Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

Identificare i siti di fattore di trascrizione Olig2 associazione genomico in acutamente purificato PDGFRα + cellule di immunoprecipitazione della cromatina Low-cella ordinamento dell'analisi

Published: April 16, 2018 doi: 10.3791/57547

Summary

Qui presentiamo un protocollo che è stato progettato per analizzare l'associazione genoma del fattore di trascrizione del oligodendrocyte 2 (Olig2) in cellule del precursore del oligodendrocyte cervello acutamente purificato (OPCs) eseguendo immunoprecipitazione della cromatina basso-cella (ChIP) , libreria preparazione, high throughput sequenziamento e analisi bioinformatica dei dati.

Abstract

In cellule di mammifero, trascrizione genica è disciplinata in modo specifico di cella tipo le interazioni dei fattori trascrizionali con DNA genomico. Fattori di trascrizione Lineage-specifici sono considerati svolgono un ruolo essenziale nella specifica delle cellule e differenziazione durante lo sviluppo. ChIP accoppiato con sequenziamento del DNA di alto-rendimento (ChIP-seq) è ampiamente usato per analizzare i siti di legame del genoma di fattori di trascrizione (o suo complesso associato) di DNA genomico. Tuttavia, un numero elevato di celle è necessario per una reazione di ChIP standard, che lo rende difficile da studiare il numero limitato di cellule primarie isolate o popolazioni di cellule rare. Al fine di comprendere il meccanismo di regolazione di trascrizione lineage-specifici del oligodendrocyte fattore Olig2 nel topo acutamente purificata OPCs, un metodo dettagliato utilizzando ChIP-seq per identificare i siti di legame del genoma di Olig2 (o Olig2 complesso) viene visualizzato. In primo luogo, il protocollo spiega come purificare l'alfa del ricevitore di fattore di crescita derivato dalle piastrine (PDGFRα) positivo OPCs da cervelli di topo. Successivamente, Olig2 anticorpo mediato ChIP e la costruzione della libreria vengono eseguite. L'ultima parte viene descritto il software bioinformatico e procedure utilizzate per l'analisi di Olig2 ChIP-seq. In sintesi, questa carta segnala un metodo per analizzare le associazioni di genoma del fattore trascrizionale Olig2 nel cervello acutamente purificato OPCs.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

È importante studiare la proteina (o complesso proteico) DNA binding e i segni epigenetici per costruire reti di regolazione trascrizionale coinvolti nei vari processi biologici. In particolare, le associazioni di fattori di trascrizione da DNA genomic possono giocare un ruolo importante nella regolazione genica, la differenziazione cellulare e lo sviluppo del tessuto. Un potente strumento per lo studio della regolazione trascrizionale e meccanismi epigenetici è immunoprecipitazione della cromatina (ChIP). A causa dei rapidi progressi nella tecnologia di sequenziamento di nuova generazione, ChIP accoppiato con sequenziamento del DNA di alto-rendimento (ChIP-seq) viene utilizzato per le analisi di binding proteina-DNA e segni epigenetici1. Tuttavia, un protocollo standard di ChIP-seq richiede circa 20 milioni di cellule per reazione, il che rende difficile l'applicazione di questa tecnica quando il numero di cellulare è limitato, come cellule primarie isolate e popolazioni di cellule rare.

Del oligodendrocyte lignaggio cellule compreso le cellule del precursore del oligodendrocyte (OPCs) ed i oligodendrocytes sono ampiamente distribuite in tutto il cervello e sono essenziali per lo sviluppo e la funzione del cervello. Come un tipo delle cellule del precursore, OPCs sono capaci di auto-rinnovamento e di differenziazione. Gli OPC non solo servono come progenitori per gli oligodendrociti ma anche svolgono un ruolo importante nella propagazione della segnalazione di un neurone comunicando con altri tipi di cellule di cervello2. Studi precedenti hanno suggerito che lo sviluppo del oligodendrocyte è regolato da fattori di trascrizione lineage-specifici come Olig2 e Sox103,4. Questi fattori di trascrizione sono stati trovati da associare alle regioni promotore o enhancer di alcuni geni cruciali per influenzare la loro espressione durante del oligodendrocyte specificazione e differenziamento. Tuttavia, è difficile da identificare il grippaggio del DNA della proteina (o complesso proteico) di interesse in OPCs acutamente purificata primario con un numero molto limitato di cellule.

Questo protocollo viene descritto come analizzare sistematicamente l'immunoprecipitato DNA genomico di Olig2 in OPCs purificata del mouse a scala di genoma utilizzando la tecnica di ChIP-seq. OPCs da cervelli di topo erano acutamente purificato mediante immunopanning e utilizzati in un esperimento di ChIP senza proliferazione in vitro. Un numero limitato di OPCs può essere ottenuto da immunopanning e non è sufficiente per gli esperimenti di ChIP-seq standard. Nel presente accordo, un protocollo di ChIP-seq cella di basso con basso quanto 20 mila cellule per reazione di ChIP per fattori di trascrizione è descritto. In breve, reticolate cellule sono state lisate e sonicate da un dispositivo di sonicazione per tosare la cromatina. La cromatina tosata è stata incubata con Olig2 anticorpo come pure proteina perline rivestite con A per precipitare il DNA genomic di Olig2 anticorpo associato. Dopo eluizione da proteina A-rivestito perline e cross-linking inversa, DNA genomic precipitato da Olig2 anticorpo è stato purificato mediante estrazione con fenolo-cloroformio. Il prodotto risultante è stato quantificato e sottoposti a T-tailing, primer modello di commutazione e di estensione, l'aggiunta di schede e amplificazione, selezione dimensione raccolta e purificazione di ricottura passi per la costruzione della libreria ChIP-seq.

Dopo la sequenziazione, è stata analizzata la qualità del crudi si legge da sia il campione preparato con anticorpo di fattore di trascrizione Olig2 e il campione di controllo. Coppie di basi di bassa qualità e adattatore contenente leggere frammenti sono stati tagliati. Successiva, profilate letture sono state allineate al genoma di riferimento del mouse. Le regioni genomiche che significativamente sono state arricchite per letture di ChIP, rispetto al campione di controllo, sono state rilevate come picchi. Picchi significativi, che rappresentano potenziali siti di legame del fattore di trascrizione, sono stati filtrati e visualizzati in un browser del genoma.

In particolare, il metodo descritto in questo protocollo può essere utilizzato ampiamente per ChIP-seq di altri fattori di trascrizione con qualsiasi tipo di cellula di un numero limitato.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tutti i uso animale e protocolli sperimentali erano eseguiti in conformità con la guida per la cura e l'uso di animali da laboratorio e approvati dal Comitato istituzionale biosicurezza e Animal Welfare Committee presso la University of Texas Health Science Center at Houston.

1. purificazione di cellule Lineage Oligodendrocyte PDGFRα Positive dal cervello di topo (modificato dal immunopanning precedentemente descritti protocolli5,6,7)

  1. Preparazione di un piatto di immunopanning per la selezione positiva delle cellule PDGFRα e 2 piastre per lo svuotamento delle cellule endoteliali e microglia.
    Nota: Si prega di notare che di Petri ma piastre di coltura delle cellule non funzionano per l'esperimento di immunopanning; Se le cellule purificate verranno utilizzate per la coltura, immunopanning passi da effettuarsi nella biosicurezza
    1. Veste un 10 cm piastra di Petri con 30 µ l capra anti-ratto IgG in 10 mL di pH 9.5, 50 mM Tris-HCl durante la notte a 4 ° C. Agitare la piastra per assicurarsi che le superfici delle piastre sono uniformemente e completamente coperti dalla soluzione di rivestimento.
    2. Preparare la soluzione di anticorpo PDGFRα diluendo 40 µ l di anticorpo di topo anti-PDGFRα con 12 mL di soluzione tampone fosfato di Dulbecco (DPBS) contenente 0,2% di BSA.
    3. Dopo 3 lavaggi della piastra IgG rivestito con 10 mL 1 x DPBS ciascuno, incubare piastra IgG-rivestito con soluzione di anticorpo PDGFRα a temperatura ambiente per 4 h.
    4. Lavare la piastra di anticorpo di topo anti-PDGFRα 3 volte con 10 mL 1 x DPBS ogni. Aggiungere delicatamente DPBS soluzione lungo la parete laterale della piastra e non disturbare le superfici rivestite.
    5. Cappotto 2 nuove piastre di Petri di 15 cm per lo svuotamento delle cellule endoteliali e microglia con 20 mL di DPBS contenente 2,3 µ g/mL di Banderiaea simplicifolia lectina 1 (BSL-1) per 2 h.
    6. Lavare che il BSL-1 rivestito piastre 3 volte con 20 mL di 1 x DPBS. Aggiungere delicatamente DPBS soluzione lungo la parete laterale delle piastre e non disturbare le superfici rivestite.
  2. Purificazione di PDGFRα cellule di lignaggio del oligodendrocyte positivo viene modificato da metodi precedentemente pubblicati6 , 7 , 8.
    1. Sezionare i tessuti corticali da 2 postnatale giorno 7 (P7) del mouse cervelli secondo precedentemente protocolli pubblicati5,6.
    2. Dissociare i tessuti per generare una sospensione unicellulare con dissociazione di tessuto neurale Kit (P) secondo le istruzioni del produttore dettagliate.
    3. Brevemente, i tessuti corticali dissecati tagliate a pezzi con un bisturi e sottoporli a digestione enzimatica a 37 ° C. Dopo la digestione, manualmente dissociare i pezzi con vetro lucidati a fuoco che pipette Pasteur in sospensione unicellulare.
    4. Centrifugare la sospensione unicellulare a 300 x g per 10 min a temperatura ambiente e sospendere il pellet cellulare utilizzando 15 mL di buffer di immunopanning (immunopanning buffer è DPBS con 5 µ g/mL dell'insulina e 0,02% BSA).
    5. Incubare la sospensione unicellulare da 2 cervelli di topo in sequenza su 2 piatti di BSL-1 rivestito per 15 min a temperatura ambiente con agitazione delicata della piastra ogni 5 min per garantire un migliore svuotamento di microglia e cellule endoteliali.
    6. Agitare delicatamente la piastra per raccogliere le cellule non-aderenti in una sospensione cellulare e incubare li sul piatto di anticorpo-rivestite di ratto-PDGFRα per 45 min a temperatura ambiente.
    7. Dopo l'incubazione della sospensione delle cellule sulla piastra di anticorpo-rivestite di ratto-PDGFRα, delicatamente la piastra per raccogliere la sospensione cellulare di turbinio e risciacquare la piastra 8 volte con DPBS sbarazzarsi di cellule non aderenti. Delicatamente, aggiungere la soluzione di lavaggio lungo la parete laterale della piastra e agitare la piastra più volte per liberarsi di cellule non aderenti.
    8. Staccare le cellule dalla piastra di anticorpo di topo-PDGFRα utilizzando un 4 mL di trattamento con cellule distacco soluzione per 10 min a 37 ° C. Agitare la piastra per sloggiare le cellule aderenti.
    9. Raccogliere il OPCs purificata mediante centrifugazione a 300 x g e a temperatura ambiente, sospendere il pellet cellulare con mezzo di coltura cellulare di 2 mL OPC e contare le celle utilizzando trypan blu e un emocitometro (500 mL medium della coltura cellulare è mezzo DMEM/F12 contenente 5 mL soluzione di penicillina-streptomicina (P/S), 5 mL N2, 10ml B27, 5 µ g/mL insulina, 0.1% BSA, bFGF di 20 ng/mL e 10 ng/mL PDGFRα).
  3. Convalida della purezza di OPCs dopo immunopanning.
    1. Al fine di valutare l'arricchimento di OPCs dopo immunopanning, utilizzare alcune del OPCs purificato per estrazione di RNA con un'estrazione di tiocianato basato guanidium secondo le istruzioni del produttore.
    2. Eseguire qRT-PCR utilizzando mix master colorante verde fluorescente per controllare per l'arricchimento dell'espressione di PDGFRα in OPCs purificato rispetto alle cellule di cervello dissociata secondo i materiali pubblicati in precedenza4.
    3. Inoltre, seme alcune OPCs purificata in poli-D-lisina rivestita 24 pozzetti per immunostaining con l'anticorpo anti-NG2 Condroitin solfato proteoglicano (NG2) come precedentemente pubblicati materiali9.

2. preparazione Low-cella ChIP e ChIP costruzione della libreria per il sequenziamento High-Throughput

  1. Preparazione di basso-cella ChIP Olig2 con un sistema di sonicazione commercialmente disponibili e un numero di cellulare basso commercialmente disponibili ChIP kit (Vedi tabella materiali) seguendo le procedure standard da istruzioni del produttore.
    1. Dopo la disconnessione dal ratto anti-PDGFRα piastra di anticorpo-rivestite e la cella contando con trypan blue e un emocitometro mettere 20.000 OPCs purificato nel mezzo di coltura cellulare OPC 1 mL per ogni reazione di ChIP.
    2. 27 µ l di formaldeide 36,5% per Difficoltà sospensione cellulare per 10 min a temperatura ambiente.
      Attenzione: Si prega di notare che la formaldeide deve essere utilizzato nella cappa chimica per motivi di sicurezza.
    3. Fermata della DNA-proteina cross-linking con glicina di 2,5 M 50 µ l per 5 min a temperatura ambiente.
      Nota: Tutti i passaggi devono essere effettuati su ghiaccio o nella cella frigorifera a 4 ° C da questo punto.
    4. Lavare il pellet cellulare reticolato con 1 mL di gelida Hanks bilanciato sale soluzione (HBSS) con l'inibitore della proteasi cocktail e ottenere cellule pellettate tramite una centrifuga pre-raffreddata a 300 x g a 4 ° C.
    5. Lisare il pellet cellulare in 25 µ l completa di tampone di lisi per 5 min sul ghiaccio.
      Nota: Agitare la provetta per sospendere le cellule in tampone di lisi.
    6. Supplemento alla cella lysata con 75 µ l ghiacciata HBSS contenente shear e inibitore della proteasi cocktail la cromatina di lisato di cellulare pre-raffreddato sistema sonicazione con 5 cicli di 30 s ON e 30 s OFF programma. Sempre trattare con ultrasuoni 6 tubi insieme e assicurarsi che i tubi di equilibrio contengono 100 µ l acqua.
    7. Dopo la tosatura, centrifugare a 14.000 x g per 10 min a 4 ° C e raccogliere il surnatante in una nuova provetta dopo la centrifugazione.
    8. Diluire 100 µ l di cromatina tranciata con il volume uguale di gelida Buffer completo di ChIP con l'inibitore della proteasi.
    9. Salvare 20 µ l della cromatina tranciata diluita come campione di controllo di Input.
      Nota: Esempio di controllo di Input è anche richiesto come confronto al Olig2 immunoprecipitati campione per identificare Olig2 anticorpo immunoprecipitati DNA.
    10. Aggiungere 1 µ l di anticorpo di coniglio anti-olig2 a 180 µ l della diluito Tosato della cromatina e incubare la provetta di reazione su un disco rotante a 40 giri per 16 h a 4 ° C.
      Nota: Eseguire questo passaggio in una stanza fredda.
    11. Per ogni reazione di ChIP, lavare 11 µ l proteina magnetiche rivestite con A perline con 55 µ l tampone di lavaggio di perline e mettere il tallone pallina in 11 µ l di tampone di lavaggio perlina dopo 2 lavaggi.
      Nota: Eseguire questo passaggio in una stanza fredda.
    12. Per ogni reazione di ChIP, aggiungere 10 µ l di pre-lavati perline rivestite con A di proteina al tubo di reazione di ChIP. Eseguire questo passaggio in una stanza fredda.
    13. Incubare la provetta di reazione di ChIP a 4 ° C per un altro 2 h su una ruota in movimento.
    14. Collocare la provetta di reazione di ChIP sulla griglia magnetica per 1 min.
      Nota: Eseguire questo passaggio in una stanza fredda.
    15. Rimuovere il supernatante e non sloggiare il pellet perlina.
    16. Lavare il pellet perlina con 100 µ l per ciascuno dei 4 wash buffer rispettivamente per 4 min su una ruota rotante a 4 ° C.
    17. Dopo lavaggi, aggiungere 200 µ l di tampone di eluizione al pellet perlina e incubare la provetta di reazione di ChIP a 65 ° C per 4 h invertire legame incrociato della proteina-DNA.
    18. Inoltre, aggiungere 180 µ l di tampone di eluizione per esempio di controllo di Input di 20 µ l e incubare a 65 ° C per 4 h invertire legame incrociato della proteina-DNA pure.
    19. Aggiungere miscela di 25:24:1 (v/v) 200 µ l di fenolo, cloroformio e isoamil alcool a ciascuna provetta di reazione di ChIP.
    20. Vortexare vigorosamente per 1 min e centrifugare a 13.000 x g per 15 min a temperatura ambiente. Trasferire la fase superiore in una nuova provetta.
    21. Aggiungere la soluzione di acetato di sodio di 3m 40 µ l, 1000 µ l di etanolo al 100% e 2 µ l di glicogeno precipitante covalentemente ad un colorante blu per ciascuna provetta di reazione ChIP durante la notte a-20 ° C.
    22. Centrifuga a 13.000 x g per 20 min a 4 ° C.
    23. Eliminare il supernatante, lavare con etanolo al 70% freddo 500 µ l e centrifugare a 13.000 x g per 20 min a 4 ° C.
    24. Scartare il surnatante, mantenere l'aria di pellet asciutto per 10 min e sciogliere il precipitato con acqua di 50 µ l.
  2. Costruzione della libreria chIP per il sequenziamento ad alta produttività
    1. Pulire e concentrare il DNA ChIP con un kit di pulizia secondo le istruzioni dei fabbricanti.
    2. Quantificare il campione di ChIP da un pico-verde secondo le istruzioni del produttore.
    3. Utilizzare un kit di ChIP-seq per T-tailing, replica e tailing, cambio di modelli ed estensione, l'aggiunta di schede e amplificazione, selezione dimensione biblioteca e purificazione secondo le istruzioni del produttore.
      1. Dopo denaturazione di dsDNA, dephosphorylate estremità 3' di ssDNA di fosfatasi alcalina del gambero e aggiungere una coda di poli (T) l'anti-ssDNA transferasi terminale di deoxynucleotidyl.
      2. Temprare il Primer di DNA Poly (dA) per il modello di ssDNA per la replicazione del DNA e il cambio di modelli.
      3. Dopo il modello di commutazione, amplificare la biblioteca di ChIP-seq mediante PCR con primer forward e reverse per l'indicizzazione.
      4. Selezionare la PCR amplificato ChIP-seq libreria con frammenti che vanno da 250 a 500 bp da perline paramagnetici di opzione 2 per la selezione di dimensione doppia.
      5. Esaminare la qualità della libreria ChIP-seq selezionata utilizzando un dispositivo di elettroforesi capillare chip microfluidici.

3. analisi dei dati

  1. Preparare la struttura di directory.
    1. Creare una directory per eseguire l'analisi di dati di ChIP-seq. All'interno della directory appena creata, creare le sei sottodirectory con i seguenti nomi: raw.files, fastqc.output, bowtie.output, homer.output, macs2.output, motif.analysis e report.
  2. Preparare i dati ed effettuare analisi di controllo di qualità dei dati di sequenza crudo.
    1. Spostarsi nella directory "raw.files" e scaricare i file di dati di ChIP-seq.
    2. Verificare i nomi dei file. Se il sequenziamento è stato accoppiato-fine, ci saranno 4 file (due per il trattamento) e due per l'input con nomi di base simili: PDGFRα_Olig2.read1.fastq, PDGFRα_Olig2.read2.fastq, PDGFRα_input.read1.fastq e PDGFRα_input.read2.fastq. Se i nomi dei file sono diversi, è possibile rinominarli utilizzando il comando "mv".
    3. Spostarsi nella directory "fastqc.output".
    4. Ottenere le metriche di controllo di qualità dal crude letture utilizzando un del software di controllo di qualità dei file fastq10. Utilizzare il comando in Figura S1A per eseguire il processo di controllo qualità separatamente per ogni file fastq. Il software mostrerà diverse metriche di controllo di qualità in un file html.
    5. Aprire il file di controllo di qualità di html e verificare il numero di letture, leggere la lunghezza, per qualità di sequenze di base, per punteggi di qualità di sequenza, sequenza GC contenuti contenuti, livelli di duplicazione di sequenza, adattatore e i kmer contenuti.
  3. Trim letture finali di bassa qualità e contenuto di adattatore.
    1. Osservare "Per qualità di sequenze di base" e "Adattatore contenuto" trame. Determinare la lunghezza di taglio per la testa e la coda di ogni lettura. Una lunghezza adeguata per la rifilatura è dove la qualità di base è inferiore a 30 e c'è prova del contenuto di adattatore.
    2. Spostarsi nella directory "raw.files".
    3. Scaricare e installare un software per la rimozione della legge11. Utilizzare il comando in Figura S1B per rifilatura sia nel trattamento che l'input separatamente. Parametro 'CROP' indica la lunghezza di lettura rimanente dopo la rifilatura basi dalla fine e 'HEADCROP' specifica il numero di basi per essere eliminati dall'inizio della lettura.
    4. Il comando ritaglio include anche la minima lunghezza per essere accettato dopo il filtraggio nel parametro 'MINLEN' di leggere. Se le letture sono almeno 50 bp, bp uso 35 come la soglia di lettura lunghezza.
    5. Spostarsi nella directory "fastqc.output".
    6. Eseguire l'analisi di controllo di qualità del file fastq dopo le letture di cantu. Verificare che sono stati risolti i problemi di controllo di qualità. Utilizzare il comando in Figura S1C per ottenere le metriche di controllo di qualità.
  4. Allineare le letture di ChIP-seq monolato o accoppiato-fine al genoma di riferimento del mouse.
    1. Passare alla directory "bowtie.output" per la mappatura.
    2. Scarica il genoma di riferimento GENCODE mm10 topo. Rinominare il genoma di riferimento del mouse mm10 come "mm10.fa".
    3. Scarica una lettura mapper12 e installarlo nel sistema.
    4. Creare un file di indice del genoma di riferimento scaricato utilizzando il comando in Figura S2A. Sei file vengono creati automaticamente: mm10.1.bt2, mm10.2.bt2, mm10.3.bt2, mm10.4.bt2, mm10.rev.1.bt2 e mm10.rev.2.bt2.
    5. Utilizzare il comando in Figura S2B per eseguire l'allineamento e regolare il parametro "-p" al numero di core di elaborazione in base alle impostazioni di sistema. Se accoppiato-fine modalità di esecuzione, i parametri "-1" e "-2" indicano i nomi dei file fastq profilati.
      Nota: Mapping viene eseguita separatamente per gli esempi di trattamento e ingresso e uscita metrica log file vengono creati per ogni campione.
    6. Scaricare un software per manipolare i file in formato di SAM13 e installarlo nel sistema. Convertire il file SAM allineato in un file BAM utilizzando il comando in Figura S2C.
  5. Ottenere le metriche di controllo di qualità di letture mappate prima vetta chiamata per entrambi esempi di trattamento e controllo di fine accoppiato.
    1. Uno dei parametri più importanti di controllo di qualità all'indirizzo è la profondità di sequenziamento. Aprire il file "log.bowtie.PDGFRα_Olig2.txt" e "log.bowtie.PDGFRα_input.txt" nella directory bowtie.output e verificare che il numero di coppie di lettura in modo univoco mappate in ogni campione è maggiore di 10 milioni.
    2. Spostarsi nella directory "homer.output".
    3. Scaricare un software per l'individuazione di motivi e di analisi di sequenziamento di nuova generazione14 e installarlo nel sistema.
    4. Creare una directory denominata "tagDir".
    5. Per verificare la clonalità di tag, utilizzare il comando raffigurato in Figura S3A. Il comando "makeTagDirectory" genererà quattro qualità controllo uscita files:tagAutocorrelation.txt, tagCountDistribution.txt, tagInfo.txt e tagLengthDistribution.txt.
    6. Spostarsi nella directory "tagDir".
    7. Copiare il file "tagCountDistribution.txt" nella directory "report".
    8. Spostare la directory "reports".
    9. Aprire il file tagCountDistribution.txt utilizzando un programma di foglio di calcolo e creare una barra di trama del numero di tag per ogni posizione genomica. Memorizzare il file di istogramma con il nome "tag.clonality.xlsx".
    10. Installare nel sistema di programmazione lingua15 R.
    11. Nel terminale, digitare 'R' e premere INVIO per accedere all'ambiente di programmazione R.
    12. Scaricare un pacchetto di R per l'elaborazione di dati ChIP-seq16 e installarlo utilizzando il comando raffigurato in Figura S3B.
    13. Utilizzare lo script di R in Figura S3C per tracciare la cross-correlazione di strand.
  6. Rilevazione dei picchi utilizzando un'utilità di mapping di picco.
    1. Spostarsi nella directory "macs2.output". Scaricare e installare un picco mapper17 nel vostro sistema.
    2. Utilizzare la funzione "callpeak" con il trattamento e controllare i file di BAM generati nel passaggio 3.4.6.
      Nota: Altri parametri includono "-f" per il formato di file di input, "-g" per la dimensione del genoma, "-nome" per indicare il nome di base di tutti i file di output, e "-B" per memorizzare il pile-up frammento in formato bedgraph. Il picco completo comando è incluso nel Figura S4A. Utilizzare BEDPE per campioni accoppiato-fine.
    3. Verificare che il mapper di picco generato sei file: PDGFRα_Olig2_vs_PDGFRα_input_peaks.xls, PDGFRα_Olig2_vs_PDGFRα_input_peaks.narrowPeak, PDGFRα_Olig2_vs_PDGFRα_input_summits.bed, PDGFRα_Olig2_vs_PDGFRα_input_model.r, PDGFRα_Olig2_vs_ PDGFRα_input_control_lambda.bdg e PDGFRα_Olig2_vs_PDGFRα_input_treat_pileup.bdg.
    4. Aprire il file PDGFRα_Olig2_vs_PDGFRα_input_peaks.xls per visualizzare i picchi chiamati, posizione, lunghezza, posizione di vertice, pile-up e le metriche di arricchimento di picco:-log10(pvalue), piegare arricchimento e - log10(q-value).
  7. Filtrare e annotare chiamati cime.
    1. Utilizzando il file aperto nel passaggio precedente, con conseguente filtro picchi secondo l'arricchimento di piega, il p-value e/o il valore di q. Per decidere adeguate soglie di filtraggio, fare una trama di istogramma per determinare la densità di ogni metrica. Filtrare i valori sotto una soglia selezionata per ottenere picchi significativi.
    2. Scarica la lista nera mm10 (regioni sono noti per avere segnale artificialmente alto) e filtro fuori il ChIP-seq picchi che sono all'interno di qualsiasi di quelle regioni di artefatto.
    3. Creare un file di letto con le cime filtrate contenente le colonne seguenti: cromosoma, inizio, fine, peakID, derisione e strand. Riempire la colonna finta con un punto "." poiché non viene utilizzato. Nella colonna strand, di tutti i valori "+". Salvare il file letto come "filtered.peakData2.bed".
    4. Copiare il file "filtered.peakData2.bed" nella directory "report".
    5. Spostare la directory "reports".
    6. Per annotare il filtrato picchi ad una regione del gene specifico, utilizzare la funzione "annotatePeaks" con il file letto creato nel passaggio precedente. Il comando utilizzato è mostrato in Figura S5A.
    7. Aprire il file "filtered.annotatedPeaks.txt" utilizzando un software statistico.
    8. Filtro risultante picchi che si trova in una regione intergenica ad una distanza maggiore di 5 kb da un TSS con annotazioni. Utilizzare la colonna "Distanza di TSS" nel file come la distanza per il filtraggio. Conservare le cime filtrate in un file di excel denominato "5kbup.geneBody.peakData.txt".
    9. Archivio risultante filtrata picchi in un file bedGraph con colonne: cromosoma, inizio, fine e - log10(q-value). Nome del file "5kbup.geneBody.peakData.bedGraph".
  8. Generare file di Parruccone per la visualizzazione del browser.
    1. Scaricare e installare un software per genoma aritmetica18.
    2. Uno strumento per la conversione bedgraph parruccone di scaricare e installare nel sistema. Scaricare il file 'mm10.chrom.sizes'.
    3. Utilizzare il comando in Figura S6A per generare un file di Parruccone.
    4. Scaricare e installare un browser di genoma19 nel sistema.
    5. Aprire il browser del genoma e caricare il file "5kbup.geneBody.peakData.bigwig" per visualizzare i filtrato picchi significativi e la loro posizione nei confronti di geni noti.
  9. Ricerca di motivi.
    1. Spostarsi nella directory "motif.analysis".
    2. Scarica un motif de novo di scansione e il programma di arricchimento di motivo e installare nel tuo sistema20.
    3. Scaricare un database di motivo completa che comprende motivi di Olig2.
    4. Ottenere le sequenze genomiche di 500 regioni bp centrate in occasione dei vertici picco significativo. Memorizzare le sequenze come peak.sequences.txt. Utilizzare il comando in Figura S7 per la ricerca di motivi di Olig2 all'interno di ciascuna delle regioni di picco bp 500.
    5. Filtrare i motivi risultanti utilizzando un adeguato valore di E (predefinito = 0,05).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Basso-cella ChIP-seq è stata effettuata e analisi bioinformatiche sono stati fatti per studiare le interazioni potenziali del fattore trascrizionale Olig2 con DNA genomico in cervello acutamente purificato OPCs. La figura 1 Mostra un flusso di lavoro generale sia sperimentale che le procedure di analisi dei dati. In questo protocollo, cervelli di topi postnatali fossero dissociati in sospensione unicellulare. Dopo dissociazione del tessuto, immunopanning è stato effettuato per purificare OPCs utilizzando anticorpi PDGFRα. La figura 2 Mostra il significativo arricchimento di PDGFRα, poca espressione del marcatore del neurone Tuj1 (classe di neurone-specific III beta-tubulina), marcatore di astrociti GFAP (proteina silicea fibrillare glial), adattatore di marcatore ionizzato calcio associazione di microglia molecola 1 (Iba1), myelinating maturi oligodendrociti marcatore base proteina della mielina (Mbp) e glicoproteina myelin oligodendrocyte (Mog) da OPCs purificato come valutata mediante RT-qPCR. Immunostaining risultato indica, inoltre, che la maggior parte delle cellule sono NG2 positivo come mostrato nella Figura 2. Successivamente, cromatina era tagliata utilizzando un sistema di sonicazione e 20 mila OPCs purificata per reazione sono stati fissati dalla formaldeide. Olig2 basso-cella ChIP è stato effettuato e la libreria è stata costruita. Dopo la preparazione di biblioteca di ChIP, la qualità del prodotto generato è stata convalidata da un dispositivo di elettroforesi capillare chip microfluidici. La figura 3 Mostra un elettroferogramma di esempio di una libreria di ChIP Olig2 cella a basso. Un prodotto di biblioteca di picco chiaro di Oligo2 che vanno da 250 a 500 bp dovrebbe essere visibile dopo la selezione della dimensione del prodotto PCR di biblioteca. Le librerie di ChIP-seq del campione sia preparato con anticorpo di fattore di trascrizione Olig2 e il campione di controllo sono stati sottoposti a sequenziamento ad alta velocità per produrre 50 accoppiato-fine ciclo di letture di sequenziamento. Lunghezze di lettura saranno migliorare le percentuali di mappatura e ridurre la probabilità di multi-mapping, a scapito di costi di sequenziamento. Con le librerie di sequenziamento accoppiato-fine 50 bp ChIP-seq, si ottengono buoni risultati.

Dopo la valutazione iniziale controllo di qualità del crude letture e rifilatura di adattatori e finali paia di basi di bassa qualità, i grafici di controllo qualità sono rappresentati in Figura 4. Profilati letture dovrebbero avere una qualità di base maggiore di 30, nessuna sequenza di adattatore e hanno un tasso di duplicazione basso (Figura 4B-D). Buona qualità tagliato legge aumenterà il tasso di allineamento globale. Altri parametri come il contenuto di GC sono importanti e dovrebbero essere considerati per rifilatura.

Una volta che i campioni di sequenziamento sono allineati, è necessario verificare la profondità di sequenziamento. È noto che il numero di picchi chiamati aumenterà con una maggiore profondità di sequenziamento poiché debole siti diventerà statisticamente più significativa21. Un'analisi di saturazione è necessaria per determinare una sufficiente profondità di sequenziamento per ogni fattore di trascrizione specifico utilizzato, a scapito di tempo e budget. Una profondità di sequenziamento di consenso per il legame del fattore di trascrizione è stata suggerita dal Consorzio ENCODE per quanto riguarda i campioni dei mammiferi: un minimo di 10 milioni in modo univoco mappato letture per ciascuno dei biologico almeno due ripetizioni22. Il numero di letture in modo univoco mappate e il tasso di allineamento globale sono stato calcolato il mapper di lettura. Un esempio di metriche buona mappatura è illustrato nella Figura 5A. Allineati letture devono essere mappate a distinte posizioni genomiche, che indica una complessità adeguata biblioteca, noto anche come clonalità di tag. Il Consorzio ENCODE suggerisce che almeno l'80% dei 10 milioni di letture allineate deve essere mappato a differenti regioni genomiche22. Figura 5B Mostra un clonality tag adeguato in cui oltre il 90% delle letture vengono mappati a sola posizione genomica. Librerie di bassa complessità si verificano generalmente quando non abbastanza DNA è ottenuto, e la PCR amplificati frammenti vengono sequenziati ripetutamente. Una libreria di bassa complessità resa di un tasso di rilevazione di alta falso picco.

Quando si utilizzano dati di ChIP-seq accoppiato-fine, frammenti associano intorno al fattore di trascrizione con una certa distanza di separazione. Accoppiato-fine sequenziamento consentirà una stima più accurata della lunghezza del frammento media producendo una migliore stima delle regioni genomiche dove si è verificato più vincolanti. La trama di correlazione strand raffigura un picco di arricchimento corrispondente alla lunghezza del frammento predominante. Come osservato nella Figura 5, la lunghezza del frammento calcolato è di 130 bp considerando che la lunghezza di lettura è di 50 bp. Un dataset di ChIP-seq dove la lunghezza del frammento è maggiore della lunghezza di lettura è indicativo di alta qualità16.

L'output della chiamata di picco è un elenco di regioni genomiche probabile di essere vincolato dal fattore di trascrizione (o suo complesso). L'elenco delle regioni genomiche o picchi è incluso in un file di "letto" che può essere visualizzato in un browser del genoma. Per ogni picco, questo file contiene un ID di picco, la genomica posizione del vertice del picco e la FDR come - log10 (q-valore). I picchi notevolmente arricchiti sono quelli con più alto piega-arricchimento e metriche di significato. Un esempio di file di picco di output è mostrato in Figura 6A. Dopo aver selezionato picchi significativi utilizzando soglie personalizzate, filtraggio picchi all'interno blacklist23 di ENCODEe identificare i picchi all'interno della regione del promotore di un gene (5 kb corpo a Monte e intero gene), un file "pezzo grosso" è utile per visualizzare picchi in un genoma Browser. Regioni di picco più arricchito hanno una maggiore probabilità di associazione del fattore di trascrizione. È importante confermare la presenza di picco nelle regioni regolatorie di fattore di trascrizione conosciuto così come assenza di picco nelle regioni dove il legame del fattore di trascrizione è improbabile. Figura 6B -E vengono illustrati esempi di regioni del gene con e senza arricchimento di picco come pure la loro posizione rispetto alle regioni promotrici ENCODE.

Metodi complementari in silico per ChIP-seq esperimento sono motivo arricchimento analisi e de novo ricerca di motivi. Poiché Olig2 associazione in OPCs non è stato studiato prima, Olig2 ChIP-seq derivato picchi in cellule progenitrici del neurone di motore e cellule staminali embrionali sono state utilizzate per de novo motivo identificazione4,24. Olig2 de novo identificati motivi sono stati aggiunti al database completo ENCODE motivo25 e motivo arricchimento analisi è stata eseguita. Alto arricchimento del de novo identificato OLIG2 motivi e motivi (HDAC2, SP1, FOXP1, NR3C1, NFKB2/4, SMAD2/3, PAX5 e ASCL1) fattore di trascrizione noti sono stati trovati nel ChIP-seq cime delle cellule PDGFRα purificato. Un arricchimento del 30 de novo identificati motivi con un valore di E è stata scoperta < 0.05. La figura 7 Mostra i motivi de novo identificati due principali di Olig2. Questi due motivi Olig2 de novo identificati sono stati trovati in > 60% delle cime ChIP-seq ottenute da cellule PDGFRα purificato, in aggiunta ai motivi noti.

Figure 1
Figura 1: Panoramica del flusso di lavoro protocollo. PDGFRα positiva OPCs sono stati isolati da cervelli di topo postnatale e sono stati sottoposti a Olig2 ChIP sperimentare. I frammenti di DNA precipitati sono stati utilizzati per la preparazione di biblioteca di ChIP. Dopo la valutazione della qualità di libreria, i campioni sono stati utilizzati per il sequenziamento. Insiemi di dati sono stati analizzati e picchi sono stati identificati, indicando i potenziali siti di legame di Olig2 in OPC purificato le cellule. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: valutazione della purezza dei immunopanned OPCs qPCR e immunostaining. (A) PDGFRα dell'anticorpo immunopanned cellule sono state seminate e immunostaining è stato effettuato utilizzando OPC lignaggio marker NG2 della malattia. Blu: DAPI, verde: NG2. Barra della scala = 10 µm. (B) il livello di espressione relativa del marcatore del neurone Tuj1 in OPCs purificato (PDGFRα +) e in cellule cerebrali dissociate (mix) sono stati valutati. Tuj1 espressione in cellule cerebrali dissociata era impostato su 1. (C) il livello di espressione relativa di astrociti marcatore GFAP in OPCs purificato (PDGFRα +) e in cellule cerebrali dissociate (mix) è stata valutata. Espressione di GFAP in cellule cerebrali dissociata era impostato su 1. (D), il livello di espressione relativa di OPC marcatore PDGFRα in OPCs purificato (PDGFRα +) e in cellule cerebrali dissociate (mix) è stata valutata. PDGFRα espressione in cellule cerebrali dissociata era impostato su 1. (E), il livello di espressione relativa del marcatore oligodendrociti maturi myelinating Mog in OPCs purificato (PDGFRα +) e in cellule cerebrali dissociate (mix) è stata valutata. MOG espressione in cellule cerebrali dissociata era impostato su 1. (F), il livello di espressione relativa del marcatore oligodendrociti maturi myelinating Mbp in OPCs purificato (PDGFRα +) e in cellule cerebrali dissociate (mix) è stata valutata. MBP espressione in cellule cerebrali dissociata era impostato su 1. (G), il livello di espressione relativa della microglia marcatore Iba1 in OPCs purificato (PDGFRα +) e nel cervello dissociato cellule (mix) è stata valutata. Iba1 espressione in cellule cerebrali dissociata era impostato su 1. Dati in B-G rappresentano esperimenti triplici e barre di errore indicano errore standard. T-analisi test * P < 0.05. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: un elettroferogramma di esempio di una libreria da ChIP di Olig2 basso-cell. Dopo la selezione di dimensione doppia, la qualità della biblioteca di Olig2 ChIP è stata analizzata da un dispositivo di elettroforesi capillare chip microfluidici. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: risultati rappresentativi di controllo di qualità per un campione di 50 bp lettura lunghezza cella basso ChIP-seq. (A) tabella riassuntiva che raffigura il numero totale di letture, il numero di letture di scarsa qualità, lunghezza della sequenza e contenuto complessivo di GC. (B) diagramma che indica la distribuzione dei punteggi di qualità in base alle diverse posizioni nella legge. (C) trama mostrando il potenziale contenuto di adattatore in posizioni diverse nella legge. (D) linea duplicata trama indicando la percentuale di sequenze. La maggior parte delle letture proviene da sequenze che si verificano solo una volta all'interno della libreria, che quindi indica un tasso basso di duplicazione o libreria alta complessità. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: controllo di qualità metriche ottenute prima di chiamare di picco: bowtie2 allineamento metriche, filo cross-correlazione e tag clonality. (A) allineamento metriche ottenute dal mapper di lettura. Le metriche più importanti sono il numero di coppie di lettura in modo univoco mappate, indicato come "allineato concordemente esattamente 1 ora" e il tasso di allineamento globale. (B) istogramma che mostra il clonality di tag. Le barre indicano la percentuale di genomiche posizioni dove sono stati trovati tag. (C) un esempio di un complotto di cross-correlazione che indica i dati di buona qualità. Linee rosse rappresentano la lettura lunghezza a 50 bps e la lunghezza del frammento predominante a 130 bps. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 6
Figura 6: ChIP-seq picco regioni e visualizzazioni browser genoma di picchi significativi di ChIP-seq alle posizioni differenti genomici. (A) esempio di regioni picco identificato con il chiamante di picco. (B) significativo ChIP-seq picchi trovano nel corpo del gene di Cspg4, un noto gene marcatore OPC. (B) nessun ChIP-seq picchi sono stati trovati nelle regioni promotore o all'interno degli organismi del gene del gene di Mbp, un indicatore per oligodendrociti maturi, Tubb3 (C), un indicatore di un neurone delle cellule, o GFAP (D), un indicatore di cella dei astrocytes. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 7
Figura 7: altamente arricchito de novo identificati motivi di Olig2 trovato nei picchi di PDGFRα-Olig2 ChIP-seq. Clicca qui per visualizzare una versione più grande di questa figura.

Figura S1: preparazione degli insiemi di dati di ChIP-seq. (A) definizione di architetture di Directory. (B) calcolo crudo leggi metriche di controllo di qualità. (C) taglio di letture. Per favore clicca qui per scaricare questo file.

Figura S2: allineamento di letture per il genoma di riferimento. Per favore clicca qui per scaricare questo file.

Figura S3: controllo di qualità di letture allineate, all'indirizzo strand cross-correlazione e determinare la clonalità tag. Per favore clicca qui per scaricare questo file.

Figura S4: chiamata picco. Per favore clicca qui per scaricare questo file.

Figura S5: annotazione di picchi significativi. Per favore clicca qui per scaricare questo file.

Figura S6: conversione di formato di file di bedGraph in Parruccone per visualizzazione picco nel browser genoma. Per favore clicca qui per scaricare questo file.

Figura S7: arricchimento di ricerca e motivo motivo De novo . Per favore clicca qui per scaricare questo file.

Figura S8: Flow-Chart che descrive l'analisi bioinformatica dei dati di ChIP-seq. Per favore clicca qui per scaricare questo file.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Reti di regolazione genica dei mammiferi sono molto complesse. ChIP-seq è un potente metodo per indagare le interazioni proteina-DNA del genoma. Questo protocollo comprende come eseguire Olig2 ChIP-seq utilizzando un basso numero di OPCs purificato da cervelli di topo (bassi quanto 20 mila cellule per reazione). Il primo passo fondamentale per questo protocollo è la purificazione di OPCs da cervelli di topo di immunopanning con l'anticorpo PDGFRα. Per la selezione positiva di OPCs con piastre PDGFRα rivestito, OPCs spesso debolmente bind per la PDGFRα piastre rivestite. Anche dopo diversi lavaggi, ci sono ancora alcune cellule non aderenti a sinistra. È importante controllare che le cellule non-aderenti dopo ogni D-PBS lavare sotto un microscopio. Se più lavaggio D-PBS non aiuta a ridurre il numero di cellule non aderenti, è il momento di raccogliere le celle selezionate, poiché lavaggi in eccesso potrebbero sloggiare OPCs allegata e riducono il rendimento delle cellule purificate. Tuttavia, lavaggi insufficiente possono provocare la contaminazione di altri tipi di cellule del cervello. Pertanto, ogni volta dopo l'isolamento, è necessario valutare la purezza dell'isolato OPCs immunostaining con OPCs marcatore NG2 qPCR per l'espressione di geni specifici delle cellule-tipo noto come Tuj1 per i neuroni, GFAP per gli astrociti, PDGFRα per OPCs, Iba1 per microglia e MOG e MBP per myelinating oligodendrociti maturi. Come illustrato nella Figura 2, immunostaining risultato indica che la maggior parte delle cellule purificate è positiva per la macchiatura NG2. Inoltre, alcuni marcatori specifici di cellula-tipo classico per i neuroni, astrociti, microglia e myelinating maturi oligodendrociti espositivo inosservabile o estremamente-bassi livelli di espressione in OPCs purificato rispetto alla miscela delle cellule cerebrali non purificata. PDGFRα presenta il livello di alta espressione in OPCs purificato rispetto alla miscela delle cellule cerebrali non purificata. Utilizzando il metodo immunopanning, microglia sono notevolmente ridotti nel OPCs purificato rispetto alla miscela delle cellule cerebrali non purificata, ma esiste una piccola quantità di contaminazione. Questa osservazione è coerenza con le precedenti pubblicazioni di altri7,8,26. Inoltre, quando confrontato con rapporti precedentemente pubblicati, viene utilizzato un kit disponibile in commercio in questo protocollo per la dissociazione standardizzata, efficiente e conveniente di tessuti cerebrali in sospensioni unicellulari.

Dopo cross-linking di OPCs purificata, le cellule reticolate dovrebbero essere lavate con soluzione HBSS ghiacciata e i passaggi di ChIP rimanenti devono essere effettuati a 4 ° C, altrimenti l'anticorpo non può precipitare il DNA genomic correttamente.

Il prossimo passo in questo protocollo è libreria preparazione. L'amplificazione di PCR del materiale del circuito integrato è stato utilizzato per la costruzione della libreria. Il numero di cicli PCR per la preparazione di libreria dipende dalla quantità di DNA di partenza. Una preparazione buona libreria richiede la quantificazione accurata della quantità di DNA input. Troppi o troppo pochi cicli PCR possono influenzare la concentrazione di libreria, nonché della complessità, che conduce ai manufatti PCR.

È difficile costruire ChIP-seq libreria quando si utilizza un numero limitato di cellule per immunoprecipitazione27. Il protocollo standard utilizzato in precedenza di ChIP richiede 10 ng di immunoprecipitato DNA per ChIP-seq libreria preparazione1,28. Tuttavia, il protocollo descritto qui normalmente genera 2 ng di immunoprecipitato DNA dall'anticorpo di Olig2 da 20.000 OPCs. DNA è utilizzato per preparare la libreria di ChIP-seq da un metodo di aggiunta di passo singolo adattatore, che consente maggiore sensibilità permettendo picogrammi di immunoprecipitato DNA da amplificare. Combinando i corredi commerciali, questo protocollo fornisce una soluzione pratica per eseguire ChIP-seq per fattori trascrizionali, basati su un piccolo numero di cellule.

D'importanza, la cella bassa ChIP-seq protocollo descritto è applicabile per ChIP-Seq di altri fattori di trascrizione nelle cellule primarie o popolazioni di cellule rare pure. Gli anticorpi utilizzati nel presente protocollo devono essere convalidati sperimentalmente per essere precisi da esperimento IP prima. Legame non specifico degli anticorpi porterà a scarsi risultati. Inoltre, è preferibile eseguire questo esperimento basso cella ChIP-seq in cellule con un livello di alta espressione del fattore di trascrizione di interesse.

Per l'analisi dei dati, può essere difficile decidere quali valori da utilizzare come filtro cut-off dopo la chiamata a picco. A seconda degli obiettivi dell'analisi, possono essere utilizzati parametri rigorosi o più rilassati. In genere, viene utilizzata una combinazione di piega-arricchimento e p-value o FDR. Se alcuni siti di legame del fattore di trascrizione in fase di studio erano precedentemente conosciuti, questo può aiutare a determinare le soglie di filtraggio. Database del sito di associazione di trascrizione fattore derivato dagli esperimenti di ChIP-seq pubblicamente disponibili in differenti linee cellulari e condizioni sono stati compilati29,30. Uno potrebbe cercare un gene e controllare se i siti di legame del fattore di trascrizione sono stati trovati in precedenza. Tuttavia, è importante essere consapevoli che i siti di legame del fattore di trascrizione differiscono a seconda delle condizioni e tipi di cellule.

In silico metodi complementari per ChIP-seq esperimento sono motivo arricchimento analisi e de novo motivo ricerca utilizzando MEME-ChIP20 o programmi simili. La ricerca di motivi richiede un completo conosciuto e de novo derivato database motivo ad esempio ENCODE motivi25 o il database di Hocomoco31. Hocomoco è un database di motivi scoperto da umani pubblicamente disponibili e gli esperimenti del mouse ChIP-seq. Se motivi per la proteina analizzata sono sconosciuti, la ricerca di motivi de novo potrebbe rivelare modelli di sequenza ripetitiva in una frazione significativa dei picchi come nuovi motivi. L'azione combinatoria potenziale dei fattori di trascrizione può essere svelato quando motivi di altri fattori di trascrizione si trovano anche essere arricchita nei picchi risultanti.

Le regioni di picco arricchito possono essere validate sperimentalmente utilizzando la cromatina delle cellule mutanti o knockoue come controlli. Esecuzione di ChIP-seq usando le cellule non esprimono il fattore di trascrizione sono utilizzati per l'identificazione dei picchi positivi falsi, anche indicata come "fantasma picchi"32. Falsi positivi devono essere filtrati.

È anche interessante confrontare le cime di ChIP-seq risultante con dati di trascrittomica. Le cime di PDGFRα-Olig2 ChIP-seq sono state confrontate con l'espressione dei geni in OPCs da una precedente pubblicazione18. Questa strategia può essere limitata dal momento che geni espressi in OPCs possono essere controllati dai meccanismi all'infuori di Olig2 trascrizione fattore legante. Inoltre, fattore di trascrizione Olig2 può associare a regione regolatrice di un gene, ma il gene potrebbe avere il livello di espressione genica basso a causa di possibili meccanismi inibitori o la mancanza di co-fattori necessari per la trascrizione genica.

ChIP-seq è un metodo utilizzato per l'identificazione dei siti di legame del DNA genoma di fattori di trascrizione e di altre proteine. Tuttavia, attraverso l'analisi di co-occorrenza di fattori di trascrizione, i ricercatori hanno trovato che i fattori di trascrizione tendono ad associare con altre proteine che formano coregolamentazione moduli33. Questo significa che alcune associazioni tra fattori trascrizionali e DNA genomic ha rivelato da ChIP-seq sono indirette e con bridging di altre proteine. Pertanto, per ottenere risultati più significativi ricercatori consigliabile studiare simultaneamente più di un fattore di trascrizione.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano di non avere nessun concorrenti interessi finanziari.

Acknowledgments

JQW, XD, RCDD e YY sono stati supportati da concessioni dagli istituti nazionali di salute R01 NS088353; NIH grant 1R21AR071583-01; Irene Ogilvie fondo-Memorial Hermann Fondazione; l'iniziativa di cervello di UTHealth e CTSA UL1 TR000371; e una borsa di studio presso la University of Texas sistema di Neuroscienze e Neurotecnologie Research Institute (Grant n. 362469).

Materials

Name Company Catalog Number Comments
Reagent/ Equipment
Banderiaea simplicifolia lectin 1 Vector Laboratories # L-1100
Rat anti-PDGFRa antibody BD Bioscience # 558774
Neural tissue dissociation Kit (P) MACS Miltenyi Biotec # 130-092-628
Accutase STEMCELL technologies # 07920
TRIzol Thermo Fisher # 15596026
Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody Millipore # AB5320
Bioruptor Pico sonication device Diagenode # B01060001
True MicroChIP kit Diagenode # C01010130
Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v) Thermo Fisher # 15593031
NucleoSpin Gel and PCR Clean-Up kit MACHEREY-NAGEL # 740609
Quant-iT PicoGreen dsDNA Assay Kit Thermo Fisher # P11496
DNA SMART ChIP-Seq kit Clontech Laboratories # 634865
Agencourt AMPure XP Beckman Voulter # A63880
GlycoBlue Thermo Fisher # AM9516
pico-green Thermo Fisher # P11496
D-PBS Thermo Fisher # 14190-144
SYBR Green master mix Bio-Rad Laboratories # 1725124
DMEM/F12 Fisher Scientific # 11-320-033
Penicillin-Streptomycin (P/S) Fisher Scientific # 15140122
N-2 Supplement Fisher Scientific # 17502048
B-27 Supplement Fisher Scientific # 17504044
insulin Sigma # I6634 Prepare 0.5 mg/ml insulin solution by dissolving 5 mg insulin in 10 ml water and 50 μl of 1 N HCl.
Bovine Serum Albumin, suitable for cell culture (BSA) Sigma # A4161 Prepare 4% BSA solution by dissolving 4 g BSA in 100 ml D-PBS and adjust the pH to 7.4
Fibroblast Growth Factor basic Protein, Human recombinant (bFGF) EMD Millipore # GF003
HUMAN PDGF-AA VWR # 102061-188
poly-D-lysine VWR # IC15017510 Prepare 1 mg/ml poly-D-lysine solution by dissolving 10 mg poly-D-lysine in 10 ml water and dilute 100 times when using.
Falcon Disposable Petri Dishes, Sterile, Corning, 100x15mm VWR # 25373-100
Falcon Disposable Petri Dishes, Sterile, Corning, 150x15mm VWR # 25373-187
HBSS, 10X, no Calcium, no Magnesium, no Phenol Red Fisher Scientific # 14185-052
Trypan Blue Stemcell Technologies # 07050
protease inhibitor cocktail Sigma # 11697498001
Software
FastQC [10] http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ Obtaining quality control metrics of raw and trimmed reads
Trimmomatic 0.33 [11] http://www.usadellab.org/cms/?page=trimmomatic Trimming and filtering raw reads
GENCODE mm10 ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_mouse/release_M15/GRCm38.primary_assembly.genome.fa.gz Mouse reference genome
Bowtie2 2.2.4 [12] http://bowtie-bio.sourceforge.net/bowtie2/index.shtml Aligning reads to a reference genome
SAMTools 1.5 [13] http://samtools.sourceforge.net/ Converting SAM file into BAM format
HOMER 4.9.1 [14] http://homer.ucsd.edu/homer/ Creating a tag directory and annotating enriched genomic regions with gene symbols
R 3.2.2 [15] https://www.R-project.org/ Programming scripts and running functions
SPP 1.13 [16] https://github.com/hms-dbmi/spp Creating a strand cross-correlation plot
MACS2 2.2.4 [17] https://github.com/taoliu/MACS Finding regions of ChIP enrichment over control
BEDTools 2.25 [18] http://bedtools.readthedocs.io/en/latest/ Genome arithmetics
bedGraphToBigWig http://hgdownload.cse.ucsc.edu/admin/exe/ Converting bedGraph file into bigwig
IGV browser 2.3.58 [19] http://software.broadinstitute.org/software/igv/ Visualization and browsing of significant ChIP-seq peaks
Microsoft Excel Spreasheet program
ENCODE's blacklist https://sites.google.com/site/anshulkundaje/projects/blacklists Filtering peaks
mm10.chrom.sizes http://hgdownload.cse.ucsc.edu/goldenPath/mm10/bigZips/mm10.chrom.sizes. Converting bedGraph file into bigwig
ENCODE's motif database [25] http://compbio.mit.edu/encode-motifs/ Comprehensive motif database required for motif enrichment
MEME-ChIP [20] http://meme-suite.org/index.html Motif enrichment analysis and motif discovery
Primer names used for qPCR Primer sequences used for qPCR
Mbp-F: CTATAAATCGGCTCACAAGG
Mbp-R: AGGCGGTTATATTAAGAAGC
Iba1-F: ACTGCCAGCCTAAGACAACC
Iba1-R: GCTTTTCCTCCCTGCAAATCC
Mog-F: GGCTTCTTGGAGGAAGGGAC
Mog-R: TGAATTGTCCTGCATAGCTGC
GAPDH-F ATGACATCAAGAAGGTGGTG
GAPDH-R CATACCAGGAAATGAGCTTG
Tuj1-F TTTTCGTCTCTAGCCGCGTG
Tuj1-R GATGACCTCCCAGAACTTGGC
PDGFRα-F AGAGTTACACGTTTGAGCTGTC
PDGFRα-R GTCCCTCCACGGTACTCCT

DOWNLOAD MATERIALS LIST

References

  1. Wu, J. Q., et al. Tcf7 is an important regulator of the switch of self-renewal and differentiation in a multipotential hematopoietic cell line. PLoS Genet. 8, (3), e1002565 (2012).
  2. Zuchero, J. B., Barres, B. A. Intrinsic and extrinsic control of oligodendrocyte development. Curr Opin Neurobiol. 23, (6), 914-920 (2013).
  3. Liu, Z., et al. Induction of oligodendrocyte differentiation by Olig2 and Sox10: evidence for reciprocal interactions and dosage-dependent mechanisms. Dev Biol. 302, (2), 683-693 (2007).
  4. Dong, X., et al. Comprehensive Identification of Long Non-coding RNAs in Purified Cell Types from the Brain Reveals Functional LncRNA in OPC Fate Determination. PLoS Genet. 11, (12), e1005669 (2015).
  5. Hilgenberg, L. G., Smith, M. A. Preparation of dissociated mouse cortical neuron cultures. J Vis Exp. (10), e562 (2007).
  6. Emery, B., Dugas, J. C. Purification of oligodendrocyte lineage cells from mouse cortices by immunopanning. Cold Spring Harb Protoc. 2013, (9), 854-868 (2013).
  7. Cahoy, J. D., et al. A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function. J Neurosci. 28, (1), 264-278 (2008).
  8. Zhang, Y., et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci. 34, (36), 11929-11947 (2014).
  9. Cheng, X., et al. Bone morphogenetic protein signaling and olig1/2 interact to regulate the differentiation and maturation of adult oligodendrocyte precursor cells. Stem Cells. 25, (12), 3204-3214 (2007).
  10. Andrews, S. FastQC: A quality control tool for high throughput sequencing data. Available from: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (2018).
  11. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 30, (15), 2114-2120 (2014).
  12. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Methods. 9, (4), 357-359 (2012).
  13. Li, H., et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25, (16), 2078-2079 (2009).
  14. Heinz, S., et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell. 38, (4), 576-589 (2010).
  15. Team, R. C. A language and environment for statistical computing. R Foundation for Statistical Computing. (2015).
  16. Kharchenko, P. V., Tolstorukov, M. Y., Park, P. J. Design and analysis of ChIP-seq experiments for DNA-binding proteins. Nat Biotechnol. 26, (12), 1351-1359 (2008).
  17. Zhang, Y., et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9, (9), R137 (2008).
  18. Quinlan, A. R., Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 26, (6), 841-842 (2010).
  19. Robinson, J. T., et al. Integrative genomics viewer. Nat Biotechnol. 29, (1), 24-26 (2011).
  20. Bailey, T. L., et al. MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res. 37, (Web Server issue), W202-W208 (2009).
  21. Sims, D., Sudbery, I., Ilott, N. E., Heger, A., Ponting, C. P. Sequencing depth and coverage: key considerations in genomic analyses. Nat Rev Genet. 15, (2), 121-132 (2014).
  22. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  23. Consortium, E. P. An integrated encyclopedia of DNA elements in the human genome. Nature. 489, (7414), 57-74 (2012).
  24. Mazzoni, E. O., et al. Embryonic stem cell-based mapping of developmental transcriptional programs. Nat Methods. 8, (12), 1056-1058 (2011).
  25. Kheradpour, P., Kellis, M. Systematic discovery and characterization of regulatory motifs in ENCODE TF binding experiments. Nucleic Acids Res. 42, (5), 2976-2987 (2014).
  26. Dugas, J. C., Tai, Y. C., Speed, T. P., Ngai, J., Barres, B. A. Functional genomic analysis of oligodendrocyte differentiation. J Neurosci. 26, (43), 10967-10983 (2006).
  27. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  28. Raskatov, J. A., et al. Modulation of NF-kappaB-dependent gene transcription using programmable DNA minor groove binders. Proc Natl Acad Sci U S A. 109, (4), 1023-1028 (2012).
  29. Cheneby, J., Gheorghe, M., Artufel, M., Mathelier, A., Ballester, B. ReMap 2018: an updated atlas of regulatory regions from an integrative analysis of DNA-binding ChIP-seq experiments. Nucleic Acids Res. (2017).
  30. Yevshin, I., Sharipov, R., Valeev, T., Kel, A., Kolpakov, F. GTRD: a database of transcription factor binding sites identified by ChIP-seq experiments. Nucleic Acids Res. 45, (D1), D61-D67 (2017).
  31. Kulakovskiy, I. V., et al. HOCOMOCO: a comprehensive collection of human transcription factor binding sites models. Nucleic Acids Res. 41, (Database issue), D195-D202 (2013).
  32. Jain, D., Baldi, S., Zabel, A., Straub, T., Becker, P. B. Active promoters give rise to false positive 'Phantom Peaks' in ChIP-seq experiments. Nucleic Acids Res. 43, (14), 6959-6968 (2015).
  33. Gerstein, M. B., et al. Architecture of the human regulatory network derived from ENCODE data. Nature. 489, (7414), 91-100 (2012).
Identificare i siti di fattore di trascrizione Olig2 associazione genomico in acutamente purificato PDGFRα + cellule di immunoprecipitazione della cromatina Low-cella ordinamento dell'analisi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Dong, X., Cuevas-Diaz Duran, R., You, Y., Wu, J. Q. Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRα+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis. J. Vis. Exp. (134), e57547, doi:10.3791/57547 (2018).More

Dong, X., Cuevas-Diaz Duran, R., You, Y., Wu, J. Q. Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRα+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis. J. Vis. Exp. (134), e57547, doi:10.3791/57547 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter