Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

Um procedimento abrangente para avaliar o desempenho In Vitro da neovascularização de Hemangioblastoma putativo usando o Spheroid brotando do ensaio

doi: 10.3791/57183 Published: April 12, 2018

Summary

Este trabalho apresenta um procedimento abrangente para avaliar em vitro se vasculogênese clássico existe em hemangioblastomas (HBs) e seu papel na HBs. Os resultados destacam a complexidade do HB-neovascularização e sugerem que esta forma comum de angiogênese é apenas um mecanismo complementar no HB-neovascularização.

Abstract

A inactivação do gene supressor de tumor da von Hippel-Lindau (BVS) desempenha um papel crucial no desenvolvimento da hemangioblastomas (HBs) dentro do sistema nervoso central humano (CNS). No entanto, tanto a origem citológica e o processo evolutivo da HBs (incluindo a neovascularização) permanecem controversas, e antiangiogênese para BVS-HBs, baseados no clássico HB angiogênese, têm produzido resultados decepcionantes em ensaios clínicos. Um grande obstáculo para o sucesso clínico tradução de tratamento anti-vascular é a falta de uma compreensão completa de neovascularização neste tumor vascular. Neste artigo, apresentamos um procedimento abrangente para avaliar em vitro se vasculogênese clássico existe em HBs, bem como seu papel na HBs. Com este procedimento, pesquisadores com precisão podem compreender a complexidade do HB neovascularização e identificar a função desta forma comum de angiogênese em HBs. Estes protocolos podem ser usados para avaliar a terapia anti-vascular mais promissor para os tumores, que tem alto potencial de translação para tratamento de tumores ou para ajudar na otimização do tratamento antiangiogênico para HBs, no futuro, traduções. Os resultados destacam a complexidade da HB neovascularização e sugerem que esta angiogênese formulário comum é apenas um mecanismo complementar em HB neovascularização.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hemangioblastomas (HBs) são tumores vasculares benignos encontrados exclusivamente dentro do sistema nervoso central humano (CNS). Eles desenvolvem em pacientes com doença de von Hippel-Lindau (BVS) ou lesões esporádicas. BVS-HBs são difíceis de curar através de tratamento cirúrgico devido a frequente recorrência e desordem de múltiplas lesões que resultam genética1. Embora a inactivação do gene supressor de tumor da BVS tem sido considerada a causa de tumorigênese da BVS-HBs, a origem citológica (incluindo a neovascularização) e processo evolutivo de HBs permanecem em grande medida controversa2. Portanto, uma melhor compreensão dos mecanismos biológicos HB-neovascular pode fornecer insights úteis sobre antivasculares mais promissoras para BVS-HBs.

Recente pesquisa sugeriu que HB-neovascularização é semelhante ao embriológicas vasculogenesis3,4,5. Clássico vascular fator de crescimento endotelial (VEGF)-mediada angiogênese que originou o endotélio vascular e que é impulsionado pela perda da BVS da função resultou na proliferação e formação neovascular, que tem sido desafiado a6. Em 1965, Cancilla e Zimmerman encontrado, usando microscopia eletrônica, que HBs originaram-se o endotélio7. Mais tarde verificou-se que as células do estroma são derivadas de vasoformative elemento8. Em 1982, Jurco et al . encontraram que as células do estroma são de origem endotelial9. Portanto, formulamos a hipótese que vascular em células endoteliais humanas é as células originais do HB-neovascularização10. Embora seja melhor usar as culturas primárias de HB células derivadas de cirurgias pacientes BVS, nossa pesquisa anterior indicou que culturas primárias de HB não são estáveis, e linhas de célula não podem ser estabelecida3. Além disso, as culturas primárias no ambiente 3D não conseguiu identificar a origem citológica do HB-neovascularização porque eles incluem os progenitores de HB-vascular ingredientes10,11. Portanto, como um modelo primitivo e clássico das células endoteliais, células endoteliais vasculares humanas (HUVEC) poderiam servir como um modelo alternativo de celular para HBs.

O ensaio de germinação esferoide é um novo modelo em tecido engenharia12,13. Neste trabalho, um 3D baseados em colágeno coculture sistema em vitro usando o spheroid brotando do ensaio foi desenvolvido, com um objectivo global para avaliar se a vasculogênese clássico existe em HBs, bem como seu papel na HBs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Esse método foi realizado em conformidade com as directrizes aprovadas e regulamentos da investigação ética Comissão de Huashan Hospital, Universidade de Fudan. Medidas de segurança padrão correspondente foram seguidas em cada etapa. Para uma apresentação esquemática, por favor consulte a Figura 1.

1. celular cultura e construção do plasmídeo

  1. Rotineiramente, manter a veia umbilical humana endothelial da pilha (HUVEC) no Dulbecco modificada do suplementado Eagle (DMEM) com 10% de soro fetal bovino (FBS), 100 unidades/mL de penicilina e 100 µ g/mL de estreptomicina em um 5% umidificado incubadora de CO2 a 37 ° C.
  2. PLKO.1 Digest plasmídeo com ApaI e EcoRI para a síntese do fragmento de shRNA. Certifique-se de que a sequência do oligonucleotide do vetor de shRNA BVS é CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.
  3. Em seguida, misture 20 sistema µΜ com frente 5 µ l de oligo, 5 µ l de oligo reverso, 5 µ l de 10x buffer de NEB e 35 µ l de DDQ2O junto (o volume total é de 50 µ l). Aqueça a mistura a 98 ° C durante 4 min e lentamente a frio até à temperatura em poucas horas.
  4. Ligam os oligos recozidos e plasmídeo PLKO.1 juntamente com T4 ligase a 4 ° C para a noite. 16 h depois, adicione 5 µ l do mix de ligadura em 25 µ l competente DH5α as células. Em seguida, tela os plasmideos com êxito ligados e verifique se o fragmento inserido por sequenciamento.

2. infecção e pacote de lentivirus

  1. No total, misture 10 µ g do vetor PLKO.1-shVHL ou PLKO.1-shScramble, 7,5 µ g do plasmídeo psPAX2 de embalagem e 2,5 µ g do envelope do plasmídeo pMD2.G em 500 µ l da mídia DMEM sem soro fetal bovino (FBS) por 25 min.
  2. Adicione 7 mLDMEM sem FBS a solução preparada acima.
  3. Células de cultura 293FT no DMEM sem FBS em um pratos de cultura de tecido de 10 cm de diâmetro. Certifique-se de que o número de células de 293FT é 1 x 107 usando um contador de célula.
  4. Adicione 1 mL da solução preparada acima para o meio das células de 293FT para transfeccao.
    Nota: A linha de celular 293FT é derivado da linhagem de células 293F e estàvel expressar o antígeno de T grande SV40. Portanto, é um hospedeiro adequado para a produção de Lentivirus.
  5. Substituir o meio de cultura com o DMEM contendo 10% FBS após 6 h.
  6. Recolha a mídia usando uma pipeta em 48 h depois do transfection.
    Nota: O vírus existe no DMEM contendo 10% FBS. O flutuador de células mortas no meio. Use estéril membrana de 0,45 µm para filtrar as células mortas e impurezas. Geralmente, não há nenhuma necessidade de verificar a multiplicidade de infecção (MOI). Isto é para estabelecer uma linha de células estáveis. Na última etapa, todas as células vivas sem infecção bem sucedida morrerá por puromicina. O grupo shScramble e células HUVEC são um grupo de controle. Certifique-se de que todas as células HUVEC morrercom com a concentração de puromicina usado por 72 h. Cada poço tem o mesmo número de células.
  7. Cultura de células HUVEC na mídia lentivirus para 72 h. Em seguida, adicione a puromicina aos meios de comunicação das células HUVEC na concentração de 2 µ g/mL para células de uso HUVEC 24 h. sem qualquer tratamento, como o grupo de controle. Certifique-se de que todos controlam células morrem por esta altura.
    Nota: As células vivas representam uma linha de celular estável da BVS "knockdown" células e células shSramble. A densidade do chapeamento é 5.000/bem em placas de 96 poços.

3. geração de células endoteliais esferoides

  1. Trypsinize as células de HX e Resuspenda em meio DMEM com 10% FBS. Com um número moderado de células numa placa de cultura de 10 cm, adicione 1 mL de EDTA-typsin.
  2. As células em uma placa de 96 poços de fundo redondo 3D, em uma densidade de células de 1 × 103 células/poço da semente. Use um bem que pode acomodar um esferoide de 0,50 µ l para suspender o spheroid. Contar as células usando um sistema de contador de células seguindo as instruções do fabricante.
  3. Incube as células a 37 ° C e 5% CO2 continuamente por 72 h. Nestas condições, certifique-se de que a suspensão de células formam os esferoides de célula automaticamente. Substitua metade do meio de cultura após 36 h.

4. ensaio de angiogênese in vitro

  1. Descongelar a solução de gel a 4 ° C e dilui-lo com o meio de soro reduzido a uma proporção de diluição de 1:5.
  2. Chupe os esferoides DMEM meio de cultura com uma micropipeta. Depois de lavar os esferoides com 5 mL de meio de soro reduzida, suspenda os esferoides suavemente e cautelosamente no gel diluído. Certifique-se de que não há nenhuma bolha de ar.
  3. Incorpore a 300 µ l de líquido misturado em uma placa de 15. Após incubação a 37 ° C e 5% de CO2 para 1 h, adicione 400 µ l de meio de soro reduzida a cada poço. Encha de água estéril em torno dos poços para gerar um ambiente umidificado para impedir a evaporação.
  4. Depois disso, cultura a placa a 37 ° C em 5% CO2 em 100% de umidade por 1h.
  5. Cuidadosamente, Aspire o meio velho e substituí-lo por 600 µ l de meio de soro reduzida com suplementos de crescimento de células endoteliais de 1% em cada poço.
  6. Depois de 12h ou 24h, tirar fotos sob um microscópio invertido (40 *).

5. análise de dados

  1. Carregar as imagens para uma plataforma de análise de imagem on-line para obter dados de comprimento de broto (Tabela de materiais).
  2. Na página da Web, crie uma conta por e-mail.
  3. Em seguida, carregar as imagens, clicando no botão upload.
  4. Baixe o resultado clicando no botão de download.
    Nota: O software irá gerar a imagem processada e os dados. Os dados contêm cinco partes: broto cumulativa comprimento, comprimento do broto média, o desvio-padrão de comprimento do broto, broto área e área de esferoide. Na imagem processada, cada parâmetro é descrito em uma cor diferente para facilitar a identificação da imagem processada: vermelha representa sprouts esqueleto, amarelo com o número de brotos, azul a estrutura broto, broto branco final e esferoide laranja.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Imagens originais são tomadas pelo microscópio invertido. As imagens típicas do grupo controle e o grupo BVS são mostradas na Figura 2-A1 e Figura 2-A2. O comprimento de germinação do grupo controle é mais curto que a do grupo BVS.

Depois de carregar as imagens, a plataforma on-line fornece resultados de análise diretamente. A saída consiste em duas partes: a imagem processada e os resultados de análise correspondente. As imagens processadas do grupo controle e grupo de silêncio BVS gene são marcadas com cores diferentes (Figura 2-A3 e Figura 2-A4). O comprimento do broto média é 65 µm e 125 µm em grupo controle e o grupo de silêncio da BVS, respectivamente, e o comprimento médio cumulativo broto é 680 µm e 1250 µm, no grupo controle e o grupo de silêncio da BVS, respectivamente, indicando que brotam aumenta de comprimento por aproximadamente duas dobras no grupo BVS de silêncio, em comparação com o grupo controle (Figura 2B). Estes resultados indicam que a deficiência de BVS promove a capacidade de formação de navio de células endoteliais humanas.

Figure 1
Figura 1 . O esquema para o spheroid brotando ensaio. Passos 1 mostra células HUVEC cultivadas um prato. Em 2 etapas, células HUVEC são movidas para 3D placas de 96 poços de fundo redondo para 72 h. 3 passos mostra a forma de células HUVEC esferoides de célula endotelial automaticamente a placa 3D. Em 4 etapas, adicione esferoide celular ao gel diluído. Em 5 passos, adicione a mistura preparada acima para uma placa de 15. As etapas 6 mostra esferoide brotando na placa de 15. As etapas de 7 mostram a imagem de germinação sob um microscópio invertido. Etapas 8 mostra a imagem e o passo 9 é a imagem de saída da plataforma (barra = 100 µm). Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 . O efeito da BVS silenciamento sobre a capacidade de angiogênico das células HUVEC o spheroid brotando do ensaio. (A) imagens representativas da consequência de bico após 12 h no controle (A1) e esferoides HUVEC BVS-silenciado (A2) (barra = 100 µm). Figuras A3 e A4 mostram as imagens analisadas pela plataforma para figuras A1 e A2, respectivamente. Esqueleto de couve vermelha representa, amarelo com o número de brotos, azul a estrutura broto, broto branco final e esferoide laranja. (B) comprimento dos brotos. Análise estatística foi realizada utilizando o teste t de Student não pareado. * representam P < 0,05. CON, controle; HUVEC, célula endotelial de veia umbilical humana. Clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Recentemente, vários campos de pesquisa da biologia vascular foram estimulados pelo estudo do endotélio angiogênico15. Neste artigo, nós desenvolvemos um esferoide endotelial brotando técnica como modelo experimental para estudar a formação de vasos que se origina a perda do gene da BVS da função nas células endoteliais manipuladas para identificar moléculas candidato romance do angiogênico cascata. O melhor de nosso conhecimento, este é o primeiro relatório para examinar os efeitos de angiogênico das células endoteliais serem modificados.

Neovascularização do tecido (incluindo o tecido do tumor) é um processo complexo que ocorre através de mecanismos angiogênico e vasculogenic durante o desenvolvimento, bem como em ambas as condições fisiológicas e patológicas12,15 , 16. o spheroid brotando do ensaio é caracterizado por uma complexa cascata de eventos17,18, incluindo a auto-agregação das células endoteliais, que são incorporados em um sistema de cultura matriz 3D celular, que resulta em brotação e a reprodução da rede 3D de capilares19. Este modelo 3D incorporado no gel de esferoide tornou-se um sistema amplamente utilizado na engenharia de tecidos para estudar a formação vascular e seus mecanismos devido a sua capacidade de fornecer um ambiente melhor imitando uma matriz adequada. No entanto, a etapa mais crucial deste processo biológico é a ativação de células endoteliais quiescente17,20,21,22. Neste procedimento, as células endoteliais foram activadas pelo endogênicos silenciamento do gene da BVS, um gene de crescimento regulador de neovessels23,24. Diferente do endotélio clássico iniciação através de indução exógena de matrix e o ambiente extracelular correspondente (incluindo vasculares crescimento fatores exógenos), este método modificado pode ser estendido para numerosos aplicações para desvendar endogênicos mecanismos genéticos. Em seguida, para diminuir os efeitos da matriz exógeno, o protocolo foi otimizado diluindo o gel, que foi um passo simples no experimento. Além disso, levou apenas minutos para fazer upload de imagens para a plataforma e obter resultados de análises. A plataforma fornece um serviço de análise de imagem que permite que o experimentador tornar-se um objetivo, análise de imagem comparável e automatizado de brotação ensaio imagens on-line. Portanto, o protocolo supera erros de medição e cálculo causados por fatores artificiais.

A compreensão mecanicista dos passos individuais da neovascularização cascata forneceu uma base racional para o desenvolvimento do tratamento anti-vascular que está atualmente sendo aprovado para aplicação clínica em Oncologia. Este livro estabeleceu um modelo simples e robusto baseado em esferoide ensaio para estudar a formação de vasos que se origina de células endoteliais manipuladas com perda da função do gene para identificar moléculas de novo candidato para a neovascularização da BVS cascata, que pode ser utilizada para inúmeras aplicações relacionados a angiogênese e vasculogenesis. Os autores especulam que este modelo in vitro pode fornecer informações adicionais para ajudar a avaliar o papel da angiogênese em alguns tumores sólidos (por exemplo, mimetismo de vasculogenic de tumor) e investigar o papel potencial de outras células progenitoras possível para gerar tumor neovessels na vivo, particularmente em pacientes com tumores que, como um grupo, não respondem ao tratamento com agentes antiangiogênico apenas.

O ensaio de germinação de esferoide tornou-se um método amplamente usado para estudar a angiogênese e mecanismos relacionados. O ensaio tem uma vantagem importante, fornecendo um ambiente de imitar melhor do que as culturas 2D clássicas. Recentemente, foram desenvolvidos modelos 3D co-cultura para estudar vasculogênese que imita a heterogeneidade e a complexidade da angiogênese dentro do tumor microambiente25. Neste modelo, as células endoteliais são cultivadas diretamente com células de câncer, bem como um componente do estroma em um ambiente 3D. Além disso, 3D em vitro sistemas de cultura foram mostrados para refletir com mais precisão a resposta na vivo para agentes terapêuticos do que sistemas de cultura de células convencional. Além disso, este método é usado para a diferenciação das células-tronco embrionárias, crescimento do tecido, cicatrização de feridas, isquemia e inflamação. Comparado com o método clássico, nossa abordagem é eficaz e fácil de implementar. Acreditamos que é uma ferramenta útil para o estudo da angiogênese em vitro, e abre uma nova forma de entender melhor esse processo.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Este trabalho foi financiado por doações da Xangai, Comitê de ciência e tecnologia (15411951800, 15410723200). Os autores desejam agradecer a Prof YuMei Wen e Prof Chao Zhao da Universidade para sua assistência técnica departamento de microorganismo patogênicos de Fudan.

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
Um procedimento abrangente para avaliar o desempenho <em>In Vitro</em> da neovascularização de Hemangioblastoma putativo usando o Spheroid brotando do ensaio
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter