Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

분석 결과 돋 아 회전 타원 체를 사용 하 여 상 상속 Hemangioblastoma Neovascularization의 생체 외에서 성능을 평가 하는 포괄적인 절차

doi: 10.3791/57183 Published: April 12, 2018

Summary

이 종이 여부를 평가 체 외에 고전적인 종양 신생 hemangioblastomas (HBs)와 HBs에서의 역할에 있는 포괄적인 절차를 제공 합니다. 결과 HB neovascularization의 복잡성을 강조 하 고는 것이 좋습니다이 일반적인 형태의 신생 HB neovascularization만 보완 메커니즘.

Abstract

폰 Hippel Lindau (VHL) 종양 억제기 유전자의 비활성화 인간 중앙 신경 시스템 (CNS) 내에서 hemangioblastomas (HBs)의 개발에 중요 한 역할을 하고있다. 그러나, cytological 근원 그리고 HBs (neovascularization 포함)의 진화 과정 남아 논란, 그리고 안티-신생 VHL-HBs, 고전적인 HB 신생에 기반에 대 한 임상 시험에서 실망 스러운 결과 생산 했습니다. 반대로 혈관 치료의 성공적인 임상 번역 한 주요 장애물이 neovascularization 혈관이 종양에의 한 철저 한 이해의 부족 이다. 이 문서에서는, 우리가 여부를 평가 체 외에 고전적인 종양 신생 HBs, HBs의 역할에 있는 포괄적인 절차 제시. 이 절차와 연구원 수 정확 하 게 HB neovascularization의 복잡성을 이해 하 고이 일반적인 형태의 HBs에 신생의 함수를 식별. 이러한 프로토콜 있는 잠재력이 높은 변환 종양 치료 또는 HBs에 대 한 안티-신생 치료의 최적화에 돕고 미래에 번역에 대 한 종양을 위한 가장 유망한 항 혈관 치료를 평가 하기 위해 사용할 수 있습니다. 결과 HB neovascularization의 복잡성을 강조 하 고는 것이 좋습니다이 일반적인 양식 신생 HB neovascularization만 보완 메커니즘.

Introduction

Hemangioblastomas (HBs)는 독점적으로 인간 중앙 신경 시스템 (CNS) 내에서 발견 되는 양성 혈관 종양. 그들은 폰 Hippel Lindau (VHL) 질병 또는 산발적 병 변 환자에서 개발. VHL HBs 빈번한 재발으로 인해 수술 치료를 통해 치료 하기 어려운 고 발생이 유전자 여러 병 변 장애1. VHL 종양 억제기 유전자의 비활성화 VHL HBs tumorigenesis의 근본 원인을 고려 하고있다, 비록 HBs의 진화 과정과 cytological 근원 (를 포함 하 여 neovascularization) 크게 논란이2남아 있다. 따라서, HB-신생 생물 학적 메커니즘의 더 나은 이해 VHL HBs에 대 한 가장 유망한 항 혈관 전략에 유용한 통찰력을 제공할 수 있습니다.

최근 연구는 건의 HB neovascularization가 vasculogenesis3,,45와 비슷합니다. 고전적인 혈관 내 피 성장 인자 (VEGF)-중재 신생 혈관 내 피에서 유래 하 고 그 기능의 VHL 손실에 의해 구동 됩니다 확산 귀착되 고 신생 형성 되었습니다 도전6. 1965 년, Cancilla와 짐머만, 전자 현미경 검사 법, HBs endothelium7에서 유래를 사용 하 여. 나중 stromal 세포 vasoformative 요소8에서 파생 됩니다 발견 했다. 1982 년에, Jurco 그 외 여러분 발견 stromal 세포 내 피 기원9. 따라서, 우리는 인간의 혈관 내 피 세포는 HB neovascularization10의 원래 세포 가설. HB 셀 VHL 환자 수술에서 파생 된에서 기본 문화권을 사용 하는 것이 낫다, 비록 우리의 이전 연구 표시는 HB에서 주 문화는, 셀 라인 설립된3수 없습니다. 또한, 3D 환경에서 주 문화는 HB 혈관 재료10,11의 창시자를 포함 하기 때문 HB neovascularization cytological 원산지를 식별 하지 수 없습니다. 따라서, 내 피 세포의 원시적이 고 고전적인 모델 인간의 혈관 내 피 세포 (HUVEC) 대체 세포 모델 HBs에 대 한 될 수 있습니다.

회전 타원 체 돋 아 분석 결과 조직 공학12,13에 새로운 모델입니다. 이 문서에는 3D 콜라겐 기반의 coculture 시스템에서 생체 외에서 분석 결과 돋 아 회전 타원 체를 사용 하 여 개발 되었다, 고전적인 종양 신생 HBs, HBs의 역할에 있는지 여부를 평가 하는 전반적인 목표.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

이 메서드는 연구 윤리 위원회의 Huashan 병원, 복 단 대학교의 승인 된 지침에 따라 수행 되었다. 해당 표준 안전 조치는 각 단계에 따라 했다. 도식 프레 젠 테이 션, 그림 1을 참조 하십시오.

1. 세포 배양 및 플라스 미드 구조

  1. 정기적으로 유지 하는 Dulbecco에서 인간의 탯 줄 정 맥 내 피 세포 (HUVEC)이 글의 중간 (DMEM) 10% 태아 둔감 한 혈 청 (FBS), 페니실린, 100 단위/mL와 100 µ g/mL 스 습도 5%에서의 보완 수정의 CO2 배양 기 37 ° c.에
  2. PLKO.1 플라스 ApaI와 EcoRI shRNA 조각의 합성에 대 한 다이제스트. VHL shRNA 벡터의 oligonucleotide 시퀀스 CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14인지 확인 합니다.
  3. 다음, 20 µΜ 시스템 올리고, 역방향 올리고의 5 µ L, 코 버퍼 x 10의 5 µ L ddH2O 함께 (총 볼륨은 50 µ L)의 35 µ L의 앞으로 5 µ L 믹스. 몇 시간에서 4 분, 그리고 천천히 실내 온도 아래로 냉각을 위한 98 ° C에 혼합물을 열.
  4. 하룻밤을 위해 단련된 oligos 및 4 ° C에서 T4 리가 함께 PLKO.1 플라스 미드를 선. 16 h는 나중에, 25 µ L 유능한 DH5α 세포에 결 찰 믹스의 5 µ L를 추가 합니다. 그리고 성공적으로 합자 플라스 미드를 화면 연속 삽입 된 부분을 확인 합니다.

2. lentivirus 패키지 및 감염

  1. 총, PLKO.1-shVHL 또는 PLKO.1 shScramble 벡터의 10 µ g, 7.5 µ g의 플라스 미드 psPAX2, 포장 및 봉투 플라스 미드 pMD2.G 태아 둔감 한 혈 청 (FBS) 25 분 없이 DMEM 미디어의 500 µ L에서의 2.5 µ g을 혼합.
  2. 위의 준비 솔루션 FBS 없이 7 mLDMEM를 추가 합니다.
  3. 10 cm 직경 조직 문화 요리에서 FBS 없이 DMEM 293 피트 셀 문화. 293 피트 셀 수 1 x 107 셀 카운터를 사용 하 여 있는지 확인 합니다.
  4. Transfection 293 피트 셀의 매체에 위의 준비 솔루션의 1 mL를 추가 합니다.
    참고: 293 피트 셀 라인 293F 셀 라인에서 파생 되 고 안정적으로 SV40 큰 T 항 원을 표현 한다. 따라서, 그것은 lentiviral 생산을 위한 적합 한 호스트입니다.
  5. 10% 포함 된 DMEM 문화 매체를 바꿉니다 6 h 후 FBS.
  6. Transfection 후 48 h에는 피 펫을 사용 하 여 미디어를 수집 합니다.
    참고: 10% 포함 된 DMEM에 존재 하는 바이러스 FBS. 죽은 세포는 매체에 부동. 사용 하 여 0.45 μ m 살 균 막 죽은 세포 및 불순물 필터링. 일반적으로, 감염 (MOI)의 다양성을 확인할 필요가 있다. 이것은 안정 된 세포 선 확립 하입니다. 마지막 단계에서 성공적인 감염 없이 모든 살아있는 세포 puromycin에 의해 죽을 것 이다. ShScramble 그룹 및 HUVEC 세포는 제어 그룹. 모든 HUVEC 셀 72 h 사용된 puromycin 농도로 죽을 확인 합니다. 모든 잘 동일한 셀 수가 있다.
  7. HUVEC 셀 72 h lentiviral 미디어에 문화. 그런 다음 컨트롤 그룹으로 치료 없이 24 h. 사용 HUVEC 셀 2 µ g/mL의 농도에서 HUVEC 셀의 미디어를 puromycin를 추가 합니다. 모든이 시간 셀 다 제어를 확인 합니다.
    참고: 살아있는 세포 VHL 최저의 세포와 shSramble 세포의 안정적인 셀 라인을 나타냅니다. 도금 밀도가입니다 96 잘 접시에 5000/잘.

3입니다. 세대 내 피 세포 Spheroids의

  1. HUVECs 셀 trypsinize 및 10 %DMEM 매체에 resuspend FBS. 10 cm 문화 접시에 있는 세포의 적당 한 수, typsin-EDTA의 1 mL를 추가 합니다.
  2. 셀 셀 밀도 1 × 103 셀/3D 라운드 아래 96 잘 접시에 씨앗 회전 타원 체를 일시 중단 하려면 0.50 µ L의 회전 타원 체를 수용할 수 있는 우물을 사용 합니다. 제조업체의 지침에 따라 셀 카운터 시스템을 사용 하 여 셀을 계산 합니다.
  3. 37 ℃에서 72 h에 대 한 지속적으로 5% CO2 셀을 품 어. 이러한 조건에서 일시 중단 된 세포 형성 자동으로 셀 spheroids 확인 합니다. 36 h 후 문화 매체의 절반을 교체 합니다.

4. 체 외에서 신생 분석 결과

  1. 4 ° C에서 젤 솔루션을 해 동 하 고 희석 비율 1: 5의에 감소 된 혈 청 매체와 그것을 희석.
  2. Spheroids는 micropipette와 DMEM 배양에서 빨 아. 세척 후 감소 된 혈 청 매체의 5 mL와 함께 spheroids 일시 중지는 spheroids 부드럽게 그리고 조심 스럽게 희석된 젤에서. 없음 기포 확인 합니다.
  3. 15-잘 접시에 혼합된 액체의 300 µ L를 포함 합니다. 37 ° C, 5% CO2 1 h에서 부 화, 후 각 우물에 400 µ L 감소 된 혈 청 매체를 추가 합니다. 메 마른 물 증발을 방해 하는 습도 환경 생성 우물 주위를 작성 합니다.
  4. 그 후, 5% CO2 1 h 100% 습도에서 37 ° C에서 격판덮개 문화.
  5. 신중 하 게 오래 된 매체를 발음 하 고 감소 된 혈 청 매체에 각 잘 1% 내 피 세포 성장 보충제와의 600 µ L로 합니다.
  6. 12 시간 또는 24 시간 후 거꾸로 가벼운 현미경 이미지를 받아 (40 *).

5. 데이터 분석

  1. 새싹 길이 데이터 (테이블의 재료)를 얻기 위해 온라인 이미지 분석 플랫폼에는 이미지를 업로드.
  2. 웹 페이지에 전자 메일 계정을 만듭니다.
  3. 다음 업로드 버튼을 클릭 하 여 이미지를 업로드 합니다.
  4. 다운로드 버튼을 클릭 하 여 결과 다운로드 합니다.
    참고: 소프트웨어 처리 이미지와 데이터를 생성 합니다. 5 부분을 포함 하는 데이터: 누적 새싹 길이, 평균 새싹 길이 길이 새싹, 새싹 영역 및 회전 타원 체 지역의 표준 편차. 처리 된 이미지에서 각 매개 변수 처리 이미지에서 식별을 쉽게 하기 위해 다른 색상으로 설명 하는: 빨간 나타냅니다 해골 콩나물, 콩나물의 수 노란, 파란 새싹 구조, 백색 새싹 끝, 및 오렌지 회전 타원 체.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

거꾸로 가벼운 현미경에 의해 원래 이미지를 가져옵니다. VHL 그룹과 컨트롤 그룹의 전형적인 이미지는 그림 2에 표시 됩니다-A1그림 2-A2. 컨트롤 그룹의 돋 아 길이 VHL 그룹 보다 짧습니다.

이미지를 업로드 후 온라인 플랫폼 직접 분석 결과 제공 합니다. 출력 두 부분으로 구성: 처리 된 이미지와 해당 분석 결과. 처리 된 이미지는 컨트롤 그룹과 VHL 유전자 침묵 그룹의 서로 다른 색상으로 표시 됩니다 (그림 2-A3그림 2-A4). 평균 새싹 길이 65 µ m 및 제어 그룹 및 VHL 침묵 그룹에서 125 µ m 각각, 고 평균 누적 새싹 길이 680 µ m 및 제어 그룹 및 VHL 침묵 그룹에 1250 µ m 각각, 그 새싹 길이 증가 나타내는 제어 그룹 (그림 2B)에 비해 VHL 침묵 그룹에서 약 2 폴드. 이 결과 VHL 결핍 인간 내 피 세포의 혈관 형성 능력 증진을 나타냅니다.

Figure 1
그림 1 . 분석 결과 돋 아 회전 타원 체에 대 한 스키마. 단계 1는 HUVEC 세포 배양 접시를 보여 줍니다. 단계 2에서 HUVEC 셀 3 단계에서는 HUVEC 셀 폼 내 피 세포 spheroids 자동으로 3D 판 72 헤에 대 한 3D 라운드 하단 96 잘 접시로 이동 됩니다. 4 단계에서에서 셀 회전 타원 체 희석된 젤을 추가 합니다. 단계 5에서 15-잘 접시 위에 준비 하는 혼합물을 추가 합니다. 6 단계 회전 타원 체 15-잘 접시에 돋 아을 보여줍니다. 단계 7 거꾸로 가벼운 현미경 촬영 돋 아 이미지를 보여 줍니다. 업로드 된 이미지를 표시 하는 8 단계와 9 단계는 플랫폼에서 출력 이미지 (바 = 100 µ m). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 . VHL 유전자 분석 결과 돋 아 회전 타원 체에 HUVEC 세포의 신생 능력에 침묵의 효과. (A) (A1) 컨트롤과 VHL 침묵 HUVEC spheroids (A2)에 12 h 후 오 르네 파생물의 대표 이미지 (바 = 100 µ m). 그림 a 3와 A4 분석 플랫폼에서 그림 a 1과 A2, 각각 이미지를 보여줍니다. 빨간 나타내는 콩나물 해골, 싹 수 노란, 파란 새싹 구조, 백색 새싹 끝, 및 오렌지 회전 타원 체. (B) 는 콩나물의 길이. 통계 분석은 짝이 없는 학생의 t-검정을 사용 하 여 수행 되었다. * 대표 P < 0.05. 콘, 제어; HUVEC, 인간 탯 줄 정 맥 내 피 세포 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

최근, 혈관 생물학 연구의 여러 분야는 신생 endothelium15의 연구에 의해 자극 되었다. 이 문서에서는, 우리는 내 피 회전 타원 체의 소설 후보 분자 식별 하 조작 내 피 세포에서 기능의 VHL 유전자의 손실에서 유래 혈관 형성을 연구 하는 실험 모델 기법을 돋 아 개발에 신생 캐스케이드입니다. 우리의 지식 최선을이 endogenic 수정 된 내 피 세포의 신생 효과 검사 하는 첫 번째 보고서 이다.

(를 포함 하 여 종양 조직) 조직을 neovascularization 통해 신생 및 vasculogenic 메커니즘 두 생리 및 병 적인 조건12,15 에서 뿐만 아니라 개발 하는 동안 발생 하는 복잡 한 과정은 , 16. 회전 타원 체 분석 결과 돋 아 이벤트17,18, 돋 아에서 결과 3D 셀 매트릭스 문화 시스템에 포함 되어 있는 내 피 세포의 각자 집계를 포함 한 복잡 한 캐스케이드 특징 이다 그리고 모세 혈관19의 3 차원 네트워크의 재생산. 이 3D 젤 포함 회전 타원 체 모델 혈관 형성을 연구 하 고 그 메커니즘에 적합 한 매트릭스 mimicking 더 나은 환경을 제공 하는 기능 때문에 조직 공학에서 널리 사용 되는 시스템 되고있다. 그러나,이 생물 학적 과정의 가장 중요 한 단계는 무부하 내 피 세포17,20,,2122의 활성화 이다. 이 절차에서는 내 피 세포 되었다 VHL 유전자, neovessels23,24의 레 귤 레이 터 성장 유전자의 endogenic 입을 활성화 됩니다. 고전적인 endothelium 개시 를 통해 매트릭스와 해당 extracellular 환경 (포함 세 혈관 성장 인자)의 외 인 유도에서 다른,이 수정된 방법은 확장할 수 있습니다에 수많은 endogenic 유전자 메커니즘을 해명 하는 응용 프로그램. 다음, 외 인 매트릭스의 영향을 점감 하는 프로토콜 실험에 간단한 단계는 젤을 diluting 하 여 최적화 되었다. 또한, 그것은 플랫폼에 이미지를 업로드 하 고 분석 결과를 분만 했다. 플랫폼 목표, 분석 결과 이미지를 온라인을 돋 아의 비교, 그리고 자동화 된 이미지 분석 하도록 실험을 허용 하는 이미지 분석 서비스를 제공 합니다. 따라서, 프로토콜 인공 요인에 의해 발생 하는 측정 및 계산 오류를 극복 한다.

Neovascularization 캐스케이드의 개별 단계의 기계적 이해 현재 종양학에서 임상 응용 프로그램에 대 한 승인 되 고 반대로 혈관 치료의 개발에 대 한 합리적인 기초를 제공 합니다. 이 문서는 neovascularization에 대 한 소설 후보 분자 식별 VHL 유전자의 기능의 손실 가진 조작된 내 피 세포에서 유래 혈관 형성을 공부 하는 간단 하 고 강력한 회전 타원 체 기반 분석 결과 모델 설립 폭포가 있는 수많은 신생 및 vasculogenesis 관련 응용 프로그램에 대 한 이용 될 수 있다. 저자는이 체 외에 모델 일부 고체 종양 (예를 들어, 종양 vasculogenic 흉내)에서 신생의 역할을 평가 하 고 다른 가능한 조상 세포의 잠재적인 역할을 조사할 수 있도록 추가 정보를 제공할 수 있습니다 추측 생성 종양 neovessels에서 vivo에서, 특히 환자 종양, 그룹으로, 안티-신생 작용만 치료에 반응 하지 않습니다.

회전 타원 체 돋 아 분석 결과 신생 및 관련된 메커니즘 연구에 널리 사용 되는 방법 되고있다. 분석 결과 클래식 2D 문화 보다 더 나은 모방 환경을 제공 하 여 중요 한 장점이 있다. 최근, 3D 공동 문화 모델이 고 종양 microenvironment25내 신생의 복잡성을 종양 혈관 신생 연구 개발 되었습니다. 이 모델에서는 내 피 세포는 암 세포 뿐만 아니라 3D 환경에서 stromal 구성 요소와 직접 교양. 또한, 문화 시스템 3 차원 생체 외에서 기존의 세포 배양 시스템 보다 치료제 vivo에서 응답 더 정확 하 게 반영 하기 위해 표시 되었습니다. 또한,이 메서드는 배아 줄기 세포, 조직 성장, 상처 치유, 허 혈, 및 염증의 감 별 법을 위해 사용 됩니다. 전통적인 방법에 비해, 우리의 접근은 효과적이 고 쉽게 구현할 수 있습니다. 우리는 신생에서 생체 외에서연구를 위한 유용한 도구입니다 그것은 더 나은이 과정을 이해 하는 새로운 방법을 엽니다 것을 믿습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgments

이 작품은 상하이 과학 위원회 및 기술 (15411951800, 15410723200)에서 교부 금에 의해 지원 되었다. 저자 교수 YuMei 원 및 그들의 기술 지원에 대 한 병원 성 미생물과 복 단 대학 교수 차오 Zhao 감사 하 고 싶습니다.

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
분석 결과 돋 아 회전 타원 체를 사용 하 여 상 상속 Hemangioblastoma Neovascularization의 <em>생체 외에서</em> 성능을 평가 하는 포괄적인 절차
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter