Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

Ein umfassendes Verfahren zur Bewertung der In-vitro- Leistung von der vermeintlichen Hämangioblastom Neovaskularisation mit den Sphäroid sprießen Assay

doi: 10.3791/57183 Published: April 12, 2018

Summary

Dieser Beitrag stellt ein umfassendes Verfahren zur in Vitro zu bewerten, ob klassische Tumor-Angiogenese im Hämangioblastome (HBs) und ihre Rolle bei der HBs vorhanden ist. Die Ergebnisse unterstreichen die Komplexität der HB-Neovaskularisation und deuten darauf hin, dass diese Form der Angiogenese nur einen ergänzenden Mechanismus in der HB-Neovaskularisation ist.

Abstract

Die Inaktivierung von der von Hippel-Lindau (VHL) Tumorsuppressor Gen spielt eine entscheidende Rolle bei der Entwicklung von Hämangioblastome (HBs) innerhalb der menschlichen Zentralnervensystem (ZNS). Jedoch die zytologische Herkunft und den evolutionären Prozess der HBs (einschließlich Neovaskularisation) bleiben umstritten und Anti-Angiogenese für VHL-HBs, basierend auf klassischen HB Angiogenese habe produziert enttäuschende Ergebnisse in klinischen Studien. Ein Haupthindernis für die erfolgreiche klinische Übersetzung des Anti-vaskuläre Behandlung ist der Mangel an ein gründliches Verständnis der Neovaskularisation in dieser vaskulären Tumor. In diesem Artikel präsentieren wir Ihnen ein umfassendes Verfahren zur in-Vitro zu bewerten, ob klassische Tumor-Angiogenese in HBs, sowie ihre Rolle bei der HBs vorhanden ist. Mit diesem Verfahren können Forscher genau verstehen die Komplexität der HB Neovaskularisation und die Funktion von dieser Form der Angiogenese in HBs erkennen. Diese Protokolle können verwendet werden, die vielversprechendste Anti-vaskuläre Therapie bei Tumoren, bewerten die translationale Potenzial für die Behandlung von Tumoren oder für die Unterstützung bei der Optimierung der Anti-angiogenen Behandlung für HBs in Zukunft Übersetzungen hat. Die Ergebnisse unterstreichen die Komplexität der HB Neovaskularisation und legen nahe, dass dieses gemeinsame Form Angiogenese nur eine ergänzende Mechanismus in HB Neovaskularisation ist.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hämangioblastome (HBs) sind gutartige vaskuläre Tumore, die ausschließlich im menschlichen Zentralnervensystem (ZNS) gefunden werden. Sie entwickeln sich bei Patienten mit von Hippel-Lindau (VHL) Erkrankung oder sporadische Läsionen. VHL-HBs sind schwer zu heilen durch chirurgische Behandlung durch die häufige Wiederholung und multiple Läsionen, die sich daraus genetische ergeben Störung1. Obwohl die Inaktivierung von VHL Tumorsuppressor Gen die eigentliche Ursache der Tumorgenese von VHL-HBs angesehen wurde, bleiben die zytologische Ursprung (einschließlich Neovaskularisation) und evolutionären Prozess der HBs weitgehend umstritten2. Daher kann ein besseres Verständnis der biologischen Mechanismen der HB-neovaskulären nützliche Einblicke in die vielversprechendsten Anti-vaskulären Strategien VHL-HBs vorsehen.

Neue Forschung hat vorgeschlagen, dass HB-Neovaskularisation, die embryologische Vaskulogenese3,4,5 ähnelt. Klassische vaskulären endothelialen Wachstumsfaktor (VEGF)-vermittelten Angiogenese, entstand aus dem vaskulären Endothel und, angetrieben durch VHL Funktionsverlust, führte zu Verbreitung und neovaskulären Formation, die seit6in Frage gestellt. In 1965, Cancilla und Zimmerman gefunden, verwenden Elektronenmikroskopie, die das Endothel7HBs stammt. Später wurde festgestellt, dass Vasoformative Element8Stromazellen Zellen abgeleitet werden. 1982 fand Jurco Et Al. , dass Stromazellen Zellen von endothelialen Ursprungs-9. Daher vermutet wir, dass menschliche vaskuläre endotheliale Zellen der ursprünglichen Zellen von HB-Neovaskularisation10sind. Obwohl es besser, die Primärkulturen von HB Zellen aus VHL-Patienten Operationen zu verwenden ist, zufolge unserer bisherigen Forschung Primärkulturen von HB sind nicht stabil, und Zell-Linien könnte nicht etablierten3. Darüber hinaus könnte Primärkulturen in der 3D-Umgebung die zytologische Herkunft der HB-Neovaskularisation nicht erkennen, weil sie Vorfahren der HB-Kreislauf Zutaten10,11enthalten. Daher, als primitiv und klassische Modell von Endothelzellen, konnte menschliche vaskuläre endotheliale Zellen (HUVECS) als ein alternatives zellulären Modell für HBs dienen.

Der Sphäroid Sprießende Assay ist ein neues Modell im Tissue engineering12,13. In diesem Papier war ein 3D Kollagen-basierten Coculture System in Vitro mit den Sphäroid sprießen Assay entwickelt mit ein Gesamtziel zu beurteilen, ob klassische Tumor-Angiogenese in HBs, sowie ihre Rolle bei der HBs vorhanden ist.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Diese Methode wurde in Übereinstimmung mit den genehmigten Richtlinien und Vorschriften der Forschung Ethik Komitee von Huashan Krankenhaus, Fudan University durchgeführt. Entsprechende standard-Sicherheits-Maßnahmen wurden in den einzelnen Schritten gefolgt. Eine schematische Darstellung finden Sie in Abbildung 1.

(1) Zell-Kultur und Plasmid-Konstrukt

  1. Routinemäßig pflegen die menschliche nabelader Endothelzellen (HUVECS) in Dulbecco modifizierten Adlers Medium (DMEM) ergänzt mit 10 % fetalen bovine Serum (FBS), 100-Einheit/mL Penicillin und 100 µg/mL von Streptomycin in einer befeuchteten 5 % CO2 Inkubator bei 37 ° C.
  2. PLKO.1 Plasmid ApaI mit EcoRI für die Synthese von ShRNA Fragment zu verdauen. Sicherstellen Sie, dass die Oligonukleotid-Sequenz von VHL ShRNA Vektor CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.
  3. Dann mischen Sie 20 µΜ System mit vorwärts 5 µL 5 µL reverse Oligo Oligo, 5 µL 10 x NEB Puffer und 35 µL DdH2O zusammen (das Gesamtvolumen beträgt 50 µL). Erhitzen Sie die Mischung bei 98 ° C für 4 min, und langsam auf Raumtemperatur abkühlen, in ein paar Stunden.
  4. Verbinden Sie die geglühten Oligos und PLKO.1 Plasmid zusammen mit T4-Ligase bei 4 ° C für eine Nacht. 16 h später hinzufügen 5 µL Ligatur-Mix in 25 µL kompetente DH5α Zellen. Dann Bildschirm erfolgreich aufgespaltenen Plasmiden, und überprüfen Sie die eingefügte Fragment durch Sequenzierung.

(2) Lentivirus Paket und Infektion

  1. Insgesamt mischen Sie 10 µg des PLKO.1-ShVHL oder PLKO.1-ShScramble Vektors, 7,5 µg Plasmid psPAX2 zu verpacken und 2,5 µg Umschlag Plasmid pMD2.G in 500 µL der DMEM Medien ohne fetalen bovine Serum (FBS) für 25 min.
  2. Fügen Sie 7 mLDMEM ohne FBS der Projektmappe bereit oben hinzu.
  3. Kulturzellen Sie 293 FT in DMEM ohne FBS in einem Durchmesser von 10 cm Gewebekultur Gerichte. Stellen Sie sicher, dass die Anzahl der Zellen 293FT 1 x 107 Zelle Zähler.
  4. Fügen Sie 1 mL der Lösung bereit, über das Medium der 293FT Zellen zur Transfektion.
    Hinweis: Die Zell-Linie 293FT 293F Zelllinie abgeleitet ist und stabil express das SV40 große T-Antigen. Daher ist es ein geeigneter Gastgeber für Lentivirale Produktion.
  5. Ersetzen Sie das Kulturmedium mit der DMEM mit 10 % FBS nach 6 h.
  6. Sammeln Sie die Medien mit einer Pipette in 48 h nach Transfektion.
    Hinweis: Das Virus existiert in der DMEM mit 10 % FBS. Die abgestorbenen Zellen Schwimmen auf dem Medium. Verwenden Sie sterile Membran 0,45 µm, um abgestorbenen Zellen und Unreinheiten zu filtern. Im Allgemeinen gibt es keine Notwendigkeit, die Multiplizität der Infektion (MOI) zu überprüfen. Dies soll eine stabile Zellen-Linie zu schaffen. Im letzten Schritt werden alle lebenden Zellen ohne erfolgreiche Infektion durch Puromycin sterben. Die ShScramble Gruppe und HUVECS Zellen sind der Kontrollgruppe. Stellen Sie sicher, dass die HUVECS Zellen mit der verwendeten Puromycin Konzentration von 72 h sterben. Jeder Brunnen hat die gleiche Anzahl von Zellen.
  7. Kultur der HUVECS Zellen in den Lentivirale Medien für 72 h. Fügen Sie Puromycin zu den Medien der HUVECS Zellen in einer Konzentration von 2 µg/mL für 24 Std. Einsatz HUVECS Zellen ohne Behandlung als die Kontrollgruppe. Stellen Sie sicher, dass alle Zellen sterben bis zu diesem Zeitpunkt zu kontrollieren.
    Hinweis: Die lebenden Zellen repräsentieren eine stabile Zelllinie von VHL Knockdown Zellen und ShSramble Zellen. Die Beschichtung ist 5.000/Brunnen in 96-Well Platten.

3. Generation von Endothelzellen Sphäroide

  1. Trypsinize die Mediumwechsel Zellen und Aufschwemmen mittelfristig DMEM mit 10 % FBS. Hinzugeben Sie mit einer moderaten Anzahl von Zellen in der Kulturschale von 10 cm 1 mL Typsin-EDTA.
  2. Samen der Zellen in einem 3D Rundboden 96-Well-Platte in einer Zelle Dichte von 1 × 103 Zellen/gut. Verwenden Sie einen Brunnen, der ein Sphäroid von 0,50 µL aussetzen der Sphäroid unterbringen kann. Anzahl Zellen mit einem Zellsystem Zähler nach den Anweisungen des Herstellers.
  3. Inkubieren Sie die Zellen bei 37 ° C und 5 % CO2 kontinuierlich für 72 h. Sicherzustellen Sie unter diesen Bedingungen, dass die suspendierten Zellen die Zelle Sphäroide automatisch bilden. Ersetzen Sie die Hälfte des Kulturmediums nach 36 h.

4. in-vitro- Angiogenese-Assay

  1. Tauen Sie die Gel-Lösung bei 4 ° C auf und verdünnen Sie es mit dem reduzierten Serum Medium bei einem Verdünnungsverhältnis von 1:5.
  2. Saugen Sie die Sphäroide aus dem Kulturmedium DMEM mit einer Mikropipette. Nach dem Waschen aussetzen die Sphäroide mit 5 mL des Mediums reduzierte Serum der Sphäroide sanft und vorsichtig in das verwässerte Gel. Stellen Sie sicher, dass keine Luftblasen vorhanden sind.
  3. 300 µL der gemischten Flüssigkeit in ein 15-Well-Platte einbetten. Fügen Sie nach der Inkubation bei 37 ° C und 5 % CO2 für 1 h 400 µL reduzierte Serum-Medium in jede Vertiefung hinzu. Füllen Sie steriles Wasser um die Brunnen zu erzeugen eine feuchte Umgebung um Verdunstung zu verhindern.
  4. Danach die Platte bei 37 ° C in 5 % CO2 bei 100 % Luftfeuchtigkeit für 1 h Kultur.
  5. Vorsichtig Aspirieren Sie das alte Medium und ersetzen Sie es durch 600 µL reduzierte Serum-Medium mit 1 % Endothelzellen Ergänzungen in jede Vertiefung.
  6. Nach 12 h oder 24 h, nehmen Bilder unter einem invertierten Lichtmikroskop (40 *).

(5) Datenanalyse

  1. Laden Sie die Bilder, um eine Online-Bild-Analyse-Plattform sprießen Längendaten (Table of Materials) zu erhalten.
  2. Erstellen Sie ein Konto auf der Webseite per e-Mail.
  3. Dann laden Sie die Bilder durch Klicken auf die Schaltfläche "hochladen".
  4. Herunterladen Sie das Ergebnis durch Klicken auf die Schaltfläche "Download".
    Hinweis: Die Software generiert das bearbeitete Bild und die Daten. Die Daten enthalten fünf Teile: kumulative sprießen, mittlere sprießen Länge, die Standardabweichung der Länge sprießen, Keimen und Sphäroid Bereich. In das bearbeitete Bild jeden Parameter sind zusammengefasst in einer anderen Farbe, Identifikation in das bearbeitete Bild erleichtern: Rot steht für Sprossen Skelett, Gelb die Anzahl der Sprossen, blau sprießen Struktur, weißen sprießen Ende und orange Sphäroid.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Originalbilder werden durch umgekehrte Lichtmikroskop getroffen. Die typische Bilder von der Kontrollgruppe und der VHL-Gruppe sind in Abbildung 2dargestellten-A1 und Abbildung 2-A2. Die Sprießende Länge der Kontrollgruppe ist kürzer als die der VHL-Gruppe.

Nach dem Hochladen der Bilder, bietet die Online-Plattform direkt Analyseergebnisse. Die Ausgabe besteht aus zwei Teilen: das bearbeitete Bild und die entsprechenden Analyseergebnisse. Die bearbeiteten Bilder von der Kontrollgruppe und der VHL-gen Stille Gruppe sind mit verschiedenen Farben gekennzeichnet (Abbildung 2-A3 und Abbildung 2-A4). Die mittlere sprießen Länge beträgt 65 µm bzw. 125 µm in der Kontrollgruppe und der VHL-Stille-Gruppe, und die durchschnittliche kumulative sprießen Länge beträgt 680 µm und 1250 µm in der Kontrollgruppe und der VHL-Stille-Gruppe, bzw. darauf hinweist, dass die Länge erhöht sich um sprießen etwa zwei Falten in der VHL-Stille-Gruppe, verglichen mit der Kontrollgruppe (Abb. 2B). Diese Ergebnisse deuten darauf hin, dass VHL-Mangel die Schiff-bildende Fähigkeit der menschlichen Endothelzellen fördert.

Figure 1
Abbildung 1 . Das Schema für das Sphäroid sprießen Assay. Schritte 1 zeigt, dass HUVECS Zellen eine Gericht kultiviert. In Schritt 2 werden HUVECS Zellen in 3D Rundboden-96-Well-Platten für 72 h verschoben, Schritte 3 die HUVECS Zellen bilden Endothelzellen Sphäroide automatisch in der 3D Platte zeigt. Fügen Sie in 4 Schritten Zelle Sphäroid verdünnten Gel hinzu. Fügen Sie in 5 Schritten die Mischung bereit, über eine 15-Well-Platte. Schritte 6 zeigt Sphäroid sprießen in der 15-Well-Platte. Schritte 7 zeigen die Sprießende Aufnahme unter einer invertierten Lichtmikroskop. Die Schritte 8 zeigt das hochgeladene Bild und Schritt 9 ist das Ausgabebild von der Plattform (bar = 100 µm). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 . Die Wirkung von VHL gen-silencing auf die Angiogenese-Fähigkeit der HUVECS Zellen in der Sphäroid sprießen Assay. (A) repräsentative Bilder von Auslauf Auswuchs nach 12 h (A1) und VHL-zum Schweigen gebracht HUVECS Sphäroide (A2) (bar = 100 µm). Zahlen A3 und A4 zeigen die Bilder von der Plattform für Zahlen A1 und A2, bzw. analysiert. Rot stellt Sprossen Skelett, die Anzahl der Sprossen gelb, blau, orange Sphäroid, sprießen Struktur und weißen sprießen Ende. ()B) Länge der Sprossen. Statistische Auswertung erfolgte mittels ungepaarte Student t-Test. * Stellen P < 0,05. CON, Kontrolle; HUVECS, menschliche nabelader Endothelzellen. Bitte klicken Sie hier für eine größere Version dieser Figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vor kurzem wurden mehrere Felder der vaskulären Biologie Forschung durch die Studie der angiogenen Endothel15stimuliert. In diesem Artikel, entwickelten wir eine endotheliale Sphäroid sprießen Technik als ein experimentelles Modell die Gefäß-Bildung zu studieren aus den Funktionsverlust des VHL-Gens in manipulierten Endothelzellen, neuartige Kandidaten Moleküle zu identifizieren die angiogenen Kaskade. Nach bestem Wissen und gewissen ist dies der erste Bericht der angiogenen Auswirkungen der endogenen veränderten Endothelzellen zu untersuchen.

Gewebe (einschließlich Tumorgewebe) Neovaskularisation ist ein komplexer Prozess, der über angiogenen und Vasculogenic Mechanismen, während der Entwicklung, sowie in beiden physiologischen und pathologischen Bedingungen12,15 auftritt , 16. das Sphäroid sprießen Assay zeichnet sich durch eine komplexe Kaskade von Ereignissen17,18, einschließlich der selbständigen Aggregation der Endothelzellen, die eingebettet sind in eine 3D Matrix Zellkultursystem, führt zu sprießen und die Wiedergabe von 3D Netz von Kapillaren19. Dieses 3D Gel eingebettet Sphäroid-Modell ist ein verbreitetes System im Gewebe-Engineering für das Studium der vaskulären Bildung und seine Mechanismen aufgrund seiner Fähigkeit, eine bessere Nachahmung Umgebung in einer geeigneten Matrix geworden. Jedoch ist der wichtigste Schritt dieser biologischen Prozess der Aktivierung von ruhenden Endothelzellen17,20,21,22. In diesem Verfahren wurden die Endothelzellen aktiviert durch die endogene Inaktivierung des VHL-Gens, ein Regler Wachstum gen Neovessels23,24. Anders als bei der klassischen Endothel Einleitung über die exogene Induktion der Matrix und die entsprechende extrazellulären Umgebung (einschließlich exogener vaskuläre Wachstumsfaktoren), kann diese modifizierte Methode zu zahlreichen erweitert werden Anwendungen, endogene genetische Mechanismen zu entwirren. Als nächstes wurde das Protokoll um die Auswirkungen der exogenen Matrix zu verringern, durch verdünnen das Gel, das ein einfacher Schritt in dem Experiment wurde optimiert. Darüber hinaus dauerte es nur wenige Minuten, um Bilder auf die Plattform hochladen und Analyseergebnisse zu erhalten. Die Plattform bietet eine Bild-Analyse-Dienst, den Experimentator, machen eine objektive, vergleichbare und automatisierten Bildanalyse von sprießen Assay Bilder online ermöglicht. Das Protokoll überwindet daher, Messung und Berechnung von vom Menschen verursachten Faktoren verursachte Fehler.

Das mechanistische Verständnis der einzelnen Schritte der Neovaskularisation Kaskade vorgesehen eine rationale Grundlage für die Entwicklung der Anti-vaskuläre Behandlung, die derzeit für die klinische Anwendung in der Onkologie genehmigt wird. Dieses Papier hergestellt eine einfache und robuste Sphäroid basierende Assays Modell Schiff Bildung zu untersuchen, die stammt aus manipulierten Endothelzellen mit Verlust der Funktion des VHL -Gens, neuartige Kandidaten Moleküle für die Neovaskularisation zu identifizieren Kaskade, die für zahlreiche Anwendungen im Zusammenhang mit Angiogenese und Vaskulogenese genutzt werden können. Die Autoren spekulieren, dass diese in-vitro- Modell zusätzliche Informationen bieten könnte zu helfen, die Rolle der Angiogenese in einigen soliden Tumoren (z. B. Tumor Vasculogenic Mimikry) zu bewerten und untersuchen die möglichen Rollen der anderen möglichen Vorläuferzellen Tumor Neovessels in Vivo, insbesondere bei Patienten mit Tumoren generieren, die als Gruppe, nicht auf die Behandlung mit Anti-angiogenen Agenten nur reagieren.

Der Sphäroid Sprießende Assay ist eine weit verbreitete Methode, Angiogenese und damit verbundenen Mechanismen zu studieren geworden. Der Test hat einen wichtigen Vorteil durch die Bereitstellung einer besseren mimischen Umwelt als die klassischen 2D Kulturen. Vor kurzem haben 3D kokultur Modelle entwickelt, um die Tumor-Angiogenese zu studieren, die die Heterogenität und Komplexität der Angiogenese in der Tumor Mikroumgebung25imitiert. In diesem Modell sind die Endothelzellen direkt mit Krebszellen sowie eine Stromale Komponente in einer 3D-Umgebung kultiviert. Darüber hinaus wurden 3D in-vitro- Kultur-Systeme gezeigt, die in Vivo -Reaktion auf Therapeutika als konventionelle Zellkultursysteme besser widerspiegeln. Darüber hinaus ist diese Methode für die Differenzierung von embryonalen Stammzellen, Zellwachstum, Wundheilung, Ischämie und Entzündungen verwendet. Im Vergleich mit der klassischen Methode, ist unser Ansatz effektiv und einfach zu implementieren. Wir glauben es ist ein nützliches Werkzeug für die Untersuchung der Angiogenese in-vitro-, und es öffnet sich eine neue Möglichkeit, diesen Prozess besser zu verstehen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Diese Arbeit wurde durch Zuschüsse aus dem Shanghai Ausschuss für Wissenschaft und Technologie (15411951800, 15410723200) unterstützt. Die Autoren danken Prof. YuMei Wen und Prof. Chao Zhao der pathogenen Mikroorganismus Abteilung der Fudan-Universität für ihre technische Unterstützung.

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
Ein umfassendes Verfahren zur Bewertung der <em>In-vitro-</em> Leistung von der vermeintlichen Hämangioblastom Neovaskularisation mit den Sphäroid sprießen Assay
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter