Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Un protocole universel pour à grande échelle gRNA bibliothèque Production provenant de toute Source d’ADN

doi: 10.3791/56264 Published: December 6, 2017

Summary

Méthodes pour générer des bibliothèques gRNA à grande échelle devraient être simple, efficace et rentable. Les auteurs décrivent un protocole pour la production de bibliothèques gRNA issu de la digestion enzymatique de l’ADN cible. Cette méthode, CORALINA (génération de bibliothèque gRNA globale par activité nucléasique contrôlé) présente une alternative à la synthèse d’oligonucléotides personnalisée coûteux.

Abstract

La popularité du système CRISPR/Cas9 pour génome et génie de l’épigénome découle de sa simplicité et son adaptabilité. Un effecteur (la nucléase Cas9 ou une protéine de fusion dCas9 nucléase-morts) est destiné à un site spécifique dans le génome par un petit ARN synthétique appelé le guide RNA ou gRNA. Le caractère biparti du système CRISPR permet son utilisation dans le dépistage des approches depuis les bibliothèques de plasmide des cassettes d’expression contenant des milliers de gRNAs individuel peuvent être utilisés pour interroger de nombreux sites différents dans une seule expérience.

A ce jour, gRNA séquences pour la construction de bibliothèques ont été presque exclusivement générés par la synthèse d’oligonucléotides, qui limite la complexité réalisable de séquences dans la bibliothèque et est relativement coûteux. Ici, un détail le protocole pour CORALINA (génération de bibliothèque gRNA globale par activité nucléasique contrôlé), un simple et méthode rentable pour la génération de bibliothèques gRNA hautement complexe issu de la digestion enzymatique de l’entrée de l’ADN, est décrite. Étant donné que les bibliothèques CORALINA peuvent provenir de n’importe quelle source d’ADN, beaucoup d’options pour la personnalisation existent, permettant une grande variété d’écrans CRISPR-basé.

Introduction

L’adaptation du système CRISPR/Cas9 bactérienne comme un outil de ciblage moléculaire causé la révolution plus récente en biologie moléculaire. Jamais auparavant il n’a été aussi facile de manipuler la chromatine aux emplacements définis de génomiques. Applications communes de CRISPR incluent des mutations de gènes ciblés1, ingénierie du génome2, épigénome édition3, activation de la transcription et4de silençage génique. Un avantage particulier du système CRISPR est que ses applications ne se limitent pas aux sites de candidats bien étudiés, comme gRNA bibliothèques permettent moins biaisées écrans. Ces amendements facilitent la découverte des loci fonctionnelles du génome sans aucune connaissance préalable expérimentale. Cependant, construction de bibliothèque gRNA repose actuellement principalement sur la synthèse des oligo-nucléotides et il y a des options limitées pour acheter gRNA bibliothèques qui ne sont pas des humains ou régions origine ou cible de souris en dehors des cadres de lecture ouverts. Ainsi, bien que CRISPR écrans sont déjà avérées incroyablement puissants5,6,7,8, leur plein potentiel n'a pas encore été exploitée.

Pour surmonter la limitation des stratégies de deux méthodes gRNA classique de production ont récemment été mis au point. Deux sont basés sur contrôlé digestion enzymatique de l’ADN cible plutôt que de compter sur la synthèse d’oligonucléotides personnalisée. Tandis que CORALINA9 emploie une nucléase micrococcique, la méthode alternative actuellement disponible uniquement, mangeur de CRISPR10, fait appel à des enzymes de restriction (HpaII, ScrFje, BfaI et Mmej’ai). Ce qui est important, les deux techniques peuvent être appliquées à n’importe quel ADN d’entrée, qui sert de source de gRNA protospacer séquences. Alors que la méthode CRISPR-manger emploie une stratégie visant à diminuer le nombre de gRNAs clonés dont ciblant les sites ne sont pas respectées par le PAM de S.pyogenes requis (motif adjacent de protospacer), il génère seulement une petite fraction de tous les possibles gRNAs fonctionnels pour une région donnée. CORALINA, en revanche, est capable de générer tous les gRNAs potentiels pour la séquence source, mais intègre également une fraction plus élevée des guides non fonctionnel. génération de bibliothèque gRNA par activité nucléasique contrôlé permet de produire des bibliothèques gRNA complet pour toute espèce, n’importe quel système Cas9-protéine ou - effecteur de manière simple et rentable. En outre, CORALINA est adaptable à la personnalisation, choix d’entrée et vecteurs appropriés définissent le type de bibliothèque, la taille et le contenu. Ici, un protocole détaillé est présenté qui peut être utilisé pour la génération de bibliothèques complètes gRNA provenant de diverses sources de l’ADN (Figure 1), y compris les chromosomes artificiels bactériens (bac) ou l’ADN génomique9. Les résultats représentatifs qui accompagne ce protocole ont été obtenues en appliquant le protocole CORALINA à ADN.

Protocol

1. la digestion de l’ADN avec une nucléase micrococcique

  1. Effectuer une réaction d’optimisation pour chaque nouveau lot d’enzyme nucléase micrococcique (MNase).
    Remarque : Le nombre d’unités de MNase utilisés doit être testé (en utilisant une dilution en série, Figure 2 a). Habituellement, 5-10 U de MNase digérer 1 µg de purifiée génomique ou ADN vers le bas pour une gamme de 5 à 100 bp avec les conditions décrites ci-dessous.
  2. Par réaction, mis en place 1 µL de mémoire tampon MNase 10 x, 1 x albumine sérique bovine (BSA), 1 µg d’ADN, 1 µL de MNase cible (0,1 à 50 unités) dans un volume réactionnel de 10 µL.
  3. Incuber à 37 ° C pendant 15 min.
  4. Inactiver immédiatement l’enzyme en ajoutant 1 µL de 500 mM ethylene glycol-bis(β-aminoethyl ether)-N, N, N', N'-tétraacétique (EGTA).

2. séparation de l’ADN des Fragments à l’aide de l’électrophorèse sur Gel de Polyacrylamide (PAGE)

  1. Ajouter échantillon tampon/gel colorant aux échantillons d’ADN de chargement et les charger sur un 20 % gel de PAGE. Charger une échelle d’ADN appropriée pour le dimensionnement (5 bp échelle d’ADN). Ne surchargez pas le gel (1 µg ADN / puits).
  2. Exécuter les gels dans approprié 1 x TRIS-Borate-EDTA (TBE) en cours d’exécution un tampon à 150 V (constant) pour autour de 1,5 h ou jusqu'à ce que la partie inférieure avant de colorant (bromophénol couleur bleu foncé, bleu) qui se déplace à environ 15 bp, atteint l’extrémité inférieure du gel.
  3. Souillez le gel à l’aide d’une teinture ultra-sensible des acides nucléiques et visualiser sous la lumière UV.
  4. À partir de l’image de gel, déterminer la concentration optimale de MNase pour digestion ADN jusqu'à 20-30 bp en taille.
  5. Utiliser la concentration optimisée de MNase pour digérer l’ADN cible en répétant les étapes 1,2-2,2. En général, mise en place de 10-12 réactions (c'est-à-dire 10 à 12 µg de matière première au total) produira assez digéré suivant PAGE gel extraction de l’ADN pour passer aux étapes suivantes.
  6. À l’aide d’un scalpel stérile, couper le gel à côté de la voie de marqueur et tache uniquement la partie du gel contenant l’échelle avec frais 1 x TBE en cours d’exécution un tampon contenant 1 X d’une tache ultra-sensible des acides nucléiques. Visualiser l’échelle d’ADN et d’accise de fragments d’ADN digéré MNase dans la gamme de taille entre environ 18-30 ans bp à l’aide d’une lame de rasoir.
    Remarque : Évitez d’exposer les fragments MNase digéré à la lumière UV. Il est possible d’utiliser une source de lumière bleue (au lieu de UV) ou prendre une image de l’échelle sous exposition aux UV, imprimez-le pour multiplier et utilisez-le pour guider l’excision des fragments d’ADN digéré MNase). Cette étape permet d’éviter la coloration et l’exposition de fragments d’ADN à la lumière UV. Toujours utiliser un scalpel jetable inutilisé et stérile ou la lame de rasoir pour cette étape pour éviter la contamination.
  7. Transférer la tranche de gel dans un tube de microcentrifuge.
  8. Colorer le reste du gel avec tache acide nucléique comme ci-dessus, exposer à la lumière UV et d’enregistrer une image afin de conserver un enregistrement de l’étape de l’excision de gel.

3. séparation des Fragments d’ADN de PAGE-gels à l’aide de l’écrasement et la méthode de trempage

Remarque : Cette étape a été adoptée de Sambrook et al. 11

  1. Préparer PAGE tampon de solubilisation de gel (1,88 mL d’acétate d’ammonium 4 M, 150 µL d’acétate de magnésium 1 M, 30 µL de 0,5 M l’acide éthylènediaminetétraacétique (EDTA) (pH 8) à ultrapure H2O pour un volume total de 15 mL).
  2. Écraser la tranche excisés gel contre le mur du tube à l’aide d’un embout de la pipette stérile micro-centrifuge.
  3. Ajouter les 2 volumes de mémoire tampon de la PAGE la solubilisation de gel et incuber à 37 ° C pendant 16 h sur une plate-forme tournante.
  4. Centrifuger les échantillons pendant 1 min à vitesse maximale dans une micro-centrifugeuse. Transférer le surnageant dans un nouveau tube de microcentrifuge, prenant soin de ne pas pour transférer des morceaux de gel concassée.
  5. Ajouter 0,5 volumes de tampon de solubilisation de PAGE au gel-pellet, vortex et répétez la centrifugation (étape 3.4). Combiner les surnageants.
  6. Extraire les fragments d’ADN à l’aide d’extraction standard phénol-chloroforme.
    ATTENTION : Le phénol est toxique si elle entre en contact avec la peau ou ingestion. Précautions de sécurité tels que des gants, des lunettes de protection, une blouse de laboratoire et en travaillant dans une hotte de laboratoire sont essentielles. Éliminer tous les déchets contenant du phénol conformément aux règlements de l’Institut.
    1. Ajouter un volume de phénol : chloroforme : isoamylique alcool (25:24:1) dans l’échantillon et le vortex soigneusement.
    2. Centrifuger pendant 10 min à vitesse maximale (16 000 x g) dans une centrifugeuse de table à la température ambiante. Transvaser avec soin la phase aqueuse supérieure à un tube de microcentrifuge fraîches. Prendre soin de ne pas pour reporter sur n’importe quel phénol pendant le pipetage.
    3. Répétez les étapes 3.6.1 et 3.6.2 une fois.
    4. Ajouter une petite quantité (0.2 µL) du glycogène, des volumes 0,1 M 3 d’acétate de sodium (pH 5,2) et 2 volumes de 100 % d’éthanol (EtOH).
    5. Vortex et incuber à-20 ° C pendant plusieurs heures ou toute la nuit.
    6. Centrifuger pendant 30 min à la vitesse maximale à 4 ° C à l’aide d’une centrifugeuse de table.
    7. Avec précaution, retirez le surnageant et laver le culot d’ADN avec 70 % EtOH.
    8. Centrifuger pendant 30 min à la vitesse maximale à 4 ° C à l’aide d’une centrifugeuse de table.
    9. Retirez le surnageant et le culot d’ADN sécher à l’air. Assurez-vous que tous le EtOH se soit évaporée, mais veillez à ne pas trop sécher le culot.
    10. Dissoudre le culot d’ADN dans 12 µL d’H2O.
      NOTE : PAGE gel extraction est très inefficace. Pour chaque 10 µg de démarrage ADN digéré avec MNase, s’attendre à récupérer 1-20 ng de fragments purifiés après extraction du gel. Contrôler le montant et l’intégrité des fragments de chargement 1/6ème (2 µL) sur un gel de la PAGE (Figure 2).

4. fin réparation des Fragments digérés MNase, purification Gel

  1. Mettre en place la réaction suivante à l’aide d’un ADN émoussant kit : 10 µL de l’ADN purifié de l’étape 3.6.10, 1,5 µL de 10 X émoussant 1,5 µL du mélange dNTP 1 mM, 0,6 µL d’enzyme émousser, tampon, 1,4 µL d’H2O.
  2. Incuber à 22 ° C pendant 30 min et puis chaleur-inactiver l’enzyme par incubation à 70 ° C pendant 10 min.
  3. Ajouter 85 µL d’H2O et effectuer un réaction nettoyage à l’aide de standard phénol/chloroforme-extraction et EtOH-précipitations (tel que décrit à la section 3.6). Procéder immédiatement à la ligature de l’éditeur de liens.

5. génération de linker

NOTE : Linkers ont besoin d’être amplifié en parallèle avec l’article 3, pour être en mesure de procéder immédiatement à la ligature de l’éditeur de liens. Séquences d’amorces utilisées ci-dessous doivent être appropriées pour le vecteur d’expression gRNA choisie. Celles qui sont présentées ici ont été conçus pour le vecteur Pan-RPGAA-pLKO.1. 9 pour l’amplification de l’éditeur de liens 5' de Pan-RPGAA-pLKO.1, utiliser l’apprêt séquences 5'-linker-F (TTGGAATCACACGACCTGGA) et 5'-linker-R (CGGTGTTTCGTCCTTTCCAC), ce qui donne un amplicon bp 689. Pour l’amplification de l’éditeur de liens 3' de Pan-RPGAA-pLKO.1, utiliser les amorces 3'-linker-F: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) et 3'-linker-r : (ACTCGGTCATGGTAAGCTCC), qui produisent un amplicon bp 848.

  1. PCR-amplifier l’adaptateur des séquences du vecteur d’expression gRNA (à l’aide de réactifs de choix et de séquences d’apprêt personnalisées, si nécessaire). Pour Pan-RPGAA-pLKO.1 mis en place la réaction PCR de 50 µL à l’adresse suivante : 25 µL du mélange maître PCR, 2,5 µL d’apprêt F (10 µM), 2,5 µL de primer R (10 µM), 0,1 ng de vecteur d’expression gRNA (Pan-RPGAA-pLKO.1) H2O.
  2. Incuber les réactions sur un thermocycleur en utilisant les conditions suivantes : 1 cycle de 98 ° C pendant 30 s, 32 cycles 98 ° C pendant 10 s, 59 ° C pendant 10 s, 72 ° C pendant 30 s, 1 cycle de 72 ° C pendant 10 min.
  3. Purifier les réactions de PCR en phase solide immobilisation réversible billes selon les instructions du fabricant. Éluer dans 30 µL d’H2O.
  4. Pour appliquer la ligature directionnelle de l’éditeur de liens aux fin-réparé, digérés MNase des fragments d’ADN, linkers digest avec des enzymes de restriction appropriées (ici HindIII et SacII). Mettre en place les réactions suivantes :
    1. Pour la digestion de l’éditeur de liens 5' avec HindIII, utiliser 30 µL de linker amplicon purifiée 5' de l’étape 5.3., 5 µL de tampon, 3 µL de HindIII (20U/µL) et 12 µL d’H2O.
    2. Pour la digestion de 3' linker avec SacII, utiliser 30 µL de linker amplicon purifiée de 3' de l’étape 5.3., 5 µL de tampon, 3 µL du SacII (20 U/µL) et 12 µL d’H2O.
  5. Incuber les digestions à 37 ° C pendant 3 h.
  6. Ajouter le gel d’ADN chargement colorant et exécuter les condensés de l’enzyme de restriction sur un gel d’agarose à 1 %. Exciser les bandes à 637 bp (5' digest de l’éditeur de liens) et 295 bp (3' digest de l’éditeur de liens).
  7. Purifier l’ADN les morceaux excisés gel à l’aide d’un kit d’extraction de gel.

6. linker ligature et Amplification d’Inserts

  1. Mettre en place une réaction de ligature 14 µL à l’aide de quantités équimolaires de fragments digérés MNase, réparé à la fin et les séquences de l’éditeur de liens.
    NOTE : Linker ratios fragment peut être optimisé. Il est recommandé d’inclure une réaction de contrôle non-fragment (NFC).
    1. L’utilisation de 5 ng de digéré MNase fragments (fin-réparé et purifiée), 120 ng de l’éditeur de liens 5' (HindIII digest, purifiée), 55 ng de 3' linker (Sacrecueil II, purifiée), 1,4 µL de T4 ligase tampon et 1,4 µL du concentré T4 DNA ligase, en H2O.
  2. Incuber les réactions de ligature à 16 ° C pendant 16 h. Faire pas chaleur-inactiver l’enzyme. Procéder immédiatement à l’entaille-traduction.
    Nota : Les fragments digérés MNase réparé à la fin donnent les 5' phosphates nécessaires pour la ligature des linkers, comme l’éditeur de liens eux-mêmes sont non-phosphorylés.
  3. Pour la ligature de réaction (et la réaction de NFC) ajoutent ce qui suit : 25 µL de Taq 2 X mélange principal (capable de nick translation), 2,5 µL d’apprêt Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 2,5 µL d’apprêt Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC) et 6 µL de H2O.
  4. Inclure un contrôle non-modèle (NTC). Incuber les réactions sur un thermocycleur en utilisant les conditions suivantes : 1 cycle (nick translation) : 72 ° C pendant 20 min, 1 cycle : 95 ° C pendant 5 min, 3-4 cycles : 95 ° C pendant 15 s, 58 ° C pendant 15 s, 72 ° C pendant 30 s, 1 cycle : 72 ° C pendant 5 min.
  5. Effectuer un réaction nettoyage à l’aide de billes d’immobilisées réversible en phase solide avec une perle rapport de 1:1 échantillon. Éluer à 40 µL d’H2O.
  6. Encore amplifier le fragment désiré (5' linker + MNase fragmente + 3 ' éditeur de liens) à l’aide de réactifs appropriés de PCR et les amorces suivantes :
    1. Utiliser 12,5 µL du mélange maître PCR, 1,25 ml d’apprêt Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 1,25 ml d’apprêt Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC), 2,5 µL de produit de traduction nick purifiée de l’étape 6.4. et 7,5 µL d’H2O. utiliser les conditions suivantes : 1 cycle : 98 ° C pendant 30 s, 10-16 cycles : 98 ° C pendant 10 s, 63 ° C pendant 10 s, 72 ° C pendant 15 s, 1 cycle : 72 ° C pendant 10 min.
      Remarque : Si nécessaire, plusieurs réactions peuvent être mises en place en parallèle pour qu’il y a suffisamment de produit PCR pour les étapes suivantes. Afin de visualiser les petites quantités de produit PCR sur gel d’agarose, mis en place des réactions supplémentaires comme dans l’étape 6.5 et augmenter le nombre de cycle de 15 à 32. Cette réaction peut servir de contrôle de la qualité, si amplimères ne sont pas visibles après 15 cycles. N’inclure également un aucun contrôle de modèle (NTC).

7. sélection de la taille

Remarque : Cette étape sépare MNase fragments avec l’éditeur de liens correctement attaché 5' et 3' des fragments avec deux 5' ou deux linkers 3' selon la taille.

  1. Combiner tous les réactions de PCR 15-cycle de l’étape 6.5., ajouter ADN colorant de chargement et d’exécuter sur un gel d’agarose 0,8 %. La bande à 869 l’accise bp et purifier l’ADN en utilisant un gel extraction kit.
  2. Quantifier la quantité d’ADN (par exemple à l’aide d’un spectrophotomètre).

8. clonage de Fragments amplifiés par PCR dans le gRNA vecteur d’Expression par Gibson Assemblée

  1. Préparer l’Assemblée master mix comme suit :
    Remarque : Les étapes suivantes sont adaptées de Gibson et al. 12.
    1. Créer 6 mL de tampon de réaction isotherme en combinant 3 mL de 1 M Tris (hydroxyméthyl) aminométhane (Tris)-HCl pH 7.5, 300 µL de 1 M du MgCl, 60 µL de triphosphate de désoxyguanosine 100 mM (dGTP), 60 µL de triphosphate d’adénosine 100 mM (dATP) 60 µL de désoxythymidine 100 mM triphosphate (dTTP), 60 µL de triphosphate de désoxycytidine 100 mM (dCTP), 300 µL de 1 M le dithiothréitol (DTT), 1,5 g de polyéthylène glycol (PEG)-8000, 300 µL de 100 mM nicotinamide adénine dinucléotide (NAD) à ultrapure H2O.
      NOTE : Cette mémoire tampon peut être aliquotés et congelés à-20 ° C.
    2. Créer 1,2 mL Assemblée master mix en combinant 320 µL de 5 X tampon de réaction isothermique, 3 µL de 10 U/µL T5 exonucléase, 20 µL de 2 U/µL ADN polymérase, 160 µL de 40 U/µL DNA ligase dans ultrapure H2O. utilisation 15 µL du mélange maître Assemblée 5 µl de insérer.
      Remarque : Le mélange maître Assemblée peut être aliquotés et congelés à-20 ° C, où il est stable depuis plus d’un an et peut tolérer plusieurs cycles de gel-dégel. Le montant choisi de l’exonucléase T5 est idéal pour une utilisation avec long porte-à-faux.
  2. Digestion de vecteur colonne vertébrale
    Remarque : Veillez à digérer une quantité suffisante de vecteur comme entrée pour le nombre de réactions de l’Assemblée à l’étape 8.3 souhaité.
    1. Par réaction, ajouter ce qui suit : digérer les 1,5 µg de vecteur d’expression gRNA (Pan-RPGAA-pLKO.1), 5 µL de tampon, 1,5 µL d’âgej’ai (5U/µL) et 38,5 µL d’H2O. Incuber à 37 ° C pendant 2 h.
  3. Déphosphorylation du vecteur linéarisé.
    Remarque : Cette étape est conseillée, mais pas absolument nécessaire. T5 exonucléase dans master mix supprimera surtout l' âgej’ai porte-à-faux avant que la Taq DNA ligase a eu l’occasion d’agir. Par conséquent, trop re-ligature du vecteur ne devrait pas.
    1. Ajouter 2,5 µL d’enzyme phosphatase alkaline de crevette (rSAP, 1 U/µL).
    2. Incuber à 37 ° C pendant 30 min et ensuite désactiver l’enzyme en incubant à 65 ° C pendant 5 min.
  4. Effectuer la purification de l’ADN
    Remarque : Il est recommandé d’effectuer une étape d’extraction de gel d’agarose. Par ailleurs, colonne - ou perle de purification peut être utilisée. Il est important de vérifier que la digestion du vecteur est complete, par exemple par électrophorèse sur gel d’agarose. Pour comparaison, non digéré vecteur doit être exécuté en parallèle.
  5. Quantifier la quantité de purifiée vecteur digérée dans l’échantillon.
  6. Mettre en place l’Assemblée avec 2 fois excès molaire d’inserts à vector. Par 20 µL réaction utilisation 100 ng du vecteur (âgej’ai digérer de l’étape 8,5), 12,2 ng d’insérer (à partir de "Etape 7.1.), 15 µL du mélange principal de l’Assemblée de l’étape 8.1.2. H2O.
  7. Incuber à 50 ° C pendant 1 h.
  8. Purifier les réactions à l’aide de la purification de la colonne. Remettre en suspension l’ADN dans 75 µL d’H2O (ou échéant en volume selon l’échelle de l’électroporation).
    Remarque : L’efficacité de la transformation est grandement tributaire de pureté de l’ADN. Étapes de purification supplémentaire (p. ex. extraction de phénol/chloroforme) pourraient améliorer l’efficacité.

9. préparation des cellules d’Escherichia coli Electro-compétente TG1

  1. S’assurer que tous les centrifuger bouteilles et flacons sont exempts de détergents par lavage et remplissage ultérieur à l’eau distillée avant l’autoclavage.
    Remarque : Cette étape permet d’éliminer toutes les impuretés qui peuvent affecter l’efficacité de transformation. L’eau doit être jetée immédiatement avant l’emploi. Alternativement, utiliser des bouteilles jetables de centrifugation peut être utile.
  2. Veiller à ce que centrifugeuse bouteilles, les tubes et les solutions utilisés pour la préparation des cellules electrocompetent sont réfrigérées sur l’avant de la glace de l’utiliser. Il est préférable d’effectuer les opérations suivantes dans une chambre froide pour réduire au minimum les fluctuations de température qui peuvent affecter l’efficacité de la transformation.
  3. Préparer le milieu 2TY. À 16 g de bacto tryptone, 10 g d’extrait de levure et 5 g de NaCl, ajouter de l’eau distillée à 1 L, mélanger et stériliser. Conserver le milieu à température ambiante.
  4. Préparer des plats biologiques 2TY-agar enduit et Pétri de 10 cm contenant l’antibiotique approprié. Stocker les plaques à 4 ° C.
    Remarque : Le choix de l’antibiotique dépend de la nature du vecteur d’expression gRNA, utilisation 100 µg/mL ampicilline pour Pan-RPGAA-pLKO.1.
  5. Grattez provenant d’un stock de glycérol de cellules TG1 pour ensemencer 10 mL de milieu de 2TY (sans antibiotiques).
  6. Incuber à 37 ° C pendant la nuit (~ 16 h) la culture avec la secousse à 225 t/mn.
  7. Ensemencer 1 L de milieu 2TY (sans antibiotiques) les 10 ml d’une culture (dilution 1/100) et diviser également entre deux flacons de 2 L (contenant des chicanes).
  8. Incuber à 37 ° C, 225 t/mn jusqu'à obtenir une nm DO600 de 0,55 (après environ 1,5 à 2 h), la culture. Utilisez un spectrophotomètre pour vérifier régulièrement les DO600 nm.
  9. Faites refroidir les cultures sur la glace pendant 30 min.
  10. Diviser la culture également entre quatre bouteilles de 500 mL Centrifugeuse (préalablement refroidie sur la glace).
  11. Centrifuger à 4 000 x g à 4 ° C dans une centrifugeuse préalablement réfrigérée pendant 15 minutes.
  12. Surnageants de décanter et ajouter 1 volume (soit 250 mL) d’avance réfrigérés glacee stérile distillée H2O à chacune des bouteilles centrifugeuse. Resuspendre le culot bactérien en agitant ou en inversant la bouteille (ou de pipetage doux, si nécessaire).
    Remarque : Il est plus facile de resuspendre le culot en ajoutant d’abord une petite quantité d’eau. S’assurer que la pastille est resuspendue complètement par la suite.
  13. Centrifuger pendant 15 min à 4 000 x g à 4 ° C.
  14. Répéter le lavage deux fois (étapes 9.12. et 9.13). Retirez le surnageant. Soyez prudent lors de la décantation comme le culot bactérien devient plus en plus lâche après le lavage.
  15. Resuspendre le culot dans 50 mL de glycérol à 10 % stérile, glacée et transférez-le dans un tube à centrifuger avant réfrigéré 50 mL.
  16. Cellules de Centrifuger pendant 15 min à ~ 4 000 x g à 4 ° C. Retirer délicatement le surnageant.
  17. Doucement remettre en suspension les bactéries dans 2 mL de glacee glycérol stérile de 10 %.
  18. Rester sur la glace si les cellules doivent être utilisées immédiatement pour l’électroporation.
    Remarque : Les cellules peuvent être congelés en aliquotes de 50 µL dans des tubes de 0,5 mL dans un bain de glace sèche éthanol et conservés à-80 ° C, mais cela n’est pas recommandé.

10. l’électroporation des cellules d’Escherichia coli de TG1 Electrocompetent

NOTE : Électroporation est l’un des goulets d’étranglement dans la production de la bibliothèque complète. Afin de préserver la représentation de la bibliothèque, il est recommandé d’effectuer des réactions individuelles électroporation autant que nécessaire/possible et à effectuer les opérations de contrôle de la qualité décrites ci-dessous (10.6. et 10,8.).

  1. Aliquote les réactions purifiées (de l’étape 8,8) en PCR stérile et préalablement réfrigérée tubes et gardez-les sur glace (1 µL par tube). Faites refroidir 1 mm écart électroporation cuvettes sur la glace.
  2. Ajouter 25 µL de cellules de TG1 fraîchement préparés directement à une partie aliquote d’ADN et immédiatement transférer le mélange dans une cupule d’électroporation. Flick ou robinet la cuve pour assurer le mélange de cellules/ADN est distribué sur toute la longueur de la chambre de la cuvette (sans air emprisonné ou bulles).
  3. Placez la cuve dans le compartiment de la glissière et démarrer le programme d’électroporation approprié (par exemple 1 impulsion de 1.8 kV (CE1)).
    Remarque : La constante de temps devrait se situer entre 5,7 et 6,0 m dans le cas où les arcs électroporateur, effleurer la cupule, assurez-vous il n’y a pas de bulles d’air dans la chambre et essayez à nouveau.
  4. Immédiatement ajouter 975 µL de température ambiante 2TY moyen dans la cuvette.
  5. À l’aide d’une pipette de transfert, déplacer les bactéries électroporés dans un tube de 50 mL. Répétez l’étape 10.2. et de recueillir toutes les cellules transformées avec une bibliothèque dans un tube de 50 mL.
  6. Le volume total du document.
  7. Étape de contrôle de la qualité
    1. Afin de quantifier la compétence des cellules fraîchement générés electro-compétentes, effectuer une réaction d’électroporation distinct à l’aide d’une quantité définie d’ADN (par exemple 10 pg pUC19 contrôle plasmidique) non circonci plasmidique. Ce transfert dans un tube de microtubes de 1,5 mL.
      Remarque : La compétence doit être au moins 1010 colonie unités formant (colonies UFC) par µg ADN. Les cellules fraîchement préparées généralement effectuent mieux que cela.
  8. Incuber les bactéries transformées à 37 ° C pendant 60 min en secouant à 225 t/mn.
  9. Étape de contrôle de la qualité :
    1. Plaque une petite quantité définie de bactérie transformée avec la bibliothèque (par exemple 10 µL d’une dilution de pli de 10-100) sur une gélose de 10 cm avec la sélection antibiotique appropriée.
      NOTE : Connaissant le volume total de la culture (de l’étape 10.6.), le nombre de colonies obtenues peut servir à estimer le nombre total de colonies pour l’intégralité de votre bibliothèque. représentation de pli de 20-30 de la bibliothèque devrait idéalement être maintenue.
  10. Disperse le reste de la bactérie sur 2TY agar enduit bioessai vaisselle contenant la sélection antibiotique appropriée.
    Remarque : Le volume de la culture peut être réduit par centrifugation à ~ 4 000 x g pendant 10 min (ou jusqu'à ce qu’un pellet visible s’est formé et le surnageant semble évident). Cela réduit le temps de plaques doivent sécher après la diffusion de la culture. Utilisation de plaques au lieu du milieu de culture liquide minimise la croissance disproportionnée des colonies individuelles. 13
  11. Étendre un volume approprié de la réaction d’électroporation contrôle pUC19 sur un plat d’agar supplémentaires de 10 cm avec une sélection appropriée aux antibiotiques.
  12. Incuber les boîtes de gélose durant la nuit (16 h) à 37 ° C.
  13. Dénombrer les colonies obtenues sur les plaques de contrôle (contrôle et pUC19 plaque de bibliothèque) pour estimer les CFU/µg d’ADN de la bactérie ainsi que de la complexité de la bibliothèque.

11. extraction de l’ADN plasmidique

  1. Ajouter 10 mL de médias 2-TY aux plaques une nuit ou Pluss, gratter la couche bactérienne la plaque à l’aide d’un épandeur jetable et ramasser dans un tube de 50 mL. Répétez plusieurs fois jusqu'à ce que toute la plaque semble propre.
  2. Extraire l’ADN en utilisant un kit de plasmide Maxi (2 ou 3 colonnes nécessaires par Bio-essai sur plaque).

Representative Results

En utilisant le protocole à portée de main, bibliothèques gRNA CORALINA ont été générés de l’homme, de l’ADN génomique souris9 et ADN (Figure 1). Pour produire des fragments d’ADN d’entrée approprié pour le clonage dans des vecteurs d’expression gRNA, des conditions optimales pour la digestion nucléasique contrôlé doivent être déterminés. Un résultat typique pour l’optimisation de la digestion de la nucléase micrococcique est représenté dans la Figure 2 a. Une quantité insuffisante de la nucléase (0,1, 2, 3, 4, 4.5 ou 5 unités) produit aucun produit perceptible dans la gamme de taille requise (bp 10-100) et 5,5 et 7,5 unités produites encore fragments qui sont en moyenne trop long. Plus grande quantité d’enzyme (50 unités) conduire à une dégradation excessive des entrée ADN après 10 min. Par conséquent, un montant intermédiaire a été choisi (10 unités). Le recueil a été intensifié pour produire suffisamment digéré fragments pour purification ultérieure et le clonage (Figure 2 b). Alors qu’il est recommandé de choisir aveuglément des fragments d’ADN de taille et ne compter que sur l’échelle de l’ADN pour l’orientation minimiser l’exposition des fragments d’ADN à la lumière UV, gels peuvent être colorés par la suite pour le contrôle de la qualité de la digestion et de coupe. Figure 2 b montre un exemple représentatif d’un gel de la PAGE de quel ADN fragments entre 20 et 30 bp ont été excisées. Gel purifié MNase fragments ont été chargés sur un 20 % gel de PAGE pour vérifier la sélection réussie selon la taille et la purification des fragments digérés MNase (Figure 2). Le protocole à portée de main est compatible avec l’utilisation de séquences personnalisées de l’éditeur de liens, ce qui permet de cloner des fragments digérés MNase en gRNA vecteurs d’expression de choix. Ici, gRNA-PLKO9 a été utilisé comme épine dorsale. Les linkers sont amplifiés du vecteur d’expression gRNA par PCR standard. Figure 2D représente un exemple représentatif des séquences amplifiées linker dépourvue de supplémentaires, incorrect ou aucun modèle amplicons. Ensuite, linker amplicons sont digérés par des enzymes de restriction pour assurer les linkers sont ligaturés sur les fragments digérés MNase dans le bon sens. Figure 2D montre des gels d’agarose de linkers 5' et 3' avant et après la digestion avec HindIII et SacII respectivement, indiquant une digestion complète des linkers à 637 prédites et 295 bp. La partie droite de l’image de gel documente l’excision des fragments digérés linker. Qui suit gel extraction des linkers digérées, l’étape suivante dans le protocole est la ligature des linkers aux fragments digérés MNase réparé à la fin. Parce que les séquences de l’éditeur de liens sont générées par PCR avec des amorces lieu, individu-ligature de linkers ne devrait pas se produire. Seulement les fragments d’ADN digéré MNase fin-réparé fournissent les groupes phosphates nécessaires pour la ligature. Après nick translation, le produit de la ligature est amplifié par PCR. Afin d’éviter les biais d’amplification PCR excessive qui pourrait biaiser la représentation sous forme de séquences de gRNA dans la bibliothèque, l’amplification est limitée à moins de 20 cycles au total. Après les PCR, les produits d’amplification sont difficiles à visualiser sur gels d’agarose. PCRs de commande séparé avec 32 cycles sont donc effectuées pour détecter les produits (mais ne sont pas utilisés pour la préparation de la bibliothèque). Les résultats de ce contrôle PCR sont indiquées dans Figure 2E. Cela permet d’optimiser les réactions de la ligature et à assurer des réactions sont dépourvues d’artefacts PCR, qui parfois se produisent dans « pas de contrôles de fragments » (NFC). 2E de la figure montre l’amplicon désiré (fragment d’ADN, éditeur de liens 5' + 3' linker, longueur : 869 bp) suite à l’amplification des réactions de ligature à l’aide des taux équimolaires (1:1) entre les fragments et les séquences de l’éditeur de liens.

Figure 1
Figure 1 : A suggéré la chronologie pour la préparation d’une bibliothèque de gRNA. CORALINA propose une stratégie simple et rentable pour la génération de bibliothèques gRNA complète d’une pléthore de différentes sources d’ADN de n’importe quel organisme. Le protocole à portée de main peut être amené à l’achèvement au cours d’une semaine de travail. Génération de l’éditeur de liens peut être effectuée en parallèle avec la fin-réparation de l’ADN. Préparation de bactéries electrocompetent dure deux jours et comprend une étape de croissance durant la nuit et doit donc être démarrée avant l’Assemblée, les réactions sont mises en place. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Des étapes cruciales au cours du protocole. (A) contrôlées digestion de l’ADN permet la génération de fragments de tailles différentes. L’optimisation de la digestion MNase est présentée ici. L’ADN purifié BAC a été traité avec différentes quantités de MNase pour 10 min. 10 U de MNase générer des fragments d’ADN de la longueur désirée (20-30 bp). (B) taille de sélection des fragments entre 20 et 30 bp à l’aide de l’excision des gels de polyacrylamide. L’ADN purifié BAC a été traité avec 10 U de MNase pendant 10 min. L’image a été enregistrée suite à l’excision. (C) contrôle de la qualité des fragments purifiés par gel. Après purification de gel, 1/6ème de la MNase purifiée fragments a été chargé sur un 20 % gel de PAGE pour vérifier la sélection réussie selon la taille et la purification. (D) Amplification de séquences d’éditeur de liens pour l’Assemblée et l’enzyme de restriction digestion des linkers pour clonage directionnel. 5' et 3' linkers furent amplifiés et couper avec HindIII et SacII, respectivement. Contrôles non-modèle (NTC) ont été inclus au contrôle pour les artefacts PCR et d’ADN contaminant. Gauche : demande échantillon analytique ; droite : Echantillons préparative. Image a été enregistrée après le gel de l’excision. (E) ligature réussie des lieurs de fragments d’ADN peut être analysée par PCR avec un augmentation du nombre de cycles de PCR (32) et contrôlée par n’effectuer aucun contrôle de modèle avec H2O (NTC) ou à l’aide de la CNT de l’étape précédente de traduction nick comme entrée (CNE NT)). Il est important de n’inclure un aucun fragment contrôle (NFC), qui est une amplification d’une ligature et la réaction de translation de nick d'où les fragments MNase ont été omis. Seulement les échantillons dans laquelle MNase fragments ont été combinées avec l’éditeur de liens ADN produisent l’amplicon attendu (869 bp). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Discussion

CORALINA peut servir à générer des bibliothèques gRNA à grande échelle par la digestion nucléasique contrôlé d’ADN cible et en vrac clonage de fragments bicaténaire qui en résulte. Inférence statistique indique que beaucoup plus de 10 séquences gRNA individuels de7 ont déjà été clonés avec succès en utilisant le protocole à main9. CORALINA peut être personnalisé de plusieurs façons. Le choix du modèle ADN définit la région cible et la complexité maximale de la bibliothèque générée. Utilisant ce protocole, CORALINA bibliothèques ont été générées précédemment à partir de l’homme et l’ADN génomique de souris9. Résultats représentatifs présentés ici représentent la génération d’une bibliothèque CORALINA d’ADN purifié. Personnalisation supplémentaire est possible par le choix de séquences de gRNA expression vector et éditeur de liens. Nous avons déjà testé trois paires différentes de longueurs de l’éditeur de liens pour l’assemblage de Gibson avec petites variations en efficacité9.

En raison de leur origine de l’ADN bulk digéré, protospacer de CORALINA gRNAs ne sont généralement pas exactement 20 bp en longueur, mais montrent une distribution de longueur avec une moyenne qui dépend à la fois sur les paramètres de la digestion MNase ainsi que la taille de l’excision fait du gel de la PAGE s. l’exemple représentatif indiqué sur la Figure 2 b et C, représente des fragments d’une longueur médiane entre 19 et 27 ans bp. Dans notre expérience, la longueur des fragments est fidèlement préservée par le gRNA généré protospacer9. Alors que des fragments plus courts que 20 bp doit être évitée en raison de taux hors cible plus gRNAs qui en résulte, plus longs fragments risquent beaucoup moins de problème pour les applications en aval, puisqu’il a été démontré que gRNAs avec protospacers tant que 45 bp sont toujours fonctionnelle de9.

Les deux étapes les plus critiques dans le protocole CORALINA sont la sélection de la taille des fragments digérés MNase et étapes de clonage. Génération de fragments qui sont trop courte (p. ex. moyenne moins de 18 ans bp) ou intégration des vecteurs d’expression trop vide gRNA rendra la bibliothèque inutile. Ainsi, il est important optimiser l’étape de digestion MNase (Figure 2 a), pour surveiller l’excision (Figure 2 b, C), vérifiez pour la digestion complète du squelette gRNA vector et y compris aucun fragment des contrôles tout au long du protocole. Une attention particulière doit également être prises pour préserver la représentation de la bibliothèque gRNA. Un goulot d’étranglement courant de génération de la bibliothèque est en général le transfert efficace des plasmides dans les bactéries pour l’amplification. Ainsi, de grandes quantités de bactéries possédant des compétences excellent et un grand nombre d’événements de l’électroporation individuels sont nécessaires pour réaliser un grand nombre de clones gRNA.

Nouvelles stratégies pour la production de bibliothèque gRNA sera nécessaires pour récolter tout le potentiel des approches de dépistage basé sur CRISPR dans les prochaines décennies. Il y a une forte demande pour des méthodes efficaces, simples et personnalisables générer des bibliothèques à grande échelle, une condition sine qua non pour faire le dépistage se prêtent à un plus grand nombre de systèmes modèles et approches ingénieries CRISPR différents. CORALINA fournit un premier pas vers cela. Les utilisations potentielles sont multiples, notamment pour produire des bibliothèques complètes de génomes, ADNc provenant des bibliothèques de systèmes de modèles moins courants, des bibliothèques très ciblés et des montages expérimentaux dans lequel différentes protéines CRISPR (avec PAM différente exigences) sont utilisés en combinaison.

Contrairement aux autres méthodes, CORALINA génère toutes gRNAs possibles de l’entrée de l’ADN. Cependant, un inconvénient de la méthode est que gRNAs manque la séquence nécessaire de PAM sont également inclus dans la bibliothèque, une caractéristique qu’elle partage avec une deuxième méthode enzymatique pour la génération de bibliothèque gRNA, mangeur de CRISPR (tableau 1). Le choix de la méthode idéale pour génération de bibliothèque gRNA dépend les spécifications de la projection prévue expérimenter, en particulier la nature (génique, réglementation, intergénique) et la taille de la région cible (locus unique, plusieurs régions, Génome-large). Nous voyons une tête spéciale en utilisant CORALINA lorsqu’un grand nombre de non codantes ou régions régulatrices doivent être analysés, s’il existe des informations sur les séquences incomplètes ou peu fiables (systèmes modèles exotiques, mélanges d’espèces (p. ex. microbiomes) ou "obtenus expérimentalement entrée), si différentes endonucléases CRISPR sont combinés ou saturer l’analyse est effectuée sur un locus court et défini (par exemple représenté par BACs).

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Les auteurs tiennent à remercier Prof. Dr. Stephan Beck et Prof. Dr. Magdalena Goetz pour leur contribution, d’aide et de support dans l’élaboration de la méthode CORALINA, Maximilian Wiessbeck et Valentin Baumann des commentaires utiles. Le travail a été soutenu par la DFG (STR 1385/1-1).

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
Un protocole universel pour à grande échelle gRNA bibliothèque Production provenant de toute Source d’ADN
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter