Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

الحث والتهديف من مرض الكسب غير المشروع مقابل المضيف في نموذج المورين Xenogeneic والقياس الكمي للخلايا تي البشرية في أنسجة الماوس باستخدام PCR الرقمية

doi: 10.3791/59107 Published: May 23, 2019

Summary

هنا، نقدم بروتوكولللحث على وتسجيل المرض في نموذج الكسب غير المشروع مقابل المضيف xenogeneic (xenoGVHD). xenoGVHD يوفر نموذج في الجسم الحي لدراسة كبت المناعة للخلايا T البشرية. بالإضافة إلى ذلك، فإننا نصف كيفية الكشف عن الخلايا T البشرية في الأنسجة مع PCR الرقمية كأداة لتحديد كمية كبت المناعة.

Abstract

يعد مرض الكسب غير المشروع مقابل المضيف الحاد (GVHD) قيدًا كبيرًا على المرضى الذين يتلقون زراعة الخلايا الجذعية المكونة للدم كعلاج لنقص الدم والأورام الخبيثة. يحدث GVHD الحاد عندما تعترف الخلايا T المانحة الأنسجة المضيفة كمستضد أجنبي وجبل استجابة مناعية للمضيف. وتشمل العلاجات الحالية الأدوية المثبطة للمناعة السامة التي تجعل المرضى عرضة للعدوى والتكرار. وهكذا، هناك بحوث جارية لتوفير العلاج الحاد GVHD التي يمكن أن تستهدف بشكل فعال الخلايا T المانحة والحد من الآثار الجانبية. يستخدم الكثير من هذا العمل قبل السريرية نموذج المورين GVHD xenogenic (xenoGVHD) الذي يسمح لاختبار العلاجات المثبطة للمناعة على الخلايا البشرية بدلا ً من خلايا المورين في نظام في الجسم الحي. يحدد هذا البروتوكول كيفية حث xenoGVHD وكيفية العمى وتوحيد التهديف السريري لضمان نتائج متسقة. بالإضافة إلى ذلك، يصف هذا البروتوكول كيفية استخدام PCR الرقمية للكشف عن الخلايا T البشرية في أنسجة الماوس، والتي يمكن استخدامها في وقت لاحق لتحديد فعالية العلاجات المختبرة. نموذج xenoGVHD ليس فقط يوفر نموذجا لاختبار العلاجات GVHD ولكن أي علاج يمكن قمع الخلايا T البشرية، والتي يمكن بعد ذلك تطبيقها على العديد من الأمراض الالتهابية.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

أصبحت زراعة الخلايا الجذعية المكونة للدم اللوجينية (HSCT) العلاج الروتيني للمرضى الذين يعانون من الأورام الخبيثة الدموية مثل سرطان الدم مع سوء التكهن. ومن المضاعفات الهامة لمرض HSCT مرض الكسب غير المشروع مقابل المضيف الحاد (GVHD). وأفادت دراسة أجريت في عام 2012 أن مرض نقص المناعة البشرية الحاد ة تطور في 39٪ من مرضى HSCT الذين يتلقون عمليات زرع من المتبرعين الأشقاء و 59٪ من المرضى الذين يتلقون عمليات زرع من متبرعين غير ذوي صلة1. تحدث GVHD الحادة عندما تهاجم الخلايا T المشتقة من الجهات المانحة أعضاء المتلقي. العلاج الناجح الوحيد لGVHD هو العلاج مع الأدوية المثبطة للمناعة للغاية2، والتي هي شديدة السمية وزيادة خطر العدوى وتكرار الورم. وهكذا، على الرغم من التحسينات التي أدخلت على البقاء على قيد الحياة GVHD الحاد في السنوات الأخيرة3،4،5، لا تزال هناك حاجة ماسة لتحسين العلاجات GVHD مع الحد الأدنى من السمية التي تعزز مغفرة طويلة الأجل.

الهدف العام من الطرق التالية هو حث وتسجيل XEnogeneic GVHD (xenoGVHD). تم تطوير نموذج xenoGVHD كأداة للحث على GVHD الحاد مع الخلايا البشرية بدلا من خلايا المورين مما يسمح للترجمة المباشرة أكثر من البحوث GVHD قبل السريرية إلى التجارب السريرية6. ينطوي هذا النموذج على حقن خلايا الدم الطرفية أحادية النووية البشرية عن طريق الوريد (PBMC) في الفئران NOD-SCID IL-2Rγnull (NSG) التي يتم تشعيعها دون مميت. يتم تنشيط الخلايا T البشرية المحقونة من قبل مستضد الإنسان تقديم الخلايا (APCs) تقديم مستضد المورين والخلايا T تنشيط الهجرة إلى الأنسجة البعيدة مما أدى إلى التهاب الجهازية والموت في نهاية المطاف6،7، 8 , 9 , 10.علم الأمراض والتقدم في نموذج xenoGVHD يحاكي عن كثب الإنسان الحاد GVHD. على وجه التحديد، والخلايا T البشرية المسببة للأمراض هي رد فعل على murine الرئيسية البروتينات مجمع التوافق النسيجي (MHC)، والتي تشبه alloreactivity الخلية T في GVHD الإنسان6،9. الميزة الأساسية لنموذج xenoGVHD على نموذج الماوس MHC عدم التطابق, نموذج GVHD الأخرى المستخدمة على نطاق واسع, هو أنه يسمح لاختبار العلاجات على الخلايا البشرية بدلا من خلايا المورين. وهذا يسمح لاختبار المنتجات التي يمكن ترجمتها مباشرة إلى العيادة دون أي تعديلات لأنها مصنوعة لاستهداف الخلايا البشرية. في الآونة الأخيرة، وقد استخدم هذا النموذج لاختبار الإنسان المضادة IL-2 الأجسام المضادة11،والخلايا T التنظيمية الثيمية البشرية (Tregs)12 والخلايا الجذعية mesenchymal الإنسان13 كعلاجات محتملة لGVHD الحاد. في سياق أوسع, ويمكن استخدام هذا النموذج كفحص قمع في الجسم الحي لأي نوع من المخدرات أو الخلية التي يمكن أن قمع نشاط الخلايا T الإنسان. فعلى سبيل المثال، استخدم Stockis et al.14 نموذج xenoGVHD لدراسة تأثير منع integrin αVβ8 على النشاط القمعي Treg في الجسم الحي. وهكذا، يمكن أن يوفر نموذج xenoGVHD نظرة ثاقبة في آلية أي علاج يستهدف الخلايا T في إعداد في الجسم الحي.

وهناك طريقة إضافية موصوفة في هذا البروتوكول هي كيفية الكشف عن الخلايا T البشرية في أنسجة الماوس باستخدام تفاعل البوليميراز المتسلسل الرقمي (dPCR). والهدف من هذه الطريقة هو تقديم أداة لقياس الهجرة وانتشار الخلايا T في الأنسجة المستهدفة، والتي تقيس فعالية العلاجات المثبطة للمناعة التي يجري اختبارها في هذا النموذج. dPCR هو طريقة جديدة نسبيا للقياس الكمي للأحماض النووية15. باختصار، ينقسم خليط تفاعل PCR إلى أقسام تحتوي على أعداد صغيرة من التسلسل المستهدف أو لا يوجد هدف على الإطلاق. ثم يتم تضخيم التسلسل المستهدف واكتشافه باستخدام الأصباغ المتداخلة للحمض النووي أو المسبارات الفلورية الخاصة بالهدف. dPCR كميا عدد نسخ من التسلسل المستهدف على أساس جزء من أقسام إيجابية وإحصاءات بواسون15،16. الكشف عن الخلايا T مع dPCR يتطلب أنسجة أقل بكثير مقارنة مع الطرق البديلة الأخرى، بما في ذلك قياس التدفق والنسيج، ويمكن القيام به على الأنسجة المجمدة أو الثابتة. لا يتطلب dPCR منحنى قياسي لتحديد أرقام النسخ، كما لا يلزم إجراء نسخ متماثل تقني. وهذا يقلل من كمية الكاشف والحمض النووي القالب اللازمة لdPCR مقارنة PCR الكمية التقليدية (qPCR)16. تقسيم رد فعل PCR إلى ردود فعل فرعية في dPCR يركز بشكل فعال الأهداف17. وبالتالي، فإن dPCR هو في المقام الأول أداة للكشف عن الأهداف النادرة في كمية كبيرة من الحمض النووي غير المستهدف. على سبيل المثال، يتم استخدام dPCR للكشف عن التلوث البكتيري في الحليب18،وتحديد الطفرات النادرة في الجينات مستقبلات الإستروجين19،والكشف عن تعميم الحمض النووي الورم في دم المرضى20. في هذا البروتوكول، dPCR بمثابة أداة فعالة للكشف عن وقياس الخلايا T البشرية في أنسجة الفئران مع xenoGVHD.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وقد أجريت جميع تجارب الماوس في الامتثال، وبموافقة من، مركز جامعة كانساس الطبي المؤسسية لرعاية الحيوانات واستخدامها لجنة. تم الحصول على جميع عينات الدم البشري السليمة بموافقة مستنيرة وبموافقة من مجلس المراجعة المؤسسية في المركز الطبي بجامعة كانساس.

1. تشعيع الفئران NSG

  1. قبل يوم واحد من حقن PBMC، تشعيع 8-12 أسابيع الفئران NSG القديمة (أي من الجنسين يمكن استخدامها). في خزانة السلامة البيولوجية المعقمة، ضع الفئران في قفص فطيرة معقمة أو وحدة عزل صغيرة. الفئران المشععة في مصدر Cs137 أو الرادياتير الحيواني الصغير (على سبيل المثال، RS 2000) بجرعة إجمالية قدرها 150 درجة مئوية مع دوران بطيء لضمان التشعيع حتى.
  2. وضع الفئران في أقفاص نظيفة في خزانة السلامة البيولوجية المعقمة.

2- إعداد الـ PBMC البشري للحقن

  1. جمع ما يكفي من الدم البشري السليم لعزل 1.1 × 107 PBMC لكل فأرة. تمييع الدم الهيباري في حجم متساو من 2٪ مصل البقر الجنيني (FBS) في الفوسفات المخزنة المالحة (PBS).
    ملاحظة: مع هذا البروتوكول، العائد PMBC عموما 0.5-1 × 107 لكل 10 مل من الدم كله. سيحصل كل فأر على 107 PBMC في 100 ميكرولتر من PBS. إضافية 1 × 106 في 10 ميكرولتر لكل ماوس يضمن أن كل فأر يتلقى الجرعة الكاملة من PBMC، ينبغي أن يكون هناك أي مشاكل مع ملء المحاقن.
  2. إضافة 15 مل كثافة فصل الخلايا الليمفاوية التدرج المتوسطة (على سبيل المثال، فيكول) إلى أنبوب مخروطي 50 مل ومن ثم تراكب بعناية تصل إلى 25 مل من الدم المخفف على رأس التدرج الكثافة. طرد مركزي الأنبوب الذي يحتوي على تدرج الكثافة والدم المخفف في 400 × ز لمدة 40 دقيقة في درجة حرارة الغرفة دون الفرامل.
  3. حصاد واجهة PBMC في 10 مل من PBS في أنبوب مخروطي 50 مل. طرد مركزي الخلايا في 400 × ز لمدة 10 دقيقة.
  4. تخفيف بيليه عن طريق نفض الغبار أنبوب وإعادة تعليق في PBS 10 مل لغسل PBMC. طرد مركزي الخلايا في 400 × ز لمدة 5 دقائق.
  5. (اختياري) تخلص من خلايا الدم الحمراء الفائقة والليسية (RBCs) في بيليه الخلية عن طريق إضافة حجم من المخزن المؤقت للتخدير كلوريد الأمونيوم (ACK) الذي يساوي حجم بيليه. بلطف إعادة تعليق بيليه ودوامة الأنبوب لمدة 30-60 ق. ملء أنبوب مع وسائل الإعلام RPMI خالية من المصل والطرد المركزي الأنبوب في 400 × ز لمدة 5 دقائق.
  6. إزالة supernatant وإعادة تعليق بيليه الخلية في 5 مل من PBS. عد الخلايا باستخدام استبعاد التريبان الأزرق مع مقياس الهيموكيتوميومتر ومجهر.
  7. طرد الخلايا في 400 × ز لمدة 5 دقائق.

3- الحقن المداري الرجعي لمركبات الإيثر الثنائي الفينيل المتعدد البروم البشرية في الفئران24

  1. ضع غرفة التخدير في غطاء محرك السيارة للحفاظ على العقم. قبل شحن غرفة التخدير مع 5٪ isoflurane و 1 L / دقيقة معدل تدفق الأكسجين لمدة 5 دقائق.
  2. تقليل الإيسوفلوران إلى 2٪ ووضع الفئران من نفس القفص في غرفة التخدير. مرة واحدة الفئران تفقد الحق، والتخدير الفئران لمدة 5 دقائق في الغرفة. خلال هذا الوقت، قبل ملء حقنة مع 100 ميكرولتر (1 × 107 خلايا) من تعليق الخلية.
  3. ضع الماوس على وسادة التدفئة مع أنفه في مخروط الأنف للحفاظ على التخدير. تحقق من فقدان الوعي عن طريق الضغط على وسادة القدم والتحقق من عدم وجود رد الفعل.
  4. ضبط الماوس مع الإبهام والإصبع الأوسط. إدراج 28 G 1/2 في إبرة مع شطبة أسفل الجانبية إلى canthus الوسيطة، من خلال الغشاء الملتحمة حتى يتم التوصل إلى الجزء الخلفي من العين. سحب الإبرة قليلا وحقن ببطء 100 درجة مئوية من الخلايا (1 × 107 الخلايا).
  5. سحب الإبرة بالكامل والتخلص بشكل صحيح من الحقنة والإبرة. أغلق الجفن وطبق ضغط خفيف على موقع الحقن باستخدام اسفنجة شاش.
  6. فحص موقع الحقن للتورم أو غيرها من الصدمات المرئية. السماح للماوس لاستعادة وعيه في قفص معقمة اصطف مع المناشف الورقية لمنع شفط الفراش قبل الانتقال إلى قفص المنزل. بعد توقف أي نزيف ، ضع قطرة واحدة من البروسباراكين على العين للتسكين.
    ملاحظة: حقن الوريد الذيل هو طريقة بديلة للحقن الوريدي من PBMC لهذا البروتوكول كما هو موضح من قبل Macholz وآخرون22.

4. التهديف السريري لGVHD الحاد في الفئران (الشكل 1)23

  1. قياس GVHD درجة كل يوم حتى الفئران تصل إلى درجة 2 ثم كل يوم حتى يوم من التضحية.
    1. وضع القفص في غطاء محرك السيارة تدفق laminar، وإزالة الطعام والماء ووضع الغطاء مرة أخرى على. يسجل النشاط عن طريق مراقبة الفئران لمدة 5 دقائق وتعيين عشرات على النحو التالي: 0 = الماوس يبدأ المشي في غضون بضع دقائق ويحافظ على المشي حول القفص، 1 = الماوس يأخذ أكثر من بضع دقائق للحصول على ما يصل ويمشي ببطء حول القفص، 2 = الماوس لا تحصل على ما يصل في 5 دقائق ويمشي فقط عندما لمست.
  2. وزن كل فأر في كوب زجاجي وإعطاء درجة فقدان الوزن: 0 = <10% تغيير, 1 = 10-25% تغيير و 2 = >25% تغيير.
  3. في حين أن الماوس لا يزال في الكأس، وتفقد للموقف: 0 = عادي، 1 = حدس في بقية، 2 = حدس يضعف الحركة. نسيجالفراء: 0 = عادي، 1 = خفيفة إلى معتدلة الهذيان، 2 = الهذيان الشديد، وسلامة الجلد: 0 = عادي، 1 = التحجيم من الكفوف / الذيل، 2 = مناطق واضحة من الجلد عارية (انظر إلى الأذنين، الذيل والكفوف للتحجيم).
  4. مع خمس فئات ودرجة 0-2 لكل فئة، يمكن أن يصل الماوس إلى درجة قصوى من 10. عندما يصل الماوس إلى درجة 7 أو أكثر أو يصل إلى 42 يوما بعد الحقن، قتل الماوس عن طريق القتل الرحيم CO2 أو طريقة أخرى وافقت عليها اللجنة المحلية لرعاية الحيوانات المؤسسية واستخدامها.
    ملاحظة: لضمان دقة النتائج، يتم إجراء التقييم من قبل باحث أعمى لمجموعات العلاج24. بالإضافة إلى ذلك، على الرغم من أن > 20٪ من فقدان وزن الجسم هو نقطة النهاية الإنسانية الموصى بها للعديد من بروتوكولات IACUC، مع تبرير إضافي IACUC الموافقة على هذا البروتوكول يمكن الحصول عليها.

5- حصاد الأنسجة للحمض النووي الجيني من الفئران القتل الرحيم وعزل الحمض النووي الجيني

  1. تشريح الفئران باستخدام أدوات جراحية معقمة. قطع قطعة صغيرة من الأنسجة حوالي 3 مم × 0.5 مم في الحجم من جهاز من الفائدة، على سبيل المثال، الرئة، الكبد، أو الطحال. وزن عينة الأنسجة ووضع قطعة الأنسجة في أنبوب معقمة 1.5 مل. إذا جمع أنسجة متعددة، وغسل الأدوات مع الإيثانول بين قطع كل عضو.
  2. تجميد الأنسجة عن طريق غمر الأنابيب التي تحتوي على الأنسجة في النيتروجين السائل حتى يتوقف محتدما وتخزينها في -80 درجة مئوية بين عشية وضحاها. إذابة عينات الأنسجة وlyse لهم وفقا لالحمض النووي الجينومي (gDNA) مجموعة العزل.
  3. عزل الحمض النووي الجينومي وفقا لتعليمات الشركة المصنعة كما هو موضح في مجموعة. تأكد من ملاحظة كمية الأنسجة التي تمت معالجتها لكل ميكرولتر من gDNA eluted (ملغ / كيلولتر).
    ملاحظة: يمكن تخزين الأنسجة المجمدة في -80 درجة مئوية للمعالجة في وقت لاحق.

6- التحديد الكمي للخلايا T البشريةباستخدام PCR الرقمي (الشكل 2)

  1. إعداد ردود الفعل PCR الرقمية وفقا لبروتوكول الأصباغ ملزمة الحمض النووي لآلة PCR الرقمية المستخدمة. (ب) استخدام المواد التمهيدية التالية المحددة للحمض النووي الجينومي البشري CD3 epsilon (التسلسل المرجعي للأهلي: NG_007383.1)؛ التمهيدي إلى الأمام: AGGCTGCCTTAACTCCCAAG، عكس التمهيدي: GCCCCCAGCTGTAAAC. هذه التمهيديات سوف تسفر عن نطاق واحد من 105 نقطة أساس.
    ملاحظة: أضف 0.5 ميكرولتر من إنزيم تقييدي، مثل HindIII، إلى كل رد فعل لهضم الحمض النووي الجينومي. تأكد من اختبار تخفيفات gDNA مختلفة لتحسين فصل قطرات إيجابية وسلبية. بالإضافة إلى ذلك، قد تكون مجموعة فرعية من الخلايا T التسلل غير المسببة للأمراض الخلايا T التنظيمية. ويمكن قياس هذه الخلايا كميا باستخدام التمهيديات إضافية لعلامات الخلية T التنظيمية.
  2. تنفيذ رد فعل PCR الرقمية في ظل الظروف التالية: غطاء في 105 درجة مئوية، 95 درجة مئوية لمدة 10 دقيقة (1 دورة)؛ 95 درجة مئوية ل30 درجة مئوية، منحدر 2 درجة مئوية / ث و 55 درجة مئوية لمدة 1 دقيقة، منحدر 2 درجة مئوية / ث (40 دورة)؛ 72 درجة مئوية لمدة 10 دقائق، 12 درجة مئوية عقد.
    ملاحظة: قد تحتاج هذه المعلمات إلى تعديل اعتماداً على معدات PCR الرقمية.
  3. الحصول على بيانات PCR الرقمية مع برامج التحليل. الإبلاغ عن البيانات كأرقام نسخ لكل مغ من الأنسجة باستخدام المعادلة التالية: (عدد النسخ/اللتر) x (ميكرولتر من gDNA في رد الفعل) x (عامل التخفيف)/(ملغ من الأنسجة/اللتر من إجمالي gDNA)

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

بدأت فئران NSG القديمة التي تُعفى بالأشعة تحت الأربعة واللاإنسانية واللاإنسانية واللاإنسانية واللاإنسانية والمهينة من كلا الجنسين التي تلقت PBMC البشري تظهر علامات سريرية لـ GVHD حول اليوم 10 بعد الحقن مقارنة بفئران التحكم السلبية التي تلقت PBS فقط (الشكل1A). وكان متوسط بقاء الفئران XenoGVHD 23.5 يوما (الشكل1B). مع PCR الرقمية، يمكن الكشف عن خلايا T البشرية الإيجابية CD3 epsilon في الرئة وعينات الكبد من الفئران التي تلقت PBMC الإنسان. واستخدمت عينات الأنسجة من الفئران التيحقنت مع PBS كضوابط (الشكل 2).

Figure 1
الشكل 1: تطور مرض GVHD. تم حقن فئران NSG الذكور والإناث التي تبلغ من العمر 8-12 أسبوعًا بشكل شبه مميت مع 1 × 107 من PBMC البشرية (n = 6) أو PBS (n = 4) كتحكم سلبي. البيانات المعروضة هي النتائج المجمعة لثلاث تجارب مستقلة. (A) تم قياس درجة GVHD كل يوم حتى الفئران وصلت إلى درجة 2 ثم كل يوم حتى يوم من التضحية. البيانات التي تم الإبلاغ عنها في كل نقطة زمنية لدرجة GVHD هو متوسط ± درجة SEM من الفئران الحية جنبا إلى جنب مع الدرجات الأخيرة من أي الفئران المتوفى في كل مجموعة. * p < 0.05 كما يحددها مان ويتني يو اختبار. (ب) كابلان ماير منحنى البقاء على قيد الحياة. تم وضع علامة على الموت عندما كانت درجة GVHD ≥ 7. * p < 0.05 كما يحددها اختبار رتبة السجل. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2: الكشف عن الخلايا التائية البشرية باستخدام PCR الرقمي. تم جمع عينات الرئة والكبد من الفئران التي تم حقنها بـ PBS (n = 3) أو 1 × 107 PBMC البشرية (n = 3) عندما وصلت الفئران إلى درجة GVHD من ≥ 7 أو 42 يوما بعد الحقن. وقد جُمعت البيانات من 3 تجارب مستقلة. تم عزل gDNA واستخدمت PCR الرقمية لتحديد نسخ من EPSilon CD3 الإنسان لكل مليغرام من الأنسجة. (أ) رسم PCR رقمي تمثيلي لعينات الرئة والكبد من فأر حقن بـ PBS أو PBMC. (ب) التحديد الكمي لنسخ من CD3 epsilon الإنسان لكل ملغرام من الأنسجة من الفئران حقن مع PBS أو PBMC. * ع ≤ 0.05 على النحو الذي حدده مان ويتني يو اختبار. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

تطور المرض هو عموما متسقة في نموذج xenoGVHD، حتى مع حقن PBMC من مختلف الجهات المانحة، لذلك يمكن الجمع بين تجارب متعددة. الخطوات الرئيسية المطلوبة للحفاظ على هذا الاتساق هي تقنية الحقن i.v. المناسبة، والعمى والتهديف متسقة. وأظهرت دراسة أجراها نيرفي وآخرون25 أنه بالمقارنة مع حقن الوريد الذيل، أدت الحقن المدارية الرجعية من PBMC إلى تطعيم أكثر اتساقا ً وإلى زيادة شدة GVHD. كما أثبت ليون ريكو وآخرون26 أن الحقن المدارية الرجعية أدت إلى تطعيم الخلايا الجذعية المكونة للدم بصورة أكثر اتساقاً في الفئران مقارنة بحقن الوريد الذيل. ومع ذلك، إذا لزم الأمر، يمكن استخدام حقن الوريد الذيل كوسيلة بديلة في نموذج xenoGVHD27،28،29.

ويمكن الحد من مشكلة تقلب النتائج المرتبطة بحقن الوريد الذيل عن طريق زيادة عدد المواضيع. بالإضافة إلى ذلك، من المهم أن الشخص الذي يسجل الفئران أعمى لعلاج الماوس لتجنب التحيز في تسجيل معايير أكثر ذاتية مثل النشاط أو نسيج الفراء. كما تم إثبات أهمية تسجيل GVHD الأعمى في العيادة24. الشخص الذي يحقن الفئران لا ينبغي أن يكون نفس الشخص الذي يسجل الفئران. إذا كان هذا غير ممكن، يمكن أن تكون عشوائية أنابيب التحكم والعلاج ووصفت مع معرف جديد من قبل شخص آخر (أي، السيطرة هي A، والعلاج هو B) حتى الحقن يمكن أن تكون عمياء. يجب أن يتم تسجيل الماوس في نفس الوقت تقريبا كل يوم وفي نفس الأيام بعد الحقن بين تجارب مختلفة.

وتتمثل إحدى العقبات المحتملة في هذا النموذج في الافتقار إلى تطوير الـ GVHD. ويمكن أن يعزى ذلك إلى انخفاض صلاحية PBMC الذي يمكن معالجته عن طريق التحقق من صلاحية PBMC عن طريق عد الخلايا ذات اللون الأزرق التريبان. إذا واجهت مشكلة مع بقاء الخلية، يمكن وضع الخلايا في PBS تكملها 2٪ FBS لتحسين البقاء على قيد الحياة. أيضا، يمكن حقن عدد أقل من الفئران في وقت واحد للحد من الخلايا الزمنية الجلوس في درجة حرارة الغرفة. ويمكن أن تكون فعالية الحقن المداري الرجعي هي المشكلة. الفئران التي يتم حقنها مع PBMC ولكن لا تتطور GVHD يمكن قتلها، ويمكن تحليل الخلايا المناعية المعزولة من الطحال لوجود الخلايا البشرية عن طريق dPCR أو قياس التدفق. إذا كان هناك سوء الطعوم، ثم هناك على الأرجح مشكلة مع تقنية الحقن. كاختبار لتقنية الحقن، يمكن حقن الفئران الرجعية المدارية مع 200 درجة مئوية من صبغة إيفانز الزرقاء. إذا كان الحقن ناجحا، فإن الأذنين والكفوف والذيل من الماوس تتحول إلى اللون الأزرق.

نموذج xenoGVHD يحاكي عن كثب الإنسان الحاد GVHD مرض مسببات الأمراض والتقدم30. على عكس نموذج عدم تطابق MC mc mc GVHD، يسمح نموذج xenoGVHD باختبار تأثير العلاجات المثبطة للمناعة، بما في ذلك علاجات الخلايا البشرية، على الخلايا البشرية بدلاً من الخلايا المورين. وهذا يقلل من الاختلاف بسبب الاختلافات بين الأنواع عند تطبيق نتائج البحوث على العيادة. نموذج xenoGVHD يمكن أيضا أن تكون بمثابة فحص قمع في الجسم الحي في مجالات أخرى من البحوث خلية T. وهكذا، يمكن تطبيق نتائج التجارب التي تستخدم نموذج xenoGVHD على أي مرض التهابي الإنسان T بوساطة الخلية بالإضافة إلى GVHD.

هناك قيود على نموذج xenoGVHD. وتشمل هذه التباين اتّهيب تجريبيّة وفروق يمكن في [غفهد] معالجة يقارن إلى العيادة. يمكن أن تنشأ التناقضات التجريبية من الاختلافات في سلالة الماوس، ومواقع حقن PBMC، وجرعة الإشعاع والبيئة الميكروبية30،31. وبالتالي، ينبغي للمختبرات التي تستخدم هذا النموذج أن تحاول توحيد هذه البارامترات لضمان تحقيق نتائج متسقة. في هذا البروتوكول، نقوم بوصف طرق التهديف التي تساعد على تقليل التباين في التهديف. وتشمل العوامل التي قد تحد من قابلية مقارنة بيانات xenoGVHD إلى النتائج السريرية عدم وجود مجموعات التحكم المعالجة بالأدوية الوقائية GVHD واستخدام التشعيع كمصدر وحيد للتكييف في نموذج xenoGVHD31. بالإضافة إلى ذلك، فإن آلية xenoGVHD لا تلخص تماما الإمراض الكامنة في GVHD الإنسان. فعلى سبيل المثال، فإن البلدان المانحة للناقلات الأساسية للناقلات هي التي تقوم بدور نشط في الخلايا التائية البشرية في نموذج xenoGVHD، في حين أن الناقلات المضيفة للبلدان النامية هي التي تضطلع بدور هام في الـ GVHD 7 البشرية. وهكذا، كما هو الحال مع معظم النماذج ما قبل السريرية، وهناك أوجه عدم اتساق وعدم توافق بين xenoGVHD وGVHD البشرية التي قد تحد من تطبيق البيانات التي تم إنشاؤها من xenoGVHD إلى العيادة.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

لم يعلن أي تضارب في المصالح.

Acknowledgments

نود أن نعترف مختبر لين كريستنسون لتوفير آلة PCR الرقمية المستخدمة في هذه التجارب والدعم التقني المقدمة. ونود أيضا أن نشكر الدكتور توماس يانكي على توجيهه وإرشاده. وقد حظيت هذه الدراسات بدعم مؤسسة تريب فاميلي.

Materials

Name Company Catalog Number Comments
1.5 mL eppendorf tubes Fisher 05-408-129
10 mL serological pipet VWR International 89130-898
10mL BD Vacutainers - Green capped with Sodium Heparin Becton Dickinson 366480
250 µL Ranin pipette tips Rainin 17001118 Do not use other pipettes or pipet tips for droplet generation
50 mL conical tube VWR International 89039-656
96-Well ddPCR plate Bio-Rad 12001925
ACK (Ammonium-Chloride-Potassium) Lysing Buffer Lonza 10-548E Optional
Alcohol Wipes Fisher Scientific 6818
Anesthesia Chamber World Precision Instruments EZ-178 Provided by animal facility
Anesthesia Machine Parkland Scientific PM1002 Provided by animal facility
BD Vacutainer Safety-Lok Blood Collection Set Becton Dickinson 367281
DG8 Cartridges and Gaskets for QX100/QX200 Droplet Generator Bio-Rad 1864007
DNAse and RNAse free Molecular Grade H2O Life Technologies 1811318
Ethyl alcohol, Pure,200 proof, for molecular biology Sigma-Aldrich E7023-500ML
Fetal Bovine Serum Atlanta Biologicals S11150
Ficoll Fisher Scientific 45001750
Insulin Syringe Fisher Scientific 329424
Isoflurane Sigma-Aldrich CDS019936 Provided by animal facility
Liquid nitrogen N/A N/A
Mouse Irradiator Pie Cage Braintree Scientific, Inc. MPC 1 Holds up to 11 mice
Nexcare Gentle Paper Tape (a.k.a. 3M Micropore Surgical Tape / 3/4") Fisher Scientific 19-027-761
P1000 pipetman MidSci A-1000
P200 pipetman MidSci A-200
Pierceable Foil Heat Seal Bio-Rad 1814040
Pipetaid Gilson Macroman Fisher Scientific F110756
Pipet-Lite Multi Pipette L8-200XLS+ Rainin 17013805 Do not use other pipettes or pipet tips for droplet generation
Qiagen DNeasy Blood and Tissue Kit Qiagen 69506
qPCR plates VWR International 89218-292
QX200 Droplet Digital PCR System Bio-Rad 12001925 Includes droplet generator, droplet reader, laptop computer, software, associated component consumables, for EvaGreen or probe-based digital PCR applications
QX200 Droplet Generation Oil for EvaGreen Bio-Rad 1864006
QX200 ddPCR EvaGreen Supermix Bio-Rad 1864033
RNase and DNase-free plate seal Thermo Scientific 12565491
RPMI Advanced 1640 Life Technologies 12633012
Sterile Gauze Pads (2" x 2", 12-Ply) Fisher Scientific 67522
Sterile Phosphate Buffered Saline Fisher Scientific 21040CV
Sterile reservoir VWR International 89094-662
Surgial Scissors Kent Scientific INS600393-4
Surgical Forceps Kent Scientific INS650914-4

DOWNLOAD MATERIALS LIST

References

  1. Jagasia, M., et al. Risk factors for acute GVHD and survival after hematopoietic cell transplantation. Blood. 119, (1), 296-307 (2012).
  2. Bolanos-Meade, J., et al. Phase 3 clinical trial of steroids/mycophenolate mofetil vs steroids/placebo as therapy for acute GVHD: BMT CTN 0802. Blood. 124, (22), quiz 3335 3221-3227 (2014).
  3. Gooley, T. A., et al. Reduced mortality after allogeneic hematopoietic-cell transplantation. New England Journal of Medicine. 363, (22), 2091-2101 (2010).
  4. Hahn, T., et al. Significant improvement in survival after allogeneic hematopoietic cell transplantation during a period of significantly increased use, older recipient age, and use of unrelated donors. Journal of Clinical Oncology. 31, (19), 2437-2449 (2013).
  5. Khoury, H. J., et al. Improved survival after acute graft-versus-host disease diagnosis in the modern era. Haematologica. 102, (5), 958-966 (2017).
  6. King, M. A., et al. Human peripheral blood leucocyte non-obese diabetic-severe combined immunodeficiency interleukin-2 receptor gamma chain gene mouse model of xenogeneic graft-versus-host-like disease and the role of host major histocompatibility complex. Clinical & Experimental Immunology. 157, (1), 104-118 (2009).
  7. Lucas, P. J., Shearer, G. M., Neudorf, S., Gress, R. E. The human antimurine xenogeneic cytotoxic response. I. Dependence on responder antigen-presenting cells. Journal of Immunology. 144, (12), 4548-4554 (1990).
  8. Ito, R., et al. Highly sensitive model for xenogenic GVHD using severe immunodeficient NOG mice. Transplantation. 87, (11), 1654-1658 (2009).
  9. Kawasaki, Y., et al. Comprehensive Analysis of the Activation and Proliferation Kinetics and Effector Functions of Human Lymphocytes, and Antigen Presentation Capacity of Antigen-Presenting Cells in Xenogeneic Graft-Versus-Host Disease. Biology of Blood and Marrow Transplantation. 24, (8), 1563-1574 (2018).
  10. Ito, R., et al. A Novel Xenogeneic Graft-Versus-Host Disease Model for Investigating the Pathological Role of Human CD4(+) or CD8. T Cells Using Immunodeficient NOG Mice. American Journal of Transplantation. 17, (5), 1216-1228 (2017).
  11. Trotta, E., et al. A human anti-IL-2 antibody that potentiates regulatory T cells by a structure-based mechanism. Nature Medicine. 24, (7), 1005-1014 (2018).
  12. Dijke, I. E., et al. Discarded Human Thymus Is a Novel Source of Stable and Long-Lived Therapeutic Regulatory T Cells. American Journal of Transplantation. 16, (1), 58-71 (2016).
  13. Huang, F., et al. Human Gingiva-Derived Mesenchymal Stem Cells Inhibit Xeno-Graft-versus-Host Disease via CD39-CD73-Adenosine and IDO Signals. Frontiers in Immunology. 8, 68 (2017).
  14. Stockis, J., et al. Blocking immunosuppression by human Tregs in vivo with antibodies targeting integrin alphaVbeta8. Proceedings of the National Academy of Sciences of the United States of America. 114, (47), E10161-E10168 (2017).
  15. Vogelstein, B., Kinzler, K. W. Digital PCR. Proceedings of the National Academy of Sciences of the United States of America. 96, (16), 9236-9241 (1999).
  16. Quan, P. L., Sauzade, M., Brouzes, E. dPCR: A Technology Review. Sensors (Basel). 18, (4), (2018).
  17. Sykes, P. J., et al. Quantitation of targets for PCR by use of limiting dilution. Biotechniques. 13, (3), 444-449 (1992).
  18. Ma, H., et al. Evaluation of Bacterial Contamination in Goat Milk Powder Using PacBio Single Molecule Real-Time Sequencing and Droplet Digital PCR. Journal of Food Protection. 1791-1799 (2018).
  19. Vitale, S. R., et al. An optimized workflow to evaluate estrogen receptor gene mutations in small amounts of cell-free DNA. Journal of Molecular Diagnostics. (2018).
  20. Gorgannezhad, L., Umer, M., Islam, M. N., Nguyen, N. T., Shiddiky, M. J. A. Circulating tumor DNA and liquid biopsy: opportunities, challenges, and recent advances in detection technologies. Lab Chip. 18, (8), 1174-1196 (2018).
  21. Yardeni, T., Eckhaus, M., Morris, H. D., Huizing, M., Hoogstraten-Miller, S. Retro-orbital injections in mice. LabAnimal. 40, (5), 155-160 (2011).
  22. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual restraint and common compound administration routes in mice and rats. Journal of Visualized Experiments. (67), (2012).
  23. Cooke, K. R., et al. An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin. Blood. 88, (8), 3230-3239 (1996).
  24. Weisdorf, D. J., et al. Prospective grading of graft-versus-host disease after unrelated donor marrow transplantation: a grading algorithm versus blinded expert panel review. Biology of Blood and Marrow Transplantation. 9, (8), 512-518 (2003).
  25. Nervi, B., et al. Factors affecting human T cell engraftment, trafficking, and associated xenogeneic graft-vs-host disease in NOD/SCID beta2mnull mice. Experimental Hematology. 35, (12), 1823-1838 (2007).
  26. Leon-Rico, D., et al. Comparison of haematopoietic stem cell engraftment through the retro-orbital venous sinus and the lateral vein: alternative routes for bone marrow transplantation in mice. LabAnimal. 49, (2), 132-141 (2015).
  27. Ali, N., et al. Xenogeneic graft-versus-host-disease in NOD-scid IL-2Rgammanull mice display a T-effector memory phenotype. PLoS One. 7, (8), e44219 (2012).
  28. van Rijn, R. S., et al. A new xenograft model for graft-versus-host disease by intravenous transfer of human peripheral blood mononuclear cells in RAG2-/- gammac-/- double-mutant mice. Blood. 102, (7), 2522-2531 (2003).
  29. Wunderlich, M., et al. OKT3 prevents xenogeneic GVHD and allows reliable xenograft initiation from unfractionated human hematopoietic tissues. Blood. 123, (24), e134-e144 (2014).
  30. Schroeder, M. A., DiPersio, J. F. Mouse models of graft-versus-host disease: advances and limitations. Disease Models & Mechanisms. 4, (3), 318-333 (2011).
  31. Zeiser, R., Blazar, B. R. Preclinical models of acute and chronic graft-versus-host disease: how predictive are they for a successful clinical translation? Blood. 127, (25), 3117-3126 (2016).
الحث والتهديف من مرض الكسب غير المشروع مقابل المضيف في نموذج المورين Xenogeneic والقياس الكمي للخلايا تي البشرية في أنسجة الماوس باستخدام PCR الرقمية
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).More

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter