Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Planta de crecimiento y transformación mediada por Agrobacterium de baño Floral de la Extremophyte Schrenkiella parvula

doi: 10.3791/58544 Published: January 7, 2019

Summary

Transformación mediada por Agrobacterium utilizando un método de inmersión floral puede ser empleado con éxito para crear líneas transgénicas estables del modelo extremophyte Schrenkiella parvula. Presentamos un protocolo modificado de eso para Arabidopsis thaliana, teniendo en cuenta los hábitos de crecimiento diferentes y características fisiológicas de la extremophyte.

Abstract

Schrenkiella parvula es un extremophyte adaptado a varios abiótico, incluyendo múltiples tensiones de la toxicidad de iones. A pesar de recursos genómicos de alta calidad disponibles para el estudio de cómo las plantas se adaptan a ambiente destaca, su valor como un modelo de genómica funcional y la herramienta ha sido limitada por la falta de un sistema de transformación posible. En este protocolo, informe cómo generar transgénicos estable S. parvula líneas utilizando un método de inmersión floral mediada por Agrobacterium. Modificamos el protocolo de transformación utilizado para a. thaliana para tener en cuenta las características únicas de S. parvula, como un hábito de floración indeterminada y un contenido alto de cera epicuticular en las hojas. Brevemente, las semillas de S. parvula se estratificaron a 4 ° C durante cinco días antes de la siembra. Las plantas fueron cultivadas en un fotoperiodo de luz 14 h y 10 h oscuro y una 130 μmol m-2s-1 intensidad de la luz, a 22 ° C a 24 ° C. Ocho a nueve semanas de edad las plantas con inflorescencias múltiples fueron seleccionado para la transformación. Estas inflorescencias se sumergieron en una solución de infiltración de Agrobacterium tumefaciens GV3101 llevan el plásmido pMP90RK . Se realizaron dos rondas de flor de inmersión con un intervalo de tres a cuatro semanas para aumentar la eficiencia de transformación. Las semillas de T1 fueron recogidas y secadas durante cuatro semanas en un recipiente con desecante antes de germinación a pantalla para candidato transforma líneas. Resistencia a la BASTA fue utilizada para plantas de T1. Pulveriza la solución BASTA tres veces con un intervalo de tres días a partir de dos semanas de edad las plantas reducir falsos positivos. Se realizó una prueba de gota BASTA de sobrevivir las plantas individuales para identificar transformantes positivo verdadero. La eficiencia de transformación fue 0,033%, obtención de plantas transgénicas de 3 a 4 por 10.000 semillas T1 propagadas.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En este protocolo, se describen el crecimiento y establecimiento de líneas transgénicas estables para el modelo extremophyte Schrenkiella parvula. La disponibilidad de un sistema eficiente de transformación es una característica distintiva de cualquier modelo genético. Plantas que prosperan en ambientes extremos, que se refiere como extremophytes, proporcionan un recurso crítico para la comprensión de adaptaciones de la planta al estrés ambiental. Schrenkiella parvula (anteriormente Thellungiella parvula y Eutrema parvulum) es una modelo extremophyte, con la expansión de recursos genómicos1,2,3,4,5. Sin embargo, protocolos de transformación aún no han sido denunciados por S. parvula en estudios publicados.

El genoma de S. parvula es el primer genoma de extremophyte publicado en Brassicaceae (familia de mostaza-col) y muestra un extenso synteny genoma total con el modelo no-extremophyte,1de Arabidopsis thaliana. Por lo tanto, estudios comparativos entre la a. thaliana y S. parvula podrían beneficiarse de la riqueza de los estudios genéticos realizados en a. thaliana para hacer hipótesis informativas sobre cómo ha evolucionado y regulado el genoma de S. parvula diferente para hacer frente a extremos ambientales destaca5,6,7. Parvula de S. es una de las especies más tolerantes a la sal (basadas en suelo NaCl LD50) entre conocidos parientes silvestres de a. thaliana8. Además de la tolerancia de NaCl, S. parvula sobrevive y completa su ciclo de vida en presencia de varios iones sal a altas concentraciones de tóxicos para la mayoría de las plantas7. En respuesta al estrés abiótico en su hábitat natural, ha evolucionado varios rasgos, entre los cuales varios han sido estudiados en la bioquímica o fisiológica nivel 8,9,10, 11.

Desde 2010, ha habido más de 400 publicaciones peer-reveiwed que utilizan S. parvula como una especie de objetivo o utilizan en comparación con otros genomas de plantas. Sin embargo, un evidente cuello de botella se podía identificar con un vistazo de qué tipo de estudios se han realizado. La mayoría de estos informes discutir el potencial uso de parvula S. en futuros estudios o usos en genómica comparativa y estudios de phylogenomic. Debido a la falta de un protocolo de prueba de concepto de transformación establecido por S. parvula, no se ha utilizado en estudios de genómica funcional, a pesar de tener uno de los genomas de plantas de calidad más alta disponibles hasta la fecha (> 5 Mb contig N50) montado y anotado en pseudomolecules nivel del cromosoma1.

El método de transformación mediada por Agrobacterium de inmersión floral se ha convertido en el método más ampliamente usado para crear líneas trasngenic en a. thaliana, y el desarrollo de un sistema reproducible de transformación fue un factor decisivo en su éxito como una modelo genético12,13. Sin embargo, no todas las especies de Brassicaceae se han demostrado para ser transformado con éxito usando el método de inmersión floral desarrollado de a. thaliana. Especialmente, las especies de Brassicaceae Lineage II que incluyen S. parvula ha sido recalcitrante a los métodos de transformación base floral dip14,15.

El hábito de crecimiento indeterminado de la floración de S. parvula, combinado con su morfología de hoja estrecha, ha hecho difícil adoptar el método de transformación de floral dip estándar mediada por Agrobacterium. En este estudio, Divulgamos el protocolo modificado que hemos desarrollado para la transformación reproducible de S. parvula.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. crecimiento de la planta

  1. Esterilización de las semillas (opcional)
    1. Preparar la lejía de 50% en agua destilada doble (ddH2O) con 1 o 2 gotas de un detergente no iónico (véase Tabla de materiales) en un tubo de 50 mL. Invertir el tubo varias veces para mezclar la solución.
      Nota: Es preferible llevar a cabo la esterilización de las semillas en un flujo laminar con una superficie esterilizada UV durante 15 minutos.
    2. Añadir la solución de lejía a ~ 100-200 semillas S. parvula en un tubo de 1,5 mL. Mezcle bien y deje el tubo durante 5 minutos.
    3. Quitar el cloro del tubo y añadir etanol al 70%. Lavar las semillas mediante pipeteo varias veces y retire inmediatamente la solución de etanol.
    4. Lavar las semillas en agua esterilizada para extraer etanol y exceso de lejía y luego quitar el agua. Repita este paso 5 o 6 veces.
  2. Estratificación de semillas
    1. Sumergir las semillas en agua esterilizada y guardar durante 5 a 7 días a 4 ° C. Alternativamente, siembre semillas secas no esterilizadas directamente en suelo mojado y coloque la bandeja de suelo de 5 a 7 días a 4 ° C.
  3. Cultivo de plantas en la preparación de la transformación
    1. Llenar el suelo mezclar (véase Tabla de materiales) en macetas de 7 x 6 cm2 , remojo las macetas en agua y rociar el agua de la parte superior para asegurar un medio de crecimiento uniformemente húmedo. Agregar granos de 5 – fertilizante (véase Tabla de materiales) en la superficie del suelo de cada maceta.
      Nota: Como hemos experimentado, S. parvula crece bien en cualquier mezcla de suelo donde puede crecer a. thaliana .
    2. Usando un palillo de dientes mojado, transferencia 20 ~ 25 semillas por maceta en la superficie del suelo.
      Nota: Una práctica conveniente es poner un lote de 4 a 5 semillas en las cuatro esquinas y el centro de la maceta (figura 1, día 15, el panel izquierdo).
    3. Cubrir la bandeja del pote con una cúpula transparente para mantener las semillas bajo alta humedad durante la germinación.
    4. Mantenga las bandejas de planta en una cámara de crecimiento con una intensidad de luz fijada en 130 μmol m−2 s−1 luz, 22 – 24 ° C de temperatura y 14 h por día/10 h / ciclo de noche. Retire las cúpulas 7-10 días después de la germinación. Añadir agua de la parte inferior de la bandeja para mantener el suelo humedecido uniformemente en un nivel deseable.
    5. Eliminar las plantas de semillero extras y dejar sólo 4 – 5 plántulas sanas por maceta bien separada entre sí (figura 1, día 15, panel derecho).
    6. Regar las plantas cada dos días y fertilizar con 0.2 x solución16 de Hoagland una vez cada dos semanas.
      Nota: Mantener la humedad del suelo a un nivel uniforme es clave al cultivo S. parvula constantemente y sano.
    7. Siguen creciendo las plantas para 8-10 semanas hasta inflorescencias múltiples producen 100 – 150 yemas florales por planta (figura 1, día 60 – 80). En el día previsto para la transformación de base floral dip (paso 4.5), quite todas silicuas maduras y en desarrollo de las plantas.

2. clonación en un Vector el elemento genética/genómica de interés para la transformación de la planta

  1. Amplificar el fragmento de ADN de destino utilizando la polimerasa de reacción en cadena (PCR)17 y aislar el producto PCR mediante una extracción de gel kit (véase Tabla de materiales) según el protocolo del kit o cualquier otro método apropiado para purificar ADN mediante gel de agarosa electroforesis17,18. Verificar la secuencia de lo aislado del producto de PCR mediante secuenciación de Sanger19.
  2. Clon el producto deseado de la PCR en el vector de clonación y transformar el constructo clonado en la competente e. coli las células usando una topoisomerasa clonación basada en kit (véase Tabla de materiales) siguiendo las instrucciones del fabricante.
  3. Extensión 50 μl de los productos transformados en Luria-Bertani20 (LB) agar crecimiento bacteriano los medios de comunicación (tabla 1) con los antibióticos apropiados, ej., 50 μg / mL espectinomicina (véase Tabla de materiales) e incubar a 37 ° C durante la noche.
  4. Al día siguiente, seleccione colonias solo 5 – 10, inocular en medio LB líquido con los antibióticos apropiados e incubar con agitación suave a 37 ° C durante la noche.
  5. Plásmidos aislados mediante un aislamiento del plásmido kit (véase Tabla de materiales) y verificar a través de la secuenciación de Sanger19 si la secuencia de destino amplificada en 2.1 se clona correctamente.
  6. Transferir el producto de PCR clonado y verificado a un vector de destino para la transformación de la planta compatible con clonación basada en la recombinación (véase Tabla de materiales), utilizando una mezcla de enzima recombinase kit siguientes (véase Tabla de materiales), instrucciones del fabricante del kit. Repita del paso 2.3 paso 2.5 para aislar y verificar clones albergar construcciones de plásmido adecuado.

3. transformar la construcción de vectores para la transformación de la planta de Agrobacterium tumefaciens

  1. Transformar el plásmido de la construcción del vector de 2,6 en la cepa de a. tumefaciens GV3101:pMP90RK21, que abriga un gene de resistencia rifampicina para la selección de fondo cromosómica. Uso de antibióticos apropiados, por ejemplo, gentamicina o kanamicina (véase Tabla de materiales), para la selección de la planta de transformación construir (plásmido Ti). Un protocolo breve de a. tumefaciens transformación por electroporación está incluido en la sección 3.2.
  2. A. tumefaciens transformación por electroporación
    1. Descongelar las células competentes de a. tumefaciens 22 en hielo. Mezclar 0.1 – 1 μg de plásmido preparado a partir de 2.6, disuelto en 1-2 μl de ddH2O, con células competentes en el hielo. Transferir la mezcla en una cubeta de electroporación (véase Tabla de materiales).
    2. Realizar electroporación en la mezcla de células competentes de 3.2.1, usando un electroporator y plásmidos (véase Tabla de materiales) siguiendo las instrucciones del fabricante.
      Nota: Limpie la superficie de la cubeta antes de la electroporación.
    3. Transferir la mezcla de reacción de la cubeta a un tubo de microcentrífuga que contiene 1,5 mL de LB líquido y mezclar bien con el pipeteo e incubar durante 1 h a 28 ° C con agitación suave.
  3. Inocular la transformada a. tumefaciens de la sección 3.2 en placas de LB que contengan antibióticos de selección apropiada (p. ej. kanamicina 25 μg / mL, espectinomicina 50 μg / mL, gentamicina 25 μg / mL y rifampicina 50 μg / mL) e incubar a 28 ° C durante 3 días.

4. mediada por Agrobacterium transformación de S. parvula

  1. Inocular el solo transforman colonias de las placas en 10 mL de medio líquido LB que contienen antibióticos (igual que en 3.3) en una estéril 50 mL cónico del tubo (véase Tabla de materiales). Incubar durante 24 h en un incubador de agitación (véase Tabla de materiales) a 250 rpm a 28 ° C.
  2. Transferir la solución bacteriana de 3.4.1 a un matraz estéril de 250 mL, agregar 40 mL de medio líquido LB con los antibióticos apropiados e incubar 12 h hasta que la densidad óptica en longitud de onda 600 nm (OD600) alcanza alrededor de 2.0.
  3. Centrifugar el a. tumefaciens cultureat 3.100 x g durante 10 minutos Retire el sobrenadante y resuspender el cultivo bacteriano en 40 mL de solución de infiltración de a. tumefaciens (tabla 1).
  4. Diluir el resuspendido a. tumefaciens con solución de infiltración para un final de OD600 de 0,8. Añadir 25 μl de solución de surfactante (tabla 1) a 50 mL de a. tumefaciens diluida de la solución y mezclar invirtiendo varias veces.
  5. Inmersión de la inflorescencia de las plantas en la solución de a. tumefaciens preparado en la sección 4.4 para 20 s. una fresca solución bacteriana después de la inmersión inflorescencia de seis botes. Asegúrese de que todas las flores están en contacto con la solución. Soluciones bacterianas pipeta directamente flores situados en la parte inferior de la inflorescencia no se sumergieron en la solución.
    Nota: Para la transformación de la primera ronda, asegúrese de quitar todos silicuas maduras y en desarrollo, utilizando un bisturí afilado o tijeras pequeñas. No retire silicuas en caso de transformación por segunda vez.

5. transformación de la planta cuidado y la segunda transformación

  1. Coloque las plantas florales-cruce horizontalmente en charolas limpias con cúpulas para cubrir las plantas y colocar en una habitación oscura crecimiento durante 1 – 2 días.
    Nota: Mantener las flores bajo alta humedad es importante en esta etapa (figura 1, las plantas después de la transformación).
  2. Volver las plantas a una posición vertical y las plantas de transferencia a un cuarto de crecimiento con un h 14 por día/10 h por ciclo nocturno, 130 μmol m-2 s-1 intensidad de la luz y temperatura de 22 a 24 ° C.
  3. Supervisar las inflorescencias sumergidas en la semana siguiente. Si un número significativo de las flores abortan (figura 2), repetir la inmersión floral (paso 4) después de 4 semanas o después de que recientemente ha desarrollado un gran número de flores.
    Nota: A diferencia de la etapa de preparación para la primera transformación (paso 1.3.7), no retire la preexistente o en desarrollo silicuas (figura 2) antes de la segunda ronda de la transformación.
  4. Crecer las plantas hasta que las semillas maduran y cosechan semillas en ~ 21 semanas.
  5. Semillas secas durante 2 – 3 semanas a temperatura ambiente en un recipiente hermético con llenan de desecantes (véase Tabla de materiales).

6. selección de transformantes positivo

  1. Planta las semillas de la T1 como se describe para las semillas de tipo salvaje en pasos 1.2 a 1.3.
  2. Crecer las plantas hasta que se convierten las 2 primeras hojas verdaderas, aproximadamente de 10 a 14 días después de la germinación.
  3. Realizar la primera selección para resistencia a los herbicidas (figura 3A y 3B) como se detalla a continuación.
    1. Diluir el herbicida glufosinato-amonio (11.3%) (o BASTA) (tabla 1) para 1:1,000 (v/v). Spray solución diluida BASTA las plantas de semillero y las plantas con bóvedas de la cubierta durante la noche.
    2. BASTA pulverizar 2-3 veces de repetir cada 5 – 7 días.
  4. Realizar la segunda selección mediante una prueba de gota BASTA como se detalla a continuación.
    1. Identificar las plantas que sobreviven después de ser rociada 3-4 veces con solución BASTA. Crecer las plantas para otro 2-3 semanas hasta 3 a 5 hojas desarrollan un área superficial relativamente grande.
    2. Seleccione la hoja madura más grande por planta, frote la superficie de la hoja suavemente con un dedo para eliminar la capa de cera y coloque una gota de la solución diluida BASTA (de paso 6.3.1).
      Nota: Marque la ubicación de la hoja aplicada con la gota BASTA colocando una cinta de papel sobre el tronco más cercano.
    3. Seguimiento de las hojas aplicadas con la gota BASTA para detectar signos de marchitez durante hasta una semana. Seleccionar las plantas con hojas inafectadas por las gotas BASTA.
      Nota: Hojas de las plantas más falsos positivos comienzan a marchitarse dentro de dos días, mientras que hojas de verdaderos positivos están intactas, incluso después de que la gota de la solución BASTA seca (figura 3C).
  5. Confirman positivo transformantes mediante PCR genomic.
    1. Obtener 2-3 hojas de las plantas sobrevivientes al paso 6.4.5.
    2. Extracto de ADN genómico de las hojas utilizando el método CTAB23 o cualquier otro DNA extracción método apropiado.
    3. Realizar PCR utilizando muestras de ADN genómicas extraídas de las plantas, las plantas de tipo salvaje (como controles negativos) y la construcción del plásmido en el paso 3.1 (como control positivo). Utilice un par apropiado de cebadores PCR específicas para el gen marcador selectivo, por ejemplo,, gen BASTA-resistente (bar), TCAGCAGGTGGGTGTAGA (en adelante) y GTCAACCACTACATCGAGACAA (atrás).
      1. Para los iniciadores de la polimerización en cadena de ejemplo contra el gen bar , utilice las siguientes condiciones PCR: el paso de desnaturalización inicial a 98 ° C por 30 s; seguido de 30 ciclos de desnaturalización a 98 ° C por 30 s, recocido a 59 ° C por 30 s y extensión a 72 ° C por 30 s; y la extensión final a 72 ° C durante 5 minutos.
        Nota: Para asegurar la inserción de la DNA de T toda, se recomienda también realizar genómica polimerización en cadena usando una cartilla PCR del gen marcador selectivo y otra cartilla PCR específica para la secuencia de destino clonados en el vector de transformación de plantas en el paso
    4. Confirmar la presencia del tamaño esperado del producto PCR amplificado bar por gel de agarosa electroforesis17 para las muestras de destino (figura 4A), así como mediante la secuenciación de aislados PCR producto19 usar el mismo procedimiento como en el paso 2.1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hemos desarrollado un protocolo de transformación que permite recolección de semillas de T0 a 150 días, utilizando un método de inmersión floral modificado de la de a. thaliana. La figura 1 muestra un resumen de la línea de tiempo y S. parvula plantas que representan la etapa óptima para ejecutar la transformación a través de floral dip. Se seleccionaron S. parvula plantas con 70 –80 flores en inflorescencias múltiples a 60 – 80 días después de la germinación como el escenario objetivo de transformación. Un pequeño número de flores abiertas o fertilizadas preexistentes y silicuas en esta etapa fueron retirado antes de la infiltración de a. tumefaciens por el método de inmersión floral. La infección con a. tumefaciens resultó en el aborto de algunas flores (figura 2, soporte (a)). Silicuas completamente desarrollaron después de la inmersión floral son probables contener semillas transformadas (figura 2, soporte (b)). Incluso después de la transformación, S. parvula continuó desarrollando nuevas inflorescencias y flores como las plantas se mantuvieron sanos (figura 2, flechas blancas). Debido a este hábito de floración indeterminada, puede realizarse una segunda ronda de transformación si la planta no muestra signos de estrés o senescencia. Figura 2 A y 2B muestran ejemplos de S. parvula plantas después de la primera y segunda ronda de la transformación, respectivamente, 25 días una de otra. En la segunda transformación, silicuas existentes no se deben retirar porque pueden contener semillas transgénicas. También, se puede aplicar a. tumefaciens por pipetear la solución de infiltración (tabla 1) en emergentes racimos de flores, en lugar de sumergir la sesión entera en la solución, para minimizar el daño a silicuas de la primera transformación.

La eficiencia de transformación es de 0,033%, obtención de plantas transgénicas de 3 a 4 por 10.000 semillas T1 propagadas utilizando el protocolo actual. Esta estimación se basa en ~ 50.000 semillas T1 probadas durante diez intentos de transformación independientes. Mientras que la eficacia es menor que la de la Arabidopsis thaliana, es comparable a la transformación de otro extremophyte planta salsugenium Eutrema24 y algunos de los ecotipos de Arabidopsis thaliana 25. La eficiencia de transformación puede optimizarse aún más mediante el uso de cepas de Agrobacterium alternativas y modificaciones de las soluciones de surfactante y la infiltración. La BASTA múltiples pruebas de aerosol y gota (pasos 6.3 y 6.4) será decisivo para identificar cierto transformantes positiva y reducir el número de muestras analizadas con la confirmación de la polimerización en cadena en el paso 6.5 (figura 4A). Confirmación adicional de la transformación puede comprobarse con una expresión del gen reportero, si la secuencia clonada incluye un gen reportero (figura 4B).

Figure 1
Figura 1 : Línea de tiempo de transformación S. parvula . Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: S. parvula plantas después de la transformación de flores dip. Las plantas fueron fotografiados 10 días después de la primera florales-inmersión en el día 60 (A) y 25 días después de la segunda ronda de floral dip en día 85 (B). Infiltración con Agrobacterium puede abortar desarrollo silicua de flores como se muestra en los soportes una. Silicuas completamente desarrollaron después de inmersión floral son probables contener semillas transformadas (soportes b). Las flechas blancas indican flores y las inflorescencias recién surgieron después de cada transformación. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Selección de transformantes S. parvula basado en resistencia BASTA. (A) plántulas T1 antes el spray BASTA. (B) círculo rojo indica una planta candidato sobrevivir a la selección de primera ronda por el spray BASTA. Prueba de caída (C) la selección de segunda ronda por BASTA. Se muestra un ejemplo de falsos positivos (panel superior) y las plantas transgénicas verdadero (panel inferior). Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 : Confirmación de transformación S. parvula . (A) PCR la amplificación del gen de la barra de DNAs genomic extraída de las plantas de S. parvula . Carril 1 y 13: tamaño de los marcadores; Carril 2: control negativo; Carril 3-5: tipo salvaje S. parvula ; Carril 6-10: transgénicos S. parvula candidatos; Carril 11, 12: control de vectores. Rutas 7, 8 y 9 son un ejemplo positivo transformantes. (B) ejemplo de expresión del gen GUS reportero positiva parvula S. planta. Haga clic aquí para ver una versión más grande de esta figura.

Los medios de comunicación / solución Reactivo de Cantidad
Medios de cultivo bacteriano de Luria-Bertani (LB) NaCl
Triptona
Extracto de levadura
Agar (placas) de
ddH2O
10 g
10 g
5 g
20 g
955 mL
Solución de infiltración de Agrobacterium MS de la sal (1/4 x)
Vitaminas B5 (1 x)
Sacarosa (5%w/v)
MES
N6- bencilaminopurina (BA)
Silwet L-77 (0.05%v/v)
pH
2,16 g
1 mL
50 g
0.5 g
10 ΜL
500 ΜL
5.7

Tabla 1: composición del medio de crecimiento bacteriano y Agrobacterium solución de infiltración.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El estado fisiológico de la planta influye significativamente en la eficiencia de transformación25. El uso de plantas sanas y vigorosas para la transformación es un requisito clave para la exitosa transformación en S. parvula. Agua o luz plantas tendrán menos flores en comparación con las plantas saludables ideales para la transformación (figura 1, panel central). Parvula de S. puede crecer en una intensidad de luz inferior a 130 μmol m-2 s-1, pero las plantas tienden a ser débiles; tales plantas conduciría a más abortados tras inmersión floral de flores. Parvula de S. tiende a abortar flores Agrobacterium-cruce a una velocidad superior a a. thaliana. Por lo tanto, cada paso dado para reducir al mínimo las flores abortadas al sumergido en la solución de infiltración de a. tumefaciens contribuye a una mayor eficiencia de transformación. Se recomienda un periodo de luz no de 14 h al día. A menudo, la transformación de a. thaliana se realiza en plantas cultivadas en condiciones de día largo (18 h luz y 6 h oscuridad) o incluso bajo luz continua. Sin embargo, encontramos tal resultado de prácticas en las plantas menos resistentes de S. parvula y llevar a una eficiencia de transformación baja.

Botones florales se producen continuamente en los ejes de la inflorescencia de parvula S. (figura 2, flechas blancas). Por lo tanto, lo que permite la transformación de nuevas flores aumentar significativamente la posibilidad de obtener transformantes positivo. Un segundo flores-dip (paso 5.3) no es esencial, pero fuertemente sugerida. Sin embargo, este paso es relativamente lento en comparación con a. thaliana inmersión floral, porque S. parvula produce múltiples ejes de la inflorescencia.

Tipo salvaje S. parvula es sensible a BASTA, aunque la pantalla inicial de transformantes positivo con vaporizador BASTA (paso 6.3) dejará 5 – 8 plantas sobrevivientes de 100 semillas germinadas (figura 3A y 3B). De esto la mayoría (> 80%) serán falsos positivos. Esto es en gran parte debido a la forma angosta de la hoja y el ángulo de la hoja de S. parvula, que no proporcionan suficiente superficie foliar en una orientación adecuada para retener la solución BASTA para una duración suficiente observar un fenotipo. Además, debido al contenido de alta cera de la superficie adaxial de la hoja de parvula S.10, tiende a crear una superficie más impermeable para BASTA. Por lo tanto, la segunda proyección de transformantes positivo con una gota BASTA en hojas individuales (paso 6.4, figura 3C) es un paso esencial para evitar la PCR pruebas en cientos de falsos positivos (paso 6.5).

El actual protocolo se probó con la cepa de a. tumefaciens GV3101 llevan el plásmido pMP90RK . La eficiencia de transformación puede mejorarse con otras cepas de a. tumefaciens , incluyendo cepas ABI, LMG20 y C58C1 Rif, con el plásmido de virulencia de pMP90 a aumentar la eficiencia de transformación en a. thaliana 25. especies de Brassica y Eutrema están taxonómicamente más estrechamente relacionadas con S. parvula en comparación con1de a. thaliana. Por lo tanto, la tensión a. tumefaciens LBA4404 que fue utilizado con éxito para transformar Brassica napus y la cepa EHA105 que se ha utilizado con éxito para transformar Eutrema salsugineum puede ofrecer una mayor transformación eficacia que la eficacia divulgada de la cepa utilizada actualmente26,27,28.

Reduciendo el tiempo y mano de obra necesaria por un protocolo de transformación es otro factor importante en la mejora de la eficiencia de transformación. Colocación individual BASTA gotas en las hojas y la hoja de control para una semana de múltiples plantas (paso 6.4) son tediosos. Marcador seleccionable alternativos adecuados genes29podría buscar un esfuerzo futuro para aumentar la eficiencia de transformación.

La disponibilidad de un protocolo de transformación establecidos avanzará enormemente nuestra capacidad para identificar los genes y mecanismos nuevos que permitan extremophyte plantas modelo sobrevivir múltiples abiótico2,4. Nueva variación genética en S. parvula proporcionará un conjunto más amplio de variación genética que no puede ser extraído de la variación alélica colectiva identificada como genes de la respuesta de estrés en el modelo relativamente sensible al estrés, a. thaliana pan-genoma5,6. Por lo tanto, nuestro floral dip basada en a. tumefaciens mediada por protocolo de transformación desarrollado por S. parvula llenará una brecha para la necesidad de este tipo de herramientas para llevar a cabo experimentos genómicos funcionales en un modelo de extremophyte relacionado con A. thaliana.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Este trabajo fue apoyado por un premio de la Fundación Nacional de Ciencias 1616827 de MCB.

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).
Planta de crecimiento y transformación mediada por Agrobacterium de baño Floral de la Extremophyte <em>Schrenkiella parvula</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).More

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter