Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

식물 성장 및 Extremophyte Schrenkiella parvula 의 꽃-딥 변환 Agrobacterium 중재

doi: 10.3791/58544 Published: January 7, 2019

Summary

Agrobacterium 중재 변환 꽃 딥 메서드를 사용 하 여 성공적으로 extremophyte 모델 Schrenkiella parvula의 안정적인 유전자 변형 라인을 만드는 데 사용할 수 있습니다. 선물이 프로토콜에서 애기 thaliana, 다른 성장 습관을 고려 하 고는 extremophyte의 생리 적 특성에 대 한 수정.

Abstract

Schrenkiella parvula 는 여러 이온 독성 스트레스를 포함 하 여 다양 한 abiotic 스트레스에 적응 하는 extremophyte입니다. 높은-품질 게놈 자원을 사용할 수 있는도 불구 하 고 식물 환경에 적응 하는 방법을 공부를 강조, 기능 유전체학 모델 값 고 도구 가능한 변환 시스템의 부족에 의해 제한 되어 있다. 이 프로토콜에서 우리는 안정적인 유전자 변형 미 parvula 를 생성 하는 방법을 보고 Agrobacterium 중재 꽃 딥 방법을 사용 하 여 라인. 우리는 A. thaliana 불확정 꽃 습관 등 잎에 높은 epicuticular 왁 스 콘텐츠 S. parvula의 독특한 특성에 대 한 계정에 사용 하는 변환 프로토콜을 수정 합니다. 간단히, S. parvula 씨앗 심기 전에 5 일 동안 4 ° C에서 층 화 되었다. 식물 photoperiod 14 h 빛과 어둠 10 h과는 130 µmol m-2s-1 빛의 강도, 22 ° C 24 ° c에서 성장 했다 8 9 주 된 식물 여러 inflorescences 변환에 대 한 선정 됐다. 이러한 inflorescences Agrobacterium tumefaciens GV3101의 pMP90RK 플라스 미드를 들고 침투 솔루션에서 감소 했다. 우리는 꽃 찍기 변환 효율을 높이기 위해 3 ~ 4 주 간격으로 2 라운드를 수행. T1 씨앗 수집 하 고 후보에 대 한 화면 발 변형 라인 전에 방와 컨테이너에 4 주 동안 건조 했다. 그만하 라고 저항 T1 식물에 사용 되었다. 우리는 가양성을 줄이기 위해 2 주 된 식물에서 시작 하는 3 일 간격으로 세 번 그만하 라고 솔루션을 살포. 그만하 라고 드롭 테스트 살아남는 진정한 긍정적인 transformants를 식별 하기 위해 개별 공장에서 수행 되었다. 변환 효율 0.033%, 10000 T1 씨앗 전파 당 3-4 유전자 변형 식물을 양보 했다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

이 프로토콜에서 성장 및 extremophyte 모델 Schrenkiella parvula에 대 한 안정적인 유전자 변형 라인의 설립을 설명합니다. 효율적인 변환 시스템의 가용성은 어떤 다양 한 유전자 모델의 특징 이다. 극한 환경에서 번 창 하는 식물 extremophytes, 식물 환경 스트레스에 적응을 이해 하기 위한 중요 한 리소스 제공 이라고 합니다. Schrenkiella parvula (이전 Thellungiella parvula , Eutrema parvulum) 게놈 자원1,2,3,,45를 확대와 함께 한 같은 extremophyte 모델입니다. 그러나, 변환 프로토콜 하지 아직 보고 되었습니다 S. parvula 에 대 한 게시 된 연구.

S. parvula 의 게놈 십자화과 (겨자 양배추 가족)에 첫 번째 게시 된 extremophyte 게놈 이며 비 extremophyte 모델, 애기 thaliana1광범위 한 전체 게놈 synteny를 보여줍니다. 따라서, A. thaliana S. parvula 사이 비교 연구 A. thaliana 어떻게 parvula S. 게놈 진화 있으며 규제에 유익한 가설을 수행 하는 유전자 연구의 재산에서 혜택을 수 있는 다르게 대처에 극단적인 환경5,,67강조 합니다. S. parvula 는 가장 소금 관대 (토양 NaCl LD50 기준) 알려진된 야생 친척 중의 종 A. thaliana8중 하나입니다. NaCl 내성 이외 S. parvula 통과 대부분 식물7독성 높은 농도에서 여러 소금 이온의 존재 그것의 수명 주기를 완료. 그것의 자연 서식 지에서 널리 퍼진 abiotic 스트레스에 대응, 그것 중 여러 연구에서 생화학 또는 생리 적 레벨 8,,910, 다양 한 특성을 진화 했다 11.

2010 년부터 대상 종으로 S. parvula 를 사용 하거나 다른 식물 게놈 비교에 사용 하는 400 개 이상의 피어 reveiwed 게시 되었습니다. 그러나, 분명 병목 어떤 유형의 연구를 실시 했습니다의 면밀 한으로 확인 될 수 있습니다. 대부분의 이러한 보고서의 미래 연구에 S. parvula 의 잠재적인 사용을 논의 하거나 비교 genomic 또는 phylogenomic 연구에서 그것을 사용 하 여. 개념 증명 변환 프로토콜의 부족으로 인해 설립 S. parvula에 대 한 날짜에 사용할 수 있는 최고 품질 식물 게놈의 한이 있는도 불구 하 고 기능 게놈 연구에 사용 되지 않은 (> 5 Mb contig N50) 조립 및 염색체 수준 pseudomolecules1에 주석을 답니다.

Agrobacterium 중재 꽃 dip 변환 방법 A. thaliana에서 trasngenic 라인을 만드는 가장 광범위 하 게 사용 되는 방법은 되고있다 그리고 변환의 재현 시스템의 개발은으로 그것의 성공에 중요 한 요소는 유전자 모델12,13. 그러나, 모든 십자화과 종 A. thaliana개발 꽃 딥 방법을 사용 하 여 변환 성공적으로 표시 되었습니다. 특히, S. parvula 를 포함 하는 십자화과 리니지 II 종 꽃-딥 기반된 변환 방법14,15고집 불통 되었습니다.

S. parvula, 그것의 좁은 잎 형태와 결합의 불확정 꽃 성장 습관 도전 표준 Agrobacterium 중재 꽃 딥 변환 방법을 채택 했다. 이 연구에서 우리는 수정 된 프로토콜 S. parvula의 재현성 변화에 대 한 개발 했습니다 보고 합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 식물 성장

  1. 종자 살 균 (선택 사항)
    1. 이중 증 류 물 (ddH2O) 1 표 백제 50% 준비 또는 비 이온 세제의 2 상품 ( 재료의 표참조) 50 mL 튜브에. 여러 번 솔루션을 혼합 튜브를 반전.
      참고: 그것은 층 류 캐비닛 15 분 동안 UV 살 균된 표면 살 균 씨를 수행 하는 것이 좋습니다.
    2. ~ 100-200 표 백제 솔루션 추가 1.5 mL 튜브에 S. parvula 씨. 철저 하 게 혼합 하 고 튜브를 5 분 동안 앉아 보자.
    3. 튜브에서 표 백제를 제거 하 고 70% 에탄올을 추가. 여러 번 pipetting으로 씨앗을 세척 하 고 에탄올 솔루션을 즉시 제거.
    4. 초과 표 백제 및 에탄올, 제거 하는 소독된 물에 씨앗을 씻어 다음 물을 제거 합니다. 5 ~ 6 배가이 단계를 반복 합니다.
  2. 씨앗 층 리
    1. 소독된 물에 씨앗을 담가 그리고 4 ° c.에 5 ~ 7 일 동안 저장 또는, 젖은 토양에 직접 말린된 unsterilized 씨앗을 뿌리 다 하 고 토양 트레이 4 ° c.에 5 ~ 7 일에 대 한 장소
  3. 변화의 준비에서 성장 하는 식물
    1. 작성 토양 7 x 6 cm2 냄비에 ( 재료의 표참조)를 혼합, 냄비, 물에 담가 고 균일 하 게 젖은 성장 매체를 되도록 위에서 물 스프레이. 각 포트의 토양 표면에 5-비료 구슬 ( 재료의 표참조)를 추가 합니다.
      참고: 마찬가지로 지금까지 우리가 경험한 S. parvula A. thaliana 성장할 수 있는 토양 혼합에서 잘 자 랍니다.
    2. 젖은 이쑤시개를 사용 하 여 전송 20 ~ 25 씨앗 토양 표면에 당.
      참고: 편리한 방법은 네 모퉁이 냄비 (그림 1, 하루 15, 왼쪽된 패널)의 센터에 4-5 씨앗의 배치를 넣어 것입니다.
    3. 발 아 중 높은 습도에서 씨앗을 계속 분명 돔 냄비 트레이 커버.
    4. 공장 트레이 성장 챔버에 130 µmol m−2 s− 1 , 22-24 ° C 온도, 조명과 밤 사이클 당 하루/10 h 당 14 h에서 빛의 강도 유지. 7-10 일 발 아 후 돔을 제거 합니다. 바람직한 수준에 균일 하 게 습 토양을 유지 하는 쟁반의 바닥에서 물을 추가 합니다.
    5. 여분의 묘 밖으로 대마초와 냄비 (그림 1, 하루 15, 오른쪽 패널) 서로 잘 분리 당 유일한 4-5 건강 한 묘를 두고.
    6. 부드럽게 물 식물 2 일 마다 하 고 교류가 솔루션16 x 0.2와 거 름을 한 번 매 2 주.
      참고: 균일 한 수준에 토양 수 분을 유지 하는 것은 키 성장과 S. parvula 일관 되 게 건강 하.
    7. 여러 inflorescences 생산 공장 (그림 1, 하루 60-80) 당 100-150 꽃 봉 오리 때까지 8-10 주 동안 식물 성장을 계속 합니다. 당일 꽃 딥 기반된 변환 (4.5 단계)에 대 한 계획, 식물에서 모두 성숙 하 고 발전 siliques를 제거 합니다.

2. 공장 변환에 대 한 벡터에 관심사의 유전자 또는 Genomic 요소 복제

  1. 중 합 효소 연쇄 반응 (PCR)17 분리 젤 추출을 사용 하 여 PCR 제품 키트 ( 재료의 표참조)을 사용 하 여 대상 DNA 파편을 증폭 키트 프로토콜 또는 정화 DNA agarose 젤을 사용 하 여 다른 적절 한 방법을 전기 이동 법17,18. 생어 시퀀싱19통해 격리 된 PCR 제품의 시퀀스를 확인 합니다.
  2. 복제의 복제 유능한 대장균 에 복제 구성 세포 topoisomerase 기반 복제를 사용 하 여 변환 벡터에 원하는 PCR 제품 키트 ( 재료의 표참조) 제조 업체의 지침에 따라.
  3. 적절 한 항생제, Luria Bertani20 (파운드) 한 천 세균성 성장 미디어 (표 1)에 변형 된 제품의 50 µ L를 확산 ., 50 µ g / mL Spectinomycin ( 재료의 표참조), 그리고 37 °에서 품 어 C 하룻밤입니다.
  4. 다음 날 5 – 10 단일 식민지를 선택, 적절 한 항생제로 액체 LB 매체에 접종 하 고 부드러운 하룻밤 37 ° C에서 흔들어와 품 어.
  5. 격리 플라스 미드 플라스 미드 격리를 사용 하 여 키트 ( 재료의 표참조)를 생어 시퀀싱19 통해 2.1 증폭 대상 시퀀스 제대로 복제 여부를 확인 합니다.
  6. 복제 및 확인 된 PCR 제품을 전송 공장 변환 ( 재료의 표참조) 복제 재결합 기반 호환에 대 한 대상 벡터 ( 재료의 표참조), 다음 키트 recombinase 효소 혼합을 사용 하 여 장비 제조 업체의 지시입니다. 2.3 단계에서 단계로 2.5 분리 하 고 적절 한 플라스 미드 구조를 은닉 하는 클론을 확인을 반복 합니다.

3. 변환 벡터 생성 식물의 변화를 위한 Agrobacterium tumefaciens

  1. A. tumefaciens 스트레인 GV3101:pMP90RK21, 리 팜 피신 저항 유전자 염색체 배경 선택에 대 한 항구는 2.6에서 벡터 구성의 플라스 미드를 변환 합니다. 예를 들어 Gentamycin 또는 대 적절 한 항생제를 사용 하 여 ( 재료의 표참조), 식물의 선택에 대 한 변환 구성 (Ti 플라스 미드). A. tumefaciens electroporation 통해 변환에 대 한 간단한 프로토콜 섹션 3.2에에서 포함 됩니다.
  2. A. tumefaciens 변환 electroporation에 의해
    1. A. tumefaciens 유능한 세포22 얼음에 녹여 2.6에서 준비 하는 플라스 미드의 믹스 0.1-1 µ g ddH2O, 얼음에 유능한 세포와의 1-2 µ L에 녹아. Electroporation 베트로 혼합물을 전송 ( 재료의 표참조).
    2. 플라스 미드와는 electroporator를 사용 하 여, 3.2.1에서 유능한 세포의 혼합물에 electroporation 수행 ( 재료의 표참조) 제조 업체의 지침에 따라.
      참고: electroporation 시작 하기 전에 멧의 표면 청소.
    3. 액체 LB의 1.5 mL를 포함 하는 microcentrifuge 튜브에는 베트에서 반응 혼합물을 전송 pipetting으로 잘 혼합 하 고 부드러운 떨고와 28 ° C에서 1 시간에 품 어.
  3. 3.2 파운드 접시 포함 하는 적절 한 선택 항생제에 섹션에서 변환 된 A. tumefaciens 를 접종 (예: 대 25 µ g / mL, Spectinomycin 50 µ g / mL, Gentamycin 25 µ g / mL, 그리고 리 팜 피신 50 µ g / mL)와 28 ° C에서 3 일 동안 품 어.

4. S. parvula 의 변화 Agrobacterium 중재

  1. 단일 변형 예방 살 균 50 mL 원뿔에 항생제 (3.3와 동일)를 포함 된 파운드 액체 미디어 10 mL에 격판덮개에서 식민지 튜브 ( 재료의 표참조). 떨고 인큐베이터에서 24 h에 대 한 품 어 ( 재료의 표참조)에서 250 r.p.m.에서 28 ° c.
  2. 메 마른 250 mL 플라스 크에 세균성 솔루션 3.4.1에서 전송, 적절 한 항생제로 파운드 액체 미디어의 40 mL를 추가 하 고 600 nm 파장 (OD600)에서 광학 밀도 약 2.0에 도달할 때까지 12 h를 품 어.
  3. 원심 10 분 제거에 대 한 A. tumefaciens cultureat 3100 x g 는 상쾌한 고 다시 A. tumefaciens 침투 솔루션 (표 1) 40 mL에 세균성 문화를 일시 중단.
  4. 최종 세600 0.8의 침투 솔루션 resuspended A. tumefaciens 를 희석. 계면 활성 제 솔루션 (표 1)의 25 µ L 희석된 A. tumefaciens 50 mL에 추가 솔루션 및 여러 번 반전에 의해 혼합.
  5. A. tumefaciens 솔루션 6 화분에서 꽃이 핌을 찍기 후 20 s. 사용 신선한 세균 솔루션에 대 한 섹션 4.4에에서 준비에 있는 식물의 꽃이 핌을 찍어. 모든 꽃은 솔루션 접촉 다는 것을 확인 하십시오. 피펫으로 솔루션으로 감소 될 수 없는 경우는 화 서의 아래 부분에 있는 꽃에 직접 세균 솔루션.
    참고: 1 라운드 변환에 대 한 날카로운 메스 또는 작은 위를 사용 하 여 모든 성숙 하 고 발전 siliques를 제거 해야 합니다. 두 번째 시간에 대 한 변환을 수행 하는 경우에 siliques을 제거 하지 마십시오.

5. 후 변환 공장 관리와 두 번째 변환

  1. 1-2 일에 대 한 어두운 성장 방에 식물을 커버 하는 돔 가진 깨끗 한 쟁반에 담근 꽃 식물을 가로로 놓습니다.
    참고: 높은 습도 아래 꽃을 유지 하는 것은 (그림 1, 변환 후에 식물)이이 단계에서 중요 하다입니다.
  2. 수직 위치에 식물을 반환 하 고/10 일 밤 주기, 130 µmol m-2 s-1 빛의 강도 및 온도 22 ~ 24 ° C h 당 14 h로 성장 방에 식물을 전송.
  3. 다음 주에 담근된 inflorescences를 모니터링 합니다. 꽃의 상당수는 (그림 2)를 중단, 또는 꽃의 많은 수는 새로 개발 된 후 약 4 주 후 꽃 딥 (4 단계)를 반복 합니다.
    참고: 첫 번째 변환 (단계 1.3.7)에 대 한 준비 단계와 달리 제거 하지 마십시오 siliques (그림 2)를 개발 하거나 기존 변환의 두 번째 라운드 전에.
  4. 씨 성숙 하 고 ~ 21 주에 씨앗을 수확 때까지 식물을 성장.
  5. 실내 온도 밀폐 용기에 2-3 주 동안 건조 씨 방 ( 재료의 표참조)으로 가득 합니다.

6입니다. 긍정적인 Transformants의 선택

  1. 야생 타입 씨앗 1.2 1.3 단계에서 설명한 대로 T1 씨앗 공장.
  2. 처음 2 진정한 잎 개발, 발 아 후 약 10-14 일 때까지 식물을 성장.
  3. 제 초 제 저항 (그림 3A와 3B)으로 아래에 대 한 첫 번째 선택 항목을 수행 합니다.
    1. Glufosinate 염화 (11.3%) 제 초 제 (또는 바스) 희석 (표 1) 1:1,000 (v/v)을. 묘에 희석된 바스 솔루션 스프레이 하 고 하룻밤 돔 가진 식물을 커버.
    2. 반복 2-3 회 분사 라고 매 5-7 일.
  4. 아래로 바스 드롭 테스트를 사용 하 여 두 번째 선택을 수행 합니다.
    1. 그만하 라고 솔루션 3-4 회 분무 되 후 생존 하는 식물을 식별 합니다. 3-5 잎 비교적 큰 표면 영역을 개발할 때까지 또 다른 2-3 주에 대 한 식물을 성장.
    2. 식물 당 최대 성숙한 잎을 선택 하 고 왁 스 층을 제거 하는 손가락으로 부드럽게 잎의 표면을 문질러 (6.3.1 단계)에서 희석된 바스 솔루션의 드롭 장소.
      참고: 그만하 라고 드롭과 가까운 줄기에 종이 테이프를 배치 하 여 적용 하는 잎의 위치를 표시 합니다.
    3. 나뭇잎 바스 드롭 최대 1 주일까지 들고의 흔적에 대 한 적용을 모니터링 합니다. 그만하 라고 상품에 의해 영향을 받지 않는 잎을 가진 식물을 선택 합니다.
      참고: 가장 거짓 양성 식물에서 잎 바스 솔루션의 드롭그림 3(C) 건조 후에 진정한 긍정에서 잎은 그대로 2 일 이내 시 들고를 시작 합니다.
  5. 긍정적인 transformants 게놈 PCR를 사용 하 여 확인 합니다.
    1. 2-3 잎 단계 6.4.5에서 살아남은 식물에서 수집 합니다.
    2. CTAB 방법23 또는 다른 적절 한 DNA 추출 방법을 사용 하 여 잎에서 게놈 DNA를 추출 합니다.
    3. (긍정적인 컨트롤로) 대상 식물, 야생-타입 식물 (컨트롤로 부정적인), 단계 3.1에서에서 플라스 미드 구조에서 추출 된 genomic DNA 견본을 사용 하 여 PCR을 수행 합니다. 예를 들어 선택적 마커 유전자 특정 PCR 뇌관의 적절 한 쌍을 사용 하 여, 라고 내성 유전자 (), TCAGCAGGTGGGTGTAGA (앞으로)와 GTCAACCACTACATCGAGACAA (반전)에 대 한.
      1. 예제에서는 PCR 뇌관 유전자를 대상으로 사용 하 여 다음 PCR 조건: 30 98 ° C에 초기 변성 단계 s; 뒤에 98 ° C 30에서 변성 시키기의 30 주기 s, 59 ° C 30에서 어 닐 링 s, 그리고 30 대 72 ° C에서 확장 s; 그리고 5 분 동안 72 ° C에서 최종 확장.
        참고: 전체 T-DNA의 삽입을 위해,이 좋습니다 또한 선택적 마커 유전자에서 PCR 뇌관을 사용 하 여 게놈 PCR을 수행 하 고 다른 PCR 뇌관 대상 시퀀스에 단계에서 공장 변환 벡터를 복제
    4. Agarose 젤 전기 이동 법17 대상 샘플(그림 4)에 대 한 뿐만 아니라 사용 하 여 격리 된 PCR 제품19 시퀀싱 증폭된 PCR 제품의 예상된 크기의 존재를 확인 2.1 단계 에서처럼 동일한 절차입니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

우리는 150 일 이내 T0 씨앗의 수확을 가능 하 게 변환 프로토콜을 A. thaliana에서 수정 꽃 딥 방법을 사용 하 여 개발 했다. 그림 1 타임 라인 및 S. parvula 식물 꽃 딥 통해 변화를 실행 하기 위한 최적의 단계를 나타내는 요약을 보여 줍니다. 우리는 변환에 대 한 대상 무대도 발 아 후 60-80 일에 여러 inflorescences에 S. parvula 70 –80 꽃을 가진 식물을 선택. 기존의 오픈 또는 수정 된 꽃 및이 단계에서 siliques의 작은 수 꽃 dip 방법으로 A. tumefaciens 침투 하기 전에 제거 되었다. A. tumefaciens 감염 (그림 2(a) 괄호) 꽃의 낙태 귀착되는. Siliques 꽃 딥 변형된 씨앗 (그림 2, 브래킷 (b))을 포함 것 후에 완벽 하 게 개발. 변환 후에 미 parvula 으로 식물 건강 (그림 2, 흰색 화살표)를 유지 했다 새로운 inflorescences와 꽃 개발을 계속 했다. 이 미정 개화 습관 때문 식물 스트레스 나 노화의 징후를 표시 하지 않습니다 경우 변환의 두 번째 라운드를 수행할 수 있습니다. 그림 2 A2B 보여줍니다 S. parvula 식물의 변환의 첫 번째 및 두 번째 라운드 후 각각 서로 25 일. 두 번째 변환에서 기존 siliques 해야 제거할 수 없습니다 때문에 그들은 유전자 변형 종자를 포함 될 수 있습니다. 또한, A. tumefaciens 적용할 수 pipetting 침투 솔루션 (표 1)에 의해 새로 신흥 꽃 클러스터, 처음부터 siliques을 피해를 최소화 하기 위해 솔루션으로 전체 촬영을 찍기 대신에 변환입니다.

변환 효율은 현재 프로토콜을 사용 하 여 전파 하는 10000 T1 씨앗 당 3-4 유전자 변형 식물 저조한 0.033%. 이 예상 ~ 50000 T1 씨앗 10 독립적인 변환 시도 하는 동안 테스트를 기반으로 합니다. 효율성은 애기 thaliana보다 낮은, 그것은 다른 extremophyte 식물 Eutrema salsugenium24 의 변화와 애기 thaliana ecotypes25의 일부에 비해. 변환 효율 대체 Agrobacterium 긴장 및 계면 활성 제와 침투 솔루션의 수정을 사용 하 여 추가 최적화 될 수 있습니다. 여러 바스 스프레이 드롭 테스트 (6.3, 6.4 단계) 진정한 긍정적인 transformants를 확인 하 고 샘플 단계 6.5(그림 4)에서 PCR 확인을 사용 하 여 테스트의 수를 감소에 중요 한 것. 복제 시퀀스 취재 원 유전자 (그림 4B) 포함 되어 있는 경우 변환의 더 확인 취재 원 유전자 발현을 확인할 수 있습니다.

Figure 1
그림 1 : S. parvula 변환의 타임 라인. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: S. parvula 식물 꽃 dip.로 변환 후 식물 촬영된 10 일 후에 첫 번째 꽃-하루 60 (A)과 25 일 꽃-딥 하루 85 (B)에서 두 번째 라운드 후 했다. Agrobacterium 와 침투 괄호는 에서 같이 꽃의 silique 개발을 중단 수 있습니다. Siliques 꽃 딥 변형된 씨앗 (대괄호 b)를 포함할 가능성이 후에 완전 개발. 흰색 화살표는 꽃과 inflorescences 각 변환 후 새로 등장을 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3 : 그만하 라고 저항을 기반으로 하는 다양 한 미 parvula transformants. (A) 바스 스프레이 하기 전에 T1 묘. (B) 빨간색 원이 1 라운드 선택 바스 스프레이 의해 살아남은 후보자 transformant를 나타냅니다. (C) 라고 하 여 두 번째 라운드 선택 드롭 테스트 합니다. 가양성 (상단 패널)와 진정한 유전자 변형 식물 (하단 패널)의 예로 표시 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4 : S. parvula 변환 확인. S. parvula 식물에서 추출한 게놈 DNAs에서 유전자의의 (A) PCR 증폭 레인 1과 13: 크기 마커; 레인 2: 부정적인 제어; 레인 3-5: 야생-타입 S. parvula ; 레인 6-10: 유전자 변형 미 parvula 후보자; 레인 11, 12: 벡터 제어 합니다. 7, 8, 및 9 레인 예증 긍정적인 transformants. 긍정적인 거 스 기자 유전자 발현의 (B) 예 미 parvula transformant. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

미디어 / 솔루션 시 약 금액
Luria Bertani (파운드) 세균성 성장 미디어 NaCl
Tryptone
효 모 추출 물
한 천 (번호판)에 대 한
ddH2O
10 g
10 g
5 g
20 g
955 mL
Agrobacterium 침투 솔루션 MS 소금 (1/4 x)
B5 비타민 (1x)
자당 (5%w/v)
MES
N6-benzylaminopurine (BA)
Silwet L-77 (0.05%v/v)
pH
2.16 g
1 mL
50 g
0.5 g
10 Μ L
500 Μ
5.7

표 1: 세균성 성장 매체의 구성 및 Agrobacterium 침투 솔루션.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

식물의 생리 적 상태 변환25의 효율을 크게 영향을 줍니다. 변환에 대 한 건강 하 고 활기찬 식물의 사용 S. parvula에서 성공적인 변환에 대 한 주요 요구 사항입니다. 물 또는 가벼운 스트레스 식물 변환 (그림 1, 센터 패널)에 대 한 이상적인 건강 한 식물에 비해 적은 꽃 있을 것 이다. S. parvula 는 빛의 강도에 성장할 수 있는 보다 작은 130 µmol m-2의 -1하지만 식물 경향이 frailer; 이러한 식물 들이 더 이어질 것 이다 꽃 꽃 찍어 다음 중단. S. parvula 보다 더 높은 속도로 Agrobacterium 담근 꽃을 중단 하는 경향이 있다 A. thaliana. 따라서, 중단된 꽃 A. tumefaciens 침투 솔루션에서는 감소 하는 경우를 최소화 하기 위해 이동 하는 모든 단계는 높은 변환 효율성에 기여 한다. 하루 14 h 보다 더 이상 가벼운 기간을 권장합니다. 종종, A. thaliana 의 변화 또는 지속적인 빛 에서도 긴 하루 조건 (예: 18 h 라이트와 6 h 다크)에 성장 하는 식물에 수행 됩니다. 그러나, 우리는 덜 탄력 S. parvula 식물에 이러한 관행 결과 발견 하 고 낮은 변환 효율으로 이어질.

꽃 봉 오리는 S. parvula (그림 2, 흰색 화살표)의 화 서 축에 지속적으로 생산 됩니다. 따라서, 새로운 꽃의 변화를 수 있도록 긍정적인 transformants를 얻기의 기회가 크게 증가할 것입니다. 두 번째 꽃-수영 (단계 5.3) 필수, 하지만 강력 하 게 제안 하지 않습니다. 그러나,이 단계는 상대적으로 시간이 걸리는 A. thaliana 꽃 찍기에 비해 S. parvula 여러 화 서 축 생산 하기 때문에.

야생-타입 S. parvula 는 비록 바스 스프레이 (단계 6.3) 긍정적인 transformants에 대 한 초기 화면 100 씨앗 세균 (그림 3A3B) 5-8 살아남은 식물을 떠날 것 이다 라고에 민감합니다. 이것의 대부분 (> 80%) 오판이 될 것입니다. 이것은 크게 좁은 잎 형태와 S. parvula의 잎 각도 표현 형을 관찰 하는 충분 한 기간에 대 한 바스 솔루션을 유지 하는 적절 한 방향에 충분 한 잎 표면을 제공 하지 않습니다. 또한, S. parvula10adaxial 잎 표면 왁 스 높은 콘텐츠로 인해 그것은 그만하 라고에 대 한 더 통하지 않는 표면을 만들 경향이 있다. 따라서, 개별 잎 (6.4 그림 3C단계)에 바스 드롭을 사용 하 여 긍정적인 transformants에 대 한 두 번째 검사 PCR 가양성 (단계 6.5)의 수백에 테스트를 피하기 위해 필수적인 단계는.

현재 프로토콜 pMP90RK 플라스 미드를 운반 하 여 A. tumefaciens 긴장 GV3101 테스트 했다. 변환의 효율성 다른 A. tumefaciens 긴장, A. thaliana 에서에서 변환 효율을 높이 보고 pMP90 독성 플라스 미드와 긴장 ABI, LMG20, 및 C58C1 Rifr를 포함 하 여 향상 될 수 있습니다. 25. 브라 시카Eutrema 동물 taxonomically 더 밀접 하 게 관련 parvula S. A. thaliana1에 비해. 따라서, A. tumefaciens 브라시카 napus 및 EHA105 Eutrema salsugineum 를 변환 하는 데 성공적으로 사용 된 더 높은 변환 제공할 수 있습니다 긴장을 변환 하는 데 성공적으로 사용 된 LBA4404 변형 긴장의 보고 된 효율 보다 효율은 현재26,,2728을 사용합니다.

시간과 노동 변환 프로토콜에 필요한 변환 효율 향상에 또 다른 중요 한 요소 이다. 잎에 개별 바스 방울을 배치 하 고 여러 식물 (단계 6.4)에 주에 대 한 리프를 모니터링 지루한 있습니다. 변환 효율성을 증가 하는 미래의 노력 적절 한 대체 선택 가능한 마커 유전자29에 대 한 검색 수 있습니다.

설립된 변환 프로토콜의 가용성 크게 유전자 및 생존 여러 abiotic 스트레스2,4extremophyte 모델 식물을 허용 하는 새로운 메커니즘을 식별 하는 우리의 기능을 사전 것입니다. S. parvula 에 새로운 유전 변이 됨으로 상대적으로 스트레스에 민감한 모델, A. thaliana 스트레스 반응 유전자 집단 유전자 변이에서 채굴 될 수 없는 유전 변이의 광범위 한 수영장을 제공 합니다. 팬-게놈5,6. 따라서, 우리의 꽃 딥 기반된 A. tumefaciens 중재 변환 프로토콜 S. parvula 에 대 한 개발 extremophyte 모델 A. 밀접 하 게 관련 기능 게놈 실험을 수행 하기 위해 이러한 도구에 대 한 필요성에 대 한 갭을 채울 것입니다. thaliana.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgments

이 작품은 국립 과학 재단 수상 MCB 1616827에 의해 지원 되었다.

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).
식물 성장 및 Extremophyte <em>Schrenkiella parvula</em> 의 꽃-딥 변환 Agrobacterium 중재
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).More

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter