Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

Ett omfattande förfarande för att utvärdera In Vitro den förmodade hemangioblastom kärlnybildning använder den sfäroid groning Assay

doi: 10.3791/57183 Published: April 12, 2018

Summary

Detta dokument presenterar ett omfattande förfarande för att utvärdera i vitro om klassiska tumör angiogenes finns i hemangioblastomas (HBs) och dess roll i HBs. Resultaten belysa komplexiteten i HB-kärlnybildning och tyder på att denna vanliga form av angiogenes är endast en kompletterande mekanism i den HB-kärlnybildning.

Abstract

Inaktivering av von Hippel-Lindau (VHL) tumör suppressor genen spelar en avgörande roll i utvecklingen av hemangioblastomas (HBs) inom människans centrala nervsystem (CNS). Men både cytologiska ursprung och den evolutionära processen av HBs (inklusive kärlnybildning) förblir kontroversiell och anti-angiogenes för VHL-HBs, baserat på klassiska HB angiogenes, givit nedslående resultat i kliniska prövningar. Ett stort hinder för framgångsrik klinisk översättningen av anti vaskulär behandling är bristen på en grundlig förståelse av kärlnybildning i denna vaskulär tumör. I denna artikel presenterar vi ett omfattande förfarande för att utvärdera i vitro om klassiska tumör angiogenes finns i HBs, liksom dess roll i HBs. Med den här proceduren kan forskarna exakt förstå komplexiteten i HB kärlnybildning och identifiera funktionen av denna vanliga form av angiogenes i HBs. Dessa protokoll kan användas för att utvärdera de mest lovande anti vaskulär terapi för tumörer, som har hög translationell potential för tumörer behandling eller för medhjälp i optimering av anti-angiogena behandling för HBs i framtida översättningar. Resultaten belysa komplexiteten i HB kärlnybildning och tyder på att denna vanliga form angiogenes är endast en kompletterande mekanism i HB kärlnybildning.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hemangioblastomas (HBs) är godartade vaskulär tumörer som finns uteslutande inom det mänskliga centrala nervsystemet (CNS). De utvecklas hos patienter med von Hippel-Lindau (VHL) sjukdom eller sporadiska lesioner. VHL-HBs är svåra att bota genom kirurgisk behandling på grund av den täta återfall och multipla lesioner som resulterar från denna genetiska sjukdom1. Även om inaktivering av VHL tumör suppressor genen har ansetts vara grundorsaken till uppkomst av VHL-HBs, fortfarande cytologiska ursprung (inklusive kärlnybildning) och evolutionär process av HBs till stor del kontroversiella2. En bättre förståelse av HB-neovaskulär biologiska mekanismer kan därför innehålla nyttiga insikter i de mest lovande anti vaskulär strategierna VHL-HBs.

Nyare forskning har föreslagit att HB-kärlnybildning är liknande till den embryologiska vasculogenesis3,4,5. Klassiska vaskulär endotelial tillväxtfaktor (VEGF)-medierad angiogenes som härstammar från den vaskulära endotelet och som drivs av VHL funktionsförlust resulterade i spridning och neovaskulär-formationen, vilken har varit utmanas6. I 1965, Cancilla och Zimmerman hittade, med hjälp av elektronmikroskopi, som HBs härstammar från endotelet7. Det konstaterades senare att stromaceller härleds från vasoformative element8. 1982 fann Jurco et al. att stromaceller är av endothelial ursprung9. Därför hypotesen vi att mänskliga vaskulära endotelceller är de ursprungliga cellerna av HB-kärlnybildning10. Även om det är bättre att använda de primära kulturerna från HB celler från VHL patienten operationer, visade vår tidigare forskning att primära kulturer från HB inte är stabila, och cellinjer kunde inte vara etablerade3. Dessutom kunde de primära kulturerna i 3D-miljö inte identifiera HB-kärlnybildning cytologiska ursprung eftersom de innehåller föräldraparets HB-vaskulär ingredienser10,11. Därför, som en primitiv och klassisk modell av endotelceller, kan mänskliga vaskulära endotelceller (HUVEC) fungera som en alternativ cellular-modell för HBs.

Sfäroid groning analysen är en ny modell i tissue engineering12,13. I detta papper utvecklades en 3D kollagenbaserade coculture system i vitro med den sfäroid groning analys, med ett övergripande mål att utvärdera om klassiska tumör angiogenes finns i HBs, liksom dess roll i HBs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Denna metod utfördes enligt de godkända riktlinjerna forskning etiska kommittén av Huashan Hospital, Fudan University. Motsvarande standard säkerhetsåtgärder följdes i varje steg. För en schematisk presentation, se figur 1.

1. cell kultur och Plasmid-konstruktion

  1. Rutinmässigt underhåll den mänskliga navel ven endothelial cellen (HUVEC) i Dulbecco ändrade örnens medium (DMEM) kompletteras med 10% fetalt bovint serum (FBS), 100 enheter/mL av penicillin och 100 µg/mL streptomycin i en fuktad 5% CO2 inkubator vid 37 ° C.
  2. Smälta PLKO.1 plasmid med ApaI och mina för syntesen av shRNA fragment. Se till att oligonukleotiden sekvensen av VHL shRNA vektor CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.
  3. Blanda sedan, 20 µΜ system med framåt 5 µL oligo, 5 µL omvänd oligo, 5 µL 10 x NEB buffert och 35 µL av ddH2O grupp (den totala volymen är 50 µL). Värm blandningen på 98 ° C i 4 min, och långsamt svalna till rumstemperatur i ett par timmar.
  4. Ligera av glödgad oligos och PLKO.1 plasmid tillsammans med T4 ligase vid 4 ° C för övernattning. 16 h senare, tillsätt 5 µL av ligering mix i 25 µL behöriga DH5α celler. Sedan skärmen de framgångsrikt ligated plasmidsna och verifierar den Infoga fragmenten av sekvensering.

2. lentivirus paketet och infektion

  1. Totalt, blanda 10 µg av PLKO.1-shVHL eller PLKO.1-shScramble vector, 7,5 µg av packning plasmiden psPAX2 och 2,5 µg av kuvert plasmiden pMD2.G i 500 µL DMEM medierna utan fetalt bovint serum (FBS) i 25 min.
  2. Lägger till 7 mLDMEM utan FBS i lösningen som förberetts enligt ovan.
  3. Kultur 293FT celler i DMEM utan FBS i en 10-cm diameter vävnadsodling rätter. Se till att antalet celler som 293FT 1 x 107 använder en cell räknare.
  4. Tillsätt 1 mL av den lösning som beretts ovan till medlet av 293FT celler för transfection.
    Obs: 293FT cell linjen härrör från raden 293F cellen och express stabilt SV40 stora T antigenet. Därför är det en lämplig värd för lentiviral produktion.
  5. Ersätta odlingssubstratet med den DMEM innehållande 10% FBS efter 6 h.
  6. Samla media med pipett på 48 h efter transfection.
    Obs: Viruset finns i den DMEM innehållande 10% FBS. Döda celler flyta på mediet. Använda 0,45 µm sterilt membran för att filtrera de döda hudceller och orenheter. I allmänhet finns det ingen anledning att kontrollera multiplicity av infektion (MOI). Detta är att upprätta en stabil celler linje. På det sista steget, kommer att alla levande celler utan framgångsrika infektion dö av puromycin. Den shScramble gruppen och HUVEC celler är kontrollgruppen. Se till att alla HUVEC celler dö med begagnade puromycin koncentrationen av 72 h. Varje brunn har samma antal celler.
  7. Kultur de HUVEC cellerna i lentiviral media för 72 h. Lägg sedan till puromycin till media av HUVEC celler vid en koncentration av 2 µg/mL för 24 h. användning HUVEC celler utan någon behandling som kontrollgruppen. Säkerställa att alla kontrollerar celler dör vid denna tid.
    Obs: De levande cellerna utgör en stabil cellinje av VHL knockdown och shSramble celler. Plätering densiteten är 5.000 per brunn i 96 brunnar.

3. generation av endotelceller Spheroids

  1. Trypsinize HUVECs celler och resuspendera DMEM medium med 10% FBS. Med ett måttligt antal celler i en 10-cm kultur skål, tillsätt 1 mL typsin-EDTA.
  2. Kärna ur cellerna i en 3D runda-botten plattan med 96 brunnar, på en cell densiteten av 1 × 103 celler per brunn. Använd en brunn som kan rymma en sfäroid på 0.50 µL att upphäva sfäroid. Räkna celler som använder en cell counter system efter tillverkarens anvisningar.
  3. Inkubera cellerna vid 37 ° C och 5% CO2 kontinuerligt i 72 h. Se till att de suspenderade cellerna bildar de cell spheroids automatiskt under dessa förhållanden. Byta ut hälften av odlingssubstratet efter 36 h.

4. in vitro angiogenes Assay

  1. Tina gellösningen vid 4 ° C och späd med reducerad serum mediet vid en utspädningsfaktor på 1:5.
  2. Suga spheroids från DMEM odlingssubstratet med en mikropipett. Efter tvätt upphäva spheroids med 5 mL minskade serum medium, spheroids varsamt och försiktigt i utspädda gel. Se till att det inte finns några luftbubblor.
  3. Bädda in 300 µL av blandad vätska i en 15-bra platta. Efter inkubation vid 37 ° C och 5% CO2 för 1 h, tillsätt 400 µL minskade serum mediet till varje brunn. Fyll sterilt vatten runt brunnarna att generera en fuktad miljö för att hindra avdunstning.
  4. Därefter kultur plattan vid 37 ° C i 5% CO2 på 100% luftfuktighet för 1 h.
  5. Noggrant aspirera gamla medium och ersätta det med 600 µL av minskade serum medium med 1% endotelceller tillväxt kosttillskott i varje brunn.
  6. Efter 12 h eller 24 h, ta bilder under en inverterat ljusmikroskop (40 *).

5. dataanalys

  1. Ladda upp bilderna till en online bild analysplattform att erhålla sprout längd data (Tabell för material).
  2. På webbsidan för att skapa ett konto via e-post.
  3. Sedan ladda upp bilder genom att klicka på upload-knappen.
  4. Hämta resultatet genom att klicka på knappen Hämta.
    Obs: Programvaran genererar den bearbetade bilden och data. Materialet omfattar fem delar: Kumulativ sprout längd, genomsnittlig sprout längd, standardavvikelsen för spira längd, sprout område och sfäroid område. I den bearbetade bilden, varje parameter beskrivs i en annan färg att underlätta identifiering i den bearbetade bilden: rött representerar groddar skelett, gul antalet groddar, blå sprout strukturen, vit sprout slutet och orange sfäroid.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ursprungliga bilder är tagna av inverterat ljusmikroskop. De typiska bilderna i kontrollgruppen och gruppen VHL visas i figur 2-A1 och figur 2-A2. Kontrollgruppen groning längd är kortare än för gruppen VHL.

Efter uppladdning bilder, ger online plattform resultat direkt. Produktionen består av två delar: den bearbetade bilden och de motsvarande analysresultat. De bearbetade bilderna i kontrollgruppen och gruppen VHL-genen tystnad är markerade med olika färger (figur 2-A3 och figur 2-A4). Genomsnittlig sprout längden är 65 µm respektive 125 µm i kontrollgruppen och gruppen VHL tystnad och genomsnittliga kumulativa sprout längd är 680 µm och 1250 µm i kontrollgruppen och gruppen VHL tystnad, respektive, som anger att spira längd ökar med cirka två veck i gruppen VHL tystnad, jämfört med kontrollgruppen (figur 2B). Dessa resultat indikerar att VHL-brist främjar mänskliga endothelial celler fartyget-bilda förmåga.

Figure 1
Figur 1 . Schemat för den sfäroid groning assay. Steg 1 visar HUVEC celler odlade en maträtt. I steg 2 flyttas HUVEC celler till 3D runda-96 brunnar bottenplåtar för 72 h. steg 3 visar formuläret HUVEC celler endotelceller spheroids automatiskt i 3D plattan. I steg 4, lägga till cell sfäroid utspädda gel. I steg 5, tillsätt blandningen beredd enligt ovan till en 15-bra platta. Steg 6 visar sfäroid groning i 15-väl plattan. Steg 7 visar den spirande bild tagen under ett inverterat ljusmikroskop. Steg 8 visar den uppladdade bilden och steg 9 är bild från plattformen (bar = 100 µm). Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 . Effekten av VHL nedtystning på angiogena förmågan av HUVEC celler i den sfäroid groning assay. (A) representativa bilder av pipen utväxt efter 12 h i kontroll (A1) och VHL-tystas HUVEC spheroids (A2) (bar = 100 µm). Visar bilderna analyseras av plattformen för siffror A1 och A2 respektive siffror A3 och A4. Rött representerar groddar skelett, gul antalet groddar, blå sprout strukturen, vit sprout slutet och orange sfäroid. ()B) längd av groddarna. Statistisk analys utfördes med hjälp av oparade Students t-test. * representerar P < 0,05. CON, kontroll; HUVEC, mänskliga navel ven endotelceller. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nyligen har stimuleras flera fält av vaskulär biologi forskning av studien av angiogena endotel15. I denna artikel, vi utvecklat en endothelial sfäroid groning teknik som en experimentell modell att studera fartyget bildningen som påbörjar från den VHL-genen förlust av funktion i manipulerade endotelceller att identifiera nya kandidat molekyler av den angiogena cascade. Till bäst av vår kunskap är detta den första rapporten att undersöka angiogena effekterna av endogena modifierade endotelceller.

Vävnad (inklusive tumörvävnad) kärlnybildning är en komplex process som sker via angiogena och vasculogenic mekanismer under utveckling, samt i både fysiologiska och patologiska förhållanden12,15 , 16. den sfäroid groning assay kännetecknas av en komplex kaskad av händelser17,18, inklusive själv aggregering av endotelceller som är inbäddade i en 3D matrix cellodlingssystem, vilket resulterar i groning och reproduktionen av det 3D nätverket av kapillärer19. Denna 3D gel-embedded sfäroid modell har blivit ett allmänt använt system i vävnadsteknik för att studera vaskulär bildandet och dess mekanismer på grund av dess förmåga att ge en bättre symtom liknande miljö i en lämplig matris. Dock är det mest avgörande steget i denna biologiska process aktiveringen av quiescent endotelceller17,20,21,22. I den här proceduren aktiverades endotelceller av den endogena ljuddämpning av VHL-genen, en regulator tillväxt gen kärlnybildning23,24. Skiljer sig från den klassiska endotel inledande via exogena induktion av matrisen och motsvarande extracellulära miljön (inklusive exogena vaskulär tillväxt faktorer), modifierade metoden kan förlängas till många program nysta endogena genetiska mekanismer. Nästa, för att minska effekterna av exogena matrisen, protokollet har optimerats genom att späda ut gelen, som var en enkel steg i experimentet. Dessutom tog det bara minuter att ladda upp bilder till plattformen och erhålla analysresultat. Plattformen innehåller en bild analys som gör försöksledaren att göra en objektiv, jämförbar och automatiserad bildanalys skottillväxt assay bilder online. Därför övervinner protokollet mätning och beräkning fel som orsakas av konstgjorda faktorer.

Mekanistisk förståelse för de enskilda stegen i kärlnybildning kaskad föreskrivs en rationell grund för utvecklingen av den anti vaskulär behandling som för närvarande är de godkänns för klinisk tillämpning i onkologi. Detta papper etablerat en enkel och robust sfäroid-baserad analys modell för att studera bildandet av blodkärl som härstammar från manipulerade endotelceller med förlust av funktion av VHL -genen att identifiera nya kandidat molekyler för kärlnybildning Cascade, som kan utnyttjas för ett flertal angiogenes - och vasculogenesis-relaterade program. Författarna spekulerar i att denna in vitro- modell skulle kunna ge ytterligare information för att utvärdera rollen av angiogenes i några solida tumörer (t.ex. tumör vasculogenic mimikry) och undersöka de potentiella rollerna av andra möjliga stamceller att generera tumör kärlnybildning i vivo, särskilt hos patienter med tumörer som, som grupp, svarar inte på behandling med anti-angiogena agenter endast.

Sfäroid groning analysen har blivit en allmänt använd metod att studera angiogenes och relaterade mekanismer. Analysen har en viktig fördel genom att tillhandahålla en bättre härma miljö än de klassiska 2D kulturerna. Nyligen, 3D samtidig kultur modeller har utvecklats för att studera tumör angiogenes som efterliknar heterogenitet och komplexiteten av angiogenes inom de tumör mikromiljö25. I den här modellen odlas endothelial celler direkt med cancerceller, liksom en stromal komponent i en 3D-miljö. 3D i vitro kultur system har dessutom visat att reflektera mer exakt svar i vivo terapeutiska medel än konventionella cell kultur system. Dessutom, används denna metod för differentiering av embryonala stamceller, vävnadstillväxt, sårläkning, ischemi och inflammation. Vår strategi jämfört med den klassiska metoden, och är effektiv och lätt att genomföra. Vi tror det är ett användbart verktyg för studiet av angiogenes i vitro, och det öppnar ett nytt sätt att förstå denna process bättre.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Detta arbete stöds av bidrag från Shanghai kommittén för vetenskap och teknik (15411951800, 15410723200). Författarna vill tacka Prof. YuMei Wen och Prof. Chao Zhao av patogen mikroorganism institutionen Fudan universitetet för sin tekniskt bistånd.

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
Ett omfattande förfarande för att utvärdera <em>In Vitro</em> den förmodade hemangioblastom kärlnybildning använder den sfäroid groning Assay
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter