre senkronizasyon prosedürlerinin zorlayıcı bir uygulaması potansiyel terapötik ajanların etkisini değerlendirmeye odaklanmaktadır. Antitümör etkinlik gösteren ilaçlar gibi farmasötik bileşimlerin etkisi genellikle asenkron hücre popülasyonlarında incelenir. Bu ayarlar altında, seçilen ilacın, hücre ölümü, hücre döngüsü durdurma ya da yaşlanma 7 , 40 gibi çeşitli işlemlerin başlatılmasında etkisinin belirlenmesi mümkündür. Bununla birlikte, hassas moleküler olayların düzenlenmesi için asenkron hücre ayarlarının seçimi,Bu tür işlemler eksik veya kısmen yanlış sonuçlar doğurabilir. Genellikle göz ardı edilen bu nokta, E2F1 ve p21 Cip1 gen ekspresyonu üzerinde MMC'nin kemoterapötik ilacının etkisini analiz ederek bu çalışmada gösterilmiştir ( Şekil 5 ). Genel olarak, hücre senkronizasyonu ve genotoksik ajanlar ile işleme kombinasyonu, genotoksik ajana yanıt veren genlerin ekspresyonunu incelemek ve ajan tarafından dayatılan hücre döngüsü bozulmalarından etkilenenlerden ayrım yapmak için uygun bir bağlam sağlar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgments

Yararlı tartışmalar ve teknik destek için Zubiaga ve Altmeyer laboratuvarlarının üyelerine teşekkür ediyoruz. Bu çalışma, İspanyol Bakanlığından (SAF2015-67562-R, MINECO / FEDER, UE), Bask Hükümeti'nden (IT634-13 ve KK-2015/89) ve Bask Ülkesi UPV / EHU Üniversitesinden hibelerle desteklendi UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
Hücre Çevrimiyle Düzenlenen Gen İfadesini İki Tamamlayıcı Hücre Senkronizasyon Protokolü İle Çalışmak
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter