Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Planta de crescimento e transformação de Floral-mergulho mediada por Agrobacterium do Extremophyte Schrenkiella parvula

doi: 10.3791/58544 Published: January 7, 2019

Summary

Transformação mediada por Agrobacterium, usando um método de imersão floral pode ser empregada com sucesso para criar linhas transgênicas estáveis do modelo extremophyte Schrenkiella parvula. Apresentamos um protocolo modificado do que para a Arabidopsis thaliana, considerando o crescimento de diferentes hábitos e características fisiológicas do extremophyte.

Abstract

Schrenkiella parvula é uma extremophyte adaptada a vários estresses abióticos, incluindo várias tensões de toxicidade do íon. Apesar da alta qualidade genômicos recursos disponíveis estudar como as plantas se adaptam ao meio ambiente salienta, seu valor como um modelo de genômica funcional e ferramenta tem sido limitada pela falta de um sistema de transformação praticável. Neste protocolo, relatamos como gerar transgénicos estável S. parvula linhas usando um método de imersão floral mediada por Agrobacterium. Nós modificamos o protocolo de transformação utilizado para a. thaliana para contabilizar características únicas de S. parvula, como um hábito de florescimento indeterminado e um teor de ceras epicuticulares alta nas folhas. Brevemente, S. parvula sementes foram estratificadas em 4 ° C por cinco dias antes do plantio. As plantas foram cultivadas em um fotoperíodo de uma luz de 14 h e 10 h escuro e uma 130 µmol m-2s-1 intensidade luminosa, a 22 ° C a 24 ° C. Oito a nove semanas plantas com várias inflorescências foram selecionados para a transformação. Estas inflorescências foram mergulhadas em uma solução de infiltração de Agrobacterium tumefaciens GV3101 carregando o plasmídeo pMP90RK . Foram realizadas duas rodadas de flor mergulhando com um intervalo de três a quatro semanas para aumentar a eficiência de transformação. As sementes de T1 foram coletadas e secas por quatro semanas em um recipiente com dessecantes antes de germinação a tela para o candidato transformado linhas. Resistência à BASTA foi usada para plantas T1 de tela. Atingimos a solução BASTA três vezes com um intervalo de três dias, começando com duas semanas de plantas para reduzir falsos positivos. Um teste de gota BASTA foi realizado em sobreviver plantas individuais para identificar o verdadeiro transformants positivo. A eficiência de transformação foi 0.033%, rendendo 3 – 4 plantas transgénicas por 10.000 sementes de T1 propagadas.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Neste protocolo, descrevemos o crescimento e a criação de linhas transgênicas estáveis para o modelo extremophyte Schrenkiella parvula. A disponibilidade de um sistema eficiente de transformação é uma marca registrada de qualquer modelo genético versátil. Plantas que prosperam em ambientes extremos, referido como extremophytes, fornecem um recurso crítico para compreender as adaptações de plantas a estresses ambientais. Schrenkiella parvula (anteriormente Thellungiella parvula e Eutrema parvulum) é um tal modelo de extremophyte, com a expansão de recursos genômicos1,2,3,4,5. No entanto, os protocolos de transformação não ainda foram relatados para S. parvula em estudos publicados.

O genoma de S. parvula é o primeiro genoma de extremophyte publicado em Brassicaceae (repolho mostarda família) e mostra uma extensa synteny geral do genoma com o modelo de não-extremophyte, Arabidopsis thaliana1. Assim, estudos comparativos entre a. thaliana e S. parvula poderiam se beneficiar da riqueza dos estudos genéticos realizado na a. thaliana tornar informativos hipóteses sobre como o genoma de s. parvula evoluiu e regulamentada forma diferente para lidar com extrema ambiental salienta5,6,7. S. parvula é uma das espécies mais tolerante a sal (baseadas no solo NaCl LD50) entre parentes silvestres conhecidos da . thaliana8. Além da tolerância de NaCl, S. parvula sobrevive e completa seu ciclo de vida na presença de vários íons de sal em altas concentrações tóxicas para a maioria das plantas7. Em resposta às estresses abióticos prevalentes em seu habitat natural, evoluiu várias características, entre os quais vários têm sido estudados com a bioquímica ou fisiológica nível 8,9,10, 11.

Desde 2010, foram mais de 400 publicações peer-reveiwed que usou S. parvula como espécie-alvo ou usado em uma comparação com outras genomas de planta. No entanto, um gargalo claro poderia ser identificado com um olhar mais atento de que tipo de estudos têm sido realizados. A maioria destes relatórios discutir o potencial de uso dos S. parvula em estudos futuros, ou usá-lo em Genômica comparativa ou estudos filogenéticas. Devido à falta de um protocolo de transformação de prova de conceito estabelecido para S. parvula, ela não tem sido usada em estudos de genômicos funcionais, apesar de ter um dos genomas de planta mais alta qualidade disponíveis até à data (> 5 Mb contig N50) montado e anotados em pseudomolecules cromossomo-nível1.

O método de transformação mediada por Agrobacterium de floral-mergulho tornou-se o método mais amplamente utilizado para criar linhas de trasngenic na . thaliana, e o desenvolvimento de um sistema reprodutível da transformação foi um fator crítico de seu sucesso como um modelo genético12,13. No entanto, nem todas as espécies de Brassicaceae foram mostradas para ser com êxito transformada usando o método de imersão floral desenvolvido pela . thaliana. Especialmente, as espécies de Brassicaceae Lineage II que incluem S. parvula tem sido recalcitrantes a transformação com base floral-mergulho métodos14,15.

O hábito de crescimento indeterminado floração de S. parvula, combinada com sua morfologia de folhas estreitas tornou desafiador para adotar o método de transformação de floral-mergulho padrão mediada por Agrobacterium. Neste estudo, nós relatamos o protocolo modificado que desenvolvemos para transformação reprodutível de S. parvula.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. crescimento da planta

  1. Esterilização de sementes (opcional)
    1. Prepare-se 50% de lixívia em água bidestilada (ddH2O) com 1 ou 2 gotas de um detergente não-iônico (ver Tabela de materiais) em um tubo de 50 mL. Inverta o tubo várias vezes para misturar a solução.
      Nota: É preferível realizar a esterilização de sementes em um fluxo laminar com uma superfície esterilizada UV durante 15 minutos.
    2. Adicionar a solução de lixívia a ~ 100-200 S. parvula sementes em um tubo de 1,5 mL. Misture bem e deixe o tubo descansar por 5 min.
    3. Remover o descorante do tubo e adicionar etanol a 70%. Lave as sementes pipetando várias vezes e em seguida, retire imediatamente a solução de etanol.
    4. Lave as sementes em água esterilizada para remover etanol e água sanitária em excesso e, em seguida, retire a água. Repita essa etapa 5 a 6 vezes.
  2. Estratificação de sementes
    1. Mergulhe as sementes em água esterilizada e armazenar durante 5 a 7 dias a 4 ° C. Alternativamente, semear sementes secas esterilizadas, diretamente no solo úmido e coloque a bandeja de solo por 5 a 7 dias a 4 ° C.
  3. Cultivo de plantas na preparação de transformação
    1. Preencher o solo misturar (ver Tabela de materiais) em potes de2 7 x 6 cm, mergulhe os potes de água e pulverizar a água da parte superior para assegurar um meio de crescimento uniformemente molhado. Adicione 5 – fertilizante grânulos (ver Tabela de materiais) na superfície do solo de cada pote.
      Nota: Tanto quanto vivemos, S. parvula cresce bem em qualquer mistura de solo onde a. thaliana pode crescer.
    2. Usando um palito de dente molhado, transferir 20 ~ 25 sementes por vaso na superfície do solo.
      Nota: Uma prática conveniente é colocar um lote de 4-5 sementes nos quatro cantos e o centro do pote (Figura 1, dia 15, painel esquerdo).
    3. Cubra a bandeja do pote com uma cúpula clara para manter as sementes sob alta umidade durante a germinação.
    4. Mantenha as bandejas de planta em uma câmara de crescimento com uma intensidade de luz em 130 µmol m− 2 s− 1 luz, temperatura de 22 a 24 ° C e 14 h por dia/10 h por ciclo de noite. Remova as cúpulas após 7-10 dias após a germinação. Adicione a água do fundo da bandeja para manter o solo umedecido uniformemente em um nível desejável.
    5. Eliminar mudas extras e deixar apenas 4-5 saudável mudas por vaso bem separado umas das outras (Figura 1, dia 15, painel direito).
    6. Delicadamente, regar as plantas a cada dois dias e fertilizar com 0.2 x de solução de Hoagland16 uma vez a cada duas semanas.
      Nota: Manter a umidade do solo em um nível uniforme é chave para crescimento S. parvula consistentemente e de forma saudável.
    7. Continuam a crescer as plantas durante 8-10 semanas até várias inflorescências produzem botões florais de 100 – 150 por planta (Figura 1, dia 60-80). No dia planejado para a transformação com base floral-mergulho (etapa 4.5), remova todos os siliques maduros e em desenvolvimento das plantas.

2. clonagem do Gene/genômica elemento de interesse em um vetor para transformação de planta

  1. Amplificar o fragmento de DNA alvo usando o polymerase reação em cadeia (PCR)17 e isolar o produto do PCR usando uma gel de extração kit (veja a Tabela de materiais) de acordo com o protocolo do kit ou qualquer outro método adequado para purificar DNA utilizando gel de agarose eletroforese de17,18. Verifique se a sequência do produto do PCR isolada através de de sequenciamento Sanger19.
  2. Clone o produto desejado de PCR para o vetor clonagem e transformar a construção clonada para o competente Escherichia coli células usando uma clonagem baseada em topoisomerase kit (veja a Tabela de materiais) seguindo as orientações do fabricante.
  3. Espalhe 50 µ l de produtos transformados em20 (LB) Luria-Bertani media ágar crescimento bacteriano (tabela 1) com antibióticos adequados, ex., 50 µ g / mL espectinomicina (ver Tabela de materiais) e incubar a 37 ° C durante a noite.
  4. No dia seguinte, selecionar colônias única de 5 – 10, inocular em meio líquido de LB com antibióticos apropriados e incubar com agitação suave a 37 ° C durante a noite.
  5. Plasmídeos isolados usando um isolamento de plasmídeo kit (veja a Tabela de materiais) e verificar através de de sequenciamento Sanger19 se a sequência do alvo amplificada em 2.1 é adequadamente clonada.
  6. Transferir o produto PCR clonado e verificado a um vetor de destino para a transformação da planta compatível com baseados na recombinação clonagem (ver Tabela de materiais), usando uma mistura de enzima recombinase kit seguinte (ver Tabela de materiais), instruções do fabricante kit. Repita da etapa 2.3 para etapa 2.5 para isolar e verificar clones abrigar construções de plasmídeo adequado.

3. transformando construir o vetor para transformação da planta em Agrobacterium tumefaciens

  1. Transforme o plasmídeo da construção de vetor de 2.6 para a cepa da . tumefaciens GV3101:pMP90RK21, que abriga um gene de resistência a rifampicina para seleção de fundo cromossômico. Usar antibióticos apropriados, por exemplo, gentamicina ou canamicina (ver Tabela de materiais), para a seleção de planta transformação construir (plasmídeo Ti). Um protocolo breve para transformação da . tumefaciens através de electroporation está incluído na seção 3.2.
  2. A. tumefaciens transformação por eletroporação
    1. Descongele a . tumefaciens células competentes22 no gelo. Mix de 0,1 – 1 µ g do plasmídeo preparado a partir de 2.6, dissolvido em 1-2 µ l de DDQ2O, com células competentes no gelo. Transfira a mistura para uma cubeta de eletroporação (ver Tabela de materiais).
    2. Executar electroporation sobre a mistura de plasmídeos e células competentes de 3.2.1, usando um electroporator (ver Tabela de materiais) seguindo as orientações do fabricante.
      Nota: Limpe a superfície da cubeta antes de iniciar a eletroporação.
    3. Transfira a mistura de reação da cubeta para um tubo de microcentrifugadora que contém 1,5 mL de LB líquido e misture bem com a pipetagem e incubar durante 1 h a 28 ° C, com agitação suave.
  3. Inocular o transformado a. tumefaciens da seção 3.2 LB placas contendo antibióticos seleção apropriada (por exemplo, canamicina 25 µ g / mL, espectinomicina 50 µ g / mL, gentamicina 25 µ g / mL e rifampicina 50 µ g / mL) e incubar a 28 ° C durante 3 dias.

4. mediada por Agrobacterium transformação de S. parvula

  1. Inocular o single transformado colônias de placas em 10 mL de LB mídia líquida contendo antibióticos (as mesmas 3.3) em uma estéril 50 mL cónica do tubo (ver Tabela de materiais). Incubar durante 24 h em uma tremendo incubadora (ver Tabela de materiais) em 250 r.p.m. a 28 ° C.
  2. Transferir a solução bacteriana de 3.4.1 num estéril 250 mL, adicionar 40 mL de meio líquido LB com antibióticos apropriados e incubar 12 h até a densidade óptica em 600 nm comprimento de onda (OD600) atinge cerca de 2.0.
  3. Centrifugue a . tumefaciens cultureat 3.100 x g durante 10 min. Retire o sobrenadante e ressuspender a cultura bacteriana em 40 mL de solução de infiltração da . tumefaciens (tabela 1).
  4. Dilua a ressuspensão a. tumefaciens com solução de infiltração para um final OD600 de 0,8. Adicione 25 µ l da solução de surfactante (tabela 1) a 50 mL de diluídos a. tumefaciens solução e mistura várias vezes por inversão.
  5. Mergulhe a inflorescência das plantas na solução a. tumefaciens preparada na seção 4.4 para 20 s. uso uma solução bacteriana fresca após mergulhar a inflorescência de seis potes. Certifique-se de todas as flores estão em contacto com a solução. Soluções bacterianas Pipetar diretamente sobre flores, localizadas na parte inferior da inflorescência, se eles não podem ser mergulhados em solução.
    Nota: Para a transformação da primeira rodada, certifique-se de remover todos os siliques maduros e em desenvolvimento, usando um bisturi afiado ou tesouras pequenas. Não remova siliques se realizando a transformação pela segunda vez.

5. pós-transformação planta cuidados e a segunda transformação

  1. Coloque as plantas florais-mergulhado na horizontal em bandejas limpas com cúpulas para cobrir as plantas e colocar em um quarto escuro de crescimento por 1 – 2 dias.
    Nota: Mantendo as flores sob alta umidade é importante nesta fase (Figura 1, as plantas depois da transformação).
  2. Retorno as plantas para uma posição ereta e transferir as plantas para uma sala de crescimento com 14 h por dia/10 h por ciclo de noite, 130 µmol m-2 s-1 intensidade luminosa e temperatura de 22 a 24 ° C.
  3. Monitore as inflorescências mergulhadas na semana seguinte. Se um número significativo de flores abortar (Figura 2), repeti o mergulho floral (etapa 4) após cerca de 4 semanas ou depois de um grande número de flores recém desenvolvido.
    Nota: Ao contrário da etapa de preparação para a primeira transformação (etapa 1.3.7), não remova pre-existentes ou desenvolver siliques (Figura 2) antes da segunda rodada de transformação.
  4. Crescem as plantas até que as sementes maduras e colhem sementes em ~ 21 semanas.
  5. Sementes secas por 2 – 3 semanas à temperatura ambiente em um recipiente hermético com cheio de dessecantes (ver Tabela de materiais).

6. seleção de Transformants positivo

  1. Plante as sementes de T1, conforme descrito para as sementes de tipo selvagem em passos de 1.2 a 1.3.
  2. Crescem as plantas até desenvolvem as 2 primeiras folhas verdadeiras, cerca de 10 a 14 dias após a germinação.
  3. Realize a primeira seleção para resistência a herbicida (Figura 3A e 3B) como detalhado abaixo.
    1. Diluir o herbicida glufosinato-amônio (11,3%) (ou BASTA) (tabela 1) para 1:1,000 (v/v). Pulverizar a solução diluída BASTA sobre as mudas e cobrir as plantas com cúpulas durante a noite.
    2. Repita BASTA pulverizar a 2-3 vezes a cada 5 a 7 dias.
  4. Realize a segunda seleção usando um teste BASTA soltar conforme detalhado abaixo.
    1. Identifica as plantas que sobrevivem após ser aplicado 3 a 4 vezes com solução BASTA. Crescem as plantas por mais 2-3 semanas até 3-5 folhas desenvolvem uma área de superfície relativamente grande.
    2. Selecione a maior folha madura por planta, friccione a superfície da folha suavemente com um dedo para remover a camada de cera e coloque uma gota de solução diluída BASTA (da etapa 6.3.1).
      Nota: Marca a localização da folha aplicada com a gota BASTA colocando uma fita de papel no caule mais próximo.
    3. Monitore as folhas aplicadas com a gota BASTA para sinais de murcha por até uma semana. Selecione as plantas com folhas não afetadas pelas gotas BASTA.
      Nota: Folhas de falso-positivos mais plantas começam a murchar dentro de dois dias, enquanto folhas de verdadeiro-positivos estão intactas, mesmo depois que a gota de solução BASTA seca (Figura 3C).
  5. Confirme transformants positivo usando PCR genômico.
    1. 2 – 3 folhas coletadas as plantas sobreviventes em etapa 6.4.5.
    2. Extrai DNA genômico de folhas usando o método CTAB23 ou qualquer outro DNA extração método adequado.
    3. Realize PCR usando extraídas amostras de DNA genômicas de alvo plantas, plantas de tipo selvagem (como controles negativos) e a construção de plasmídeo da etapa 3.1 (como um controle positivo). Usar um adequado par de primers PCR específicos para o gene marcador seletivo, por exemplo,, para gene BASTA-resistente (bar), TCAGCAGGTGGGTGTAGA (em frente) e GTCAACCACTACATCGAGACAA (reverso).
      1. Para os primers PCR exemplo como alvo o gene bar , use as seguintes condições PCR: a etapa de desnaturação inicial a 98 ° C por 30 s; seguido de 30 ciclos de desnaturação a 98 ° C por 30 s, recozendo a 59 ° C por 30 s e estendendo-se a 72 ° C por 30 s; e a extensão final a 72 ° C por 5 min.
        Nota: Para garantir a inserção do T-DNA inteiro, recomendamos também realizando genomic PCR usando uma primeira demão do PCR do gene marcador seletivo e outro primer PCR específico para a sequência do alvo clonado para o vetor de transformação de plantas no passo
    4. Confirmar a presença do tamanho esperado do produto da PCR amplificados bar por de eletroforese de gel de agarose17 para as amostras de alvo(Figura 4), bem como pelo sequenciamento do isolado do PCR produto19 usando o mesmo procedimento como no passo 2.1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Desenvolvemos um protocolo de transformação que permite a colheita de sementes de T0 no prazo de 150 dias, usando um método de imersão floral modificado do que para a. thaliana. A Figura 1 mostra um resumo do cronograma e S. parvula plantas que representam o palco ideal para executar a transformação através de imersão floral. Nós selecionamos S. parvula plantas com flores de 70 –80 em várias inflorescências em 60-80 dias após a germinação como a fase de destino para a transformação. Um pequeno número de flores abertas ou fertilizadas pré-existentes e siliques nesta fase foram retirado antes da infiltração da . tumefaciens pelo método de imersão a floral. Infecção com a. tumefaciens resultou em aborto de flores (Figura 2, suporte (a)). Siliques totalmente desenvolvido após o floral-dip são susceptíveis de conter sementes transformadas (Figura 2, suporte (b)). Mesmo após a transformação, S. parvula continuou a desenvolver novas inflorescências e flores, enquanto as plantas foram mantidas saudáveis (Figura 2, setas brancas). Devido a este hábito de florescimento indeterminado, uma segunda rodada de transformação pode ser executada se a planta não mostra sinais de stress ou senescência. Figura 2 A e 2B mostram exemplos de plantas de S. parvula após a primeira e a segunda rodada de transformação, respectivamente, 25 dias separados um do outro. Na segunda transformação, siliques existentes não devem ser removidas pois eles podem conter sementes transgênicas. Além disso, a a. tumefaciens pode ser aplicado pipetando a solução de infiltração (tabela 1) para novos emergentes, conjuntos de flor, em vez de mergulhar o tiro todo a solução, para minimizar os danos à siliques do primeiro transformação.

A eficiência de transformação é 0.033%, rendendo 3 – 4 plantas transgénicas por 10.000 sementes de T1 propagadas usando o protocolo atual. Esta estimativa baseia-se na ~ 50.000 T1 sementes testadas durante dez tentativas de transformação independente. Enquanto a eficiência é menor do que a Arabidopsis thaliana, é comparável a transformação de um outro extremophyte planta Eutrema salsugenium24 e alguns dos de ecótipos de Arabidopsis thaliana 25. A eficiência de transformação pode ser ainda mais otimizada usando cepas de Agrobacterium alternativas e modificações de surfactante e infiltração de soluções. BASTA a vários testes de spray e gota (passos 6.3 e 6.4) será fundamentais para identificar o verdadeiro transformants positivos e reduzir o número de amostras testadas usando a confirmação de PCR na etapa 6.5(Figura 4). Mais uma confirmação da transformação pode ser verificada com uma expressão de gene repórter, se a sequência clonada inclui um gene repórter (Figura 4B).

Figure 1
Figura 1 : Linha do tempo da transformação S. parvula . Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: S. parvula plantas após transformação por floral-patê As plantas foram fotografados a 10 dias após o primeiro floral-mergulho em 60 dias (A) e 25 dias após a segunda rodada de floral-mergulho no dia 85 (B). Infiltração com Agrobacterium pode abortar o desenvolvimento síliqua de flores como mostrado em suportes um. Siliques totalmente desenvolvido depois floral-mergulho são susceptíveis de conter sementes transformadas (suportes b). As setas brancas indicam que flores e inflorescências recém emergiram após cada transformação. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Seleção de S. parvula transformants com base na resistência BASTA. (A) T1 mudas antes do spray BASTA. (B) círculo vermelho indica um candidato transformantes sobrevivendo a primeira rodada seleção pelo spray BASTA. (C) a segunda rodada de seleção por BASTA teste de gota. Um exemplo de falsos positivos (painel superior) e plantas transgénicas verdadeiras (painel inferior) são mostrados. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4 : Confirmação da transformação S. parvula . (A), PCR amplificação do gene do bar de DNAs genomic extraídos de plantas de S. parvula . Pista 1 e 13: tamanho marcadores; Pista 2: controle negativo; Faixa 3-5: selvagem-tipo S. parvula ; Faixa 6-10: transgénicos S. parvula candidatos; Lane, 11, 12: controle de vetores. Lanes, 7, 8 e 9 exemplificam transformants positivo. (B) exemplo de expressão do gene repórter GUS em um positivo S. parvula transformantes. Clique aqui para ver uma versão maior desta figura.

Mídia / solução Reagente Quantidade
Mídia de crescimento bacteriano de Luria-Bertani (LB) NaCl
Triptona
Extrato de levedura
Ágar-ágar (para placas)
ddH2O
10 g
10 g
5 g
20 g
955 mL
Solução de infiltração de Agrobacterium Sal de MS (1/4 x)
Vitaminas B5 (1x)
Sacarose (5%w/v)
MES
N. o6- benzylaminopurine (BA)
Silwet L-77 (0.05%v/v)
pH
2,16 g
1 mL
50 g
0,5 g
10 Μ l
500 ΜL
5.7

Tabela 1: composição dos meios de crescimento bacteriano e Agrobacterium solução de infiltração.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O estado fisiológico da planta influencia significativamente a eficiência de transformação25. O uso de plantas saudáveis e vigorosas para transformação é um requisito-chave para a transformação bem sucedida em S. parvula. Água ou plantas estressadas luz terá menos flores em comparação com as ideal de transformação (Figura 1, painel central) de plantas saudáveis. S. parvula pode crescer em uma intensidade de luz menos de 130 µmol m-2 s-1, mas as plantas tendem a ser frailer; tais plantas conduziria a mais abortada flores floral-mergulhe a seguir. S. parvula tende a anular as flores Agrobacterium-mergulhada em uma taxa maior do que a. thaliana. Portanto, cada passo tomado para minimizar flores abortadas quando mergulhado na solução de infiltração da . tumefaciens contribui para uma maior eficiência de transformação. Recomendamos um período luz não superior a 14 h por dia. Muitas vezes, transformação da . thaliana é realizada em plantas cultivadas em uma condição de longo-dia (por exemplo, luz 18 h e 6 h escuro) ou mesmo sob luz contínua. No entanto, encontramos tal resultado de práticas em plantas menos resistentes de S. parvula e conduzir a uma eficiência de transformação de baixo.

Botões de flores são produzidos continuamente sobre os eixos de inflorescência de S. parvula (Figura 2, setas brancas). Portanto, permitindo a transformação de novas flores iria aumentar significativamente as chances de transformants positivo. Um segundo floral-mergulho (etapa 5.3) não é essencial, mas sugeriu fortemente. No entanto, esta etapa é relativamente demorada comparado à . thaliana floral mergulhando, porque S. parvula produz vários eixos de inflorescência.

Selvagem-tipo S. parvula é sensível a BASTA, embora a tela inicial para o transformants positivo com spray BASTA (etapa 6.3) vai deixar de 5 a 8 plantas sobreviventes fora 100 sementes germinadas (Figura 3A e 3B). Isto a maioria (> 80%) serão falsos positivos. Isto é principalmente devido a forma de folhas estreitas e o ângulo da folha de S. parvula, que não fornecem suficiente superfície foliar em uma orientação adequada para reter a solução BASTA por um tempo suficiente para observar um fenótipo. Além disso, devido ao teor elevado de cera da superfície adaxial da folha de S. parvula10, tende a criar uma superfície mais impermeável para BASTA. Portanto, a segunda triagem para positivo transformants usando uma gota BASTA em folhas individuais (etapa 6.4, Figura 3C) é um passo essencial para evitar PCR testes em centenas de falsos positivos (passo 6.5).

O atual protocolo foi testado com a cepa da . tumefaciens GV3101 carregando o plasmídeo pMP90RK . A eficiência de transformação pode ser melhorada com outras cepas da . tumefaciens , incluindo cepas ABI, LMG20 e C58C1 Rifr, com o plasmídeo de virulência pMP90 relatado para aumentar a eficiência de transformação em a. thaliana 25. espécie Brassica e Eutrema taxonomicamente está mais estreitamente relacionado com s. parvula comparado a. thaliana1. Portanto, a a. tumefaciens estirpe LBA4404 que foi usado com sucesso para transformar a estirpe EHA105 que tem sido usada com sucesso para transformar Eutrema salsugineum pode oferecer uma maior transformação e Brassica napus eficiência do que o relatado eficiência da estirpe utilizada atualmente26,,27,28.

Reduzindo o tempo e o trabalho necessário por um protocolo de transformação é outro fator significativo na melhoria da eficiência da transformação. Colocação individual BASTA gotas nas folhas e monitoramento da folha por uma semana em várias plantas (etapa 6.4) são entediantes. Um futuro esforço para aumentar a eficiência de transformação poderia procurar marcador selecionável alternativo adequado genes29.

A disponibilidade de um protocolo de transformação estabelecida avançará significativamente nossa capacidade de identificar genes e novos mecanismos que permitem que plantas de modelo extremophyte sobreviver vários estresses abióticos2,4. Variação genética romance em S. parvula fornecerá uma ampla piscina de variação genética que não pode ser extraída a variação alélica coletiva identificada como stress-responsivo genes no modelo relativamente sensíveis ao stress, a. thaliana Pangenoma5,6. Portanto, nosso mergulho-floral com base a. tumefaciens mediada protocolo de transformação desenvolvido para S. parvula irá preencher uma lacuna para a necessidade de tais ferramentas realizar experiências de genômicas funcionais em um modelo de extremophyte intimamente relacionado com A. thaliana.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Este trabalho foi apoiado por um prêmio da National Science Foundation 1616827 MCB.

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).
Planta de crescimento e transformação de Floral-mergulho mediada por Agrobacterium do Extremophyte <em>Schrenkiella parvula</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).More

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter