Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Induktion og scoring af graft-versus-Host-sygdom i en xenogen Murinmodel og kvantificering af humane T-celler i muse væv ved hjælp af digital PCR

doi: 10.3791/59107 Published: May 23, 2019

Summary

Her præsenterer vi en protokol til at inducere og score sygdom i en xenogene graft-versus-Host disease (xenogvhd) model. xenoGVHD giver en in vivo-model til at studere immunsuppression af humane T-celler. Derudover beskriver vi, hvordan man opdager humane T-celler i væv med digital PCR som et redskab til at kvantificere immunsuppression.

Abstract

Akut graft-versus-Host-sygdom (GVHD) er en signifikant begrænsning for patienter, der får hæmatopoietisk stamcelletransplantation som behandling for hæmatologiske mangler og maligniteter. Akut GVHD opstår, når donor-T-celler genkender værts vævet som et fremmed antigen og monterer et immunrespons over for værten. Nuværende behandlinger involverer giftige immunosuppressive lægemidler, der gør patienter modtagelige for infektion og gentagelse. Således, der er igangværende forskning for at give en akut GVHD terapi, der effektivt kan målrette donor T celler og reducere bivirkninger. Meget af dette prækliniske arbejde bruger xenogen GVHD (xenoGVHD) murine model, der giver mulighed for testning af immunosuppressive behandlinger på humane celler i stedet for murine celler i et in vivo-system. Denne protokol skitserer, hvordan xenoGVHD fremkalder, og hvordan man blinde og standardiserer klinisk scoring for at sikre ensartede resultater. Derudover beskriver denne protokol, hvordan man bruger digital PCR til at detektere humane T-celler i musens væv, som efterfølgende kan anvendes til at kvantificere effekten af testede terapier. XenoGVHD-modellen giver ikke kun en model til at teste GVHD-terapier, men enhver terapi, der kan undertrykke humane T-celler, som derefter kan anvendes til mange inflammatoriske sygdomme.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Allogen hæmatopoietisk stamcelletransplantation (HSCT) er blevet rutinemæssig behandling for patienter, som lider af hæmatologiske maligniteter såsom leukæmi med dårlig prognose. En signifikant komplikation af HSCT er akut graft-versus-Host-sygdom (GVHD). En 2012 undersøgelse rapporterede, at akut GVHD udviklet i 39% af HSCT patienter, der modtager transplantationer fra søskende donorer og 59% af patienter, der modtager transplantationer fra ikke-forretningsmæssigt forbundne donorer1. Akut GVHD opstår, når donor-afledte T-celler angriber modtagerens organer. Den eneste vellykkede behandling for GVHD er behandling med meget Immunsuppressive lægemidler2, som er meget giftige og øger risikoen for infektion og tumor gentagelse. På trods af forbedringer, der er foretaget i akut gvhd overlevelse i de seneste år3,4,5, er der stadig et kritisk behov for forbedrede gvhd-terapier med minimal toksicitet, der fremmer langsigtet remission.

Det overordnede mål med følgende metoder er at inducere og score xenogene gvhd (xenogvhd). XenoGVHD-modellen blev udviklet som et værktøj til at inducere akut GVHD med humane celler i stedet for murinceller, der giver mulighed for mere direkte oversættelse af præklinisk GVHD-forskning til kliniske forsøg6. Denne model involverer intravenøst injiceret humant perifert blod mononukleære celler (PBMC) i NOD-SCID IL-2Rγnull (NSG) mus, der er sublethally bestrålet. Injicerede humane t-celler aktiveres af humane antigen præsentations celler (apc'er), der præsenterer murin-antigen, og de aktiverede t-celler migrerer til fjernt væv, hvilket resulterer i systemisk inflammation og i sidste ende død6,7, 8 , 9 , 10. sygdoms patologi og progression i xenoGVHD-modellen nøje efterligner humant akut gvhd. Specifikt er de patogene humane T-celler reaktive over for murine Major komplekse Complex (MHC) proteiner, som svarer til T-cellens alloreactivity i human gvhd6,9. Den primære fordel ved xenoGVHD-modellen over musens MHC-mismatch-model, den anden udbredte GVHD-model, gør det muligt at teste terapier på humane celler i stedet for murinceller. Dette giver mulighed for afprøvning af produkter, der direkte kan oversættes til klinikken uden ændringer, fordi de er lavet til at målrette humane celler. For nylig er denne model blevet brugt til at teste et humant anti-IL-2 antistof11, humane thymiske regulatoriske T-celler (Tregs)12 og humane mesenchymale stamceller13 som potentielle behandlinger for akut gvhd. I en bredere sammenhæng, denne model kan bruges som en in vivo suppression analyse for enhver stof eller celletype, der kan undertrykke menneskelig T celle aktivitet. F. eks. brugte stockis et al.14 xenogvhd-modellen til at undersøge effekten af blokering af anti αvβ8 på treg suppressiv aktivitet in vivo. Derfor kan xenoGVHD-modellen give indsigt i mekanismen i enhver terapi, som målretter mod T-celler i en in vivo-indstilling.

En yderligere metode beskrevet i denne protokol er, hvordan man opdager humane T-celler i mus væv ved hjælp af digital polymerase kædereaktion (dPCR). Målet med denne metode er at tilbyde et værktøj til at kvantificere migration og spredning af T-celler i målvæv, som måler effekten af immunosuppressive behandlinger, der testes i denne model. dPCR er en forholdsvis ny metode til kvantificering af nukleinsyrer15. Kort sagt er PCR-reaktionsblandingen opdelt i partitioner, der indeholder små tal af målsekvensen eller intet mål overhovedet. Målsekvensen forstærkes og detekteres ved hjælp af DNA-interkalerende farvestoffer eller fluorescerende målspecifikke sonder. dpcr kvantificerer antallet af kopier af Target sekvens baseret på brøkdel af positive partitioner og Poissons statistik15,16. Påvisning af T-celler med dPCR kræver meget mindre væv sammenlignet med andre alternative metoder, herunder flow cytometri og histologi, og kan udføres på frosset eller fast væv. dPCR kræver ikke en standardkurve for at bestemme kopi numre, og der kræves heller ikke tekniske replikater. Dette reducerer mængden af reagens og skabelon-DNA, der er nødvendigt for dPCR sammenlignet med traditionel kvantitativ PCR (qPCR)16. Opdeling af PCR-reaktionen i sub-reaktioner i dPCR koncentrerer mål17. DPCR er således primært et værktøj til påvisning af sjældne mål i en stor mængde ikke-måldna. For eksempel bruges dPCR til at påvise bakteriel kontaminering i mælk18, identificere sjældne mutationer i østrogen receptor genet19og detektere cirkulerende tumor DNA i blodet hos patienter20. I denne protokol fungerer dPCR som et effektivt værktøj til påvisning og kvantificering af humane T-celler i væv hos mus med xenoGVHD.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle mus eksperimenter blev udført i overensstemmelse, og med godkendelse fra, University of Kansas Medical Center institutionel Animal Care og brug udvalg. Alle raske humane blodprøver blev indhentet underinformeret samtykke og med godkendelse fra den institutionelle revisions tavle på University of Kansas Medical Center.

1. bestråling af NSG-mus

  1. En dag før PBMC injektion, bestråle 8 – 12-ugers gamle NSG mus (begge køn kan bruges). I et sterilt biosikkerhedskabinet placeres mus i et steriliseret lagkage bur eller en mikroisolator. Irradiat mus i en cs137 kilde eller lille dyr bestrålings anlægs (f. eks, RS 2000) med en samlet dosis på 150 CGY med langsom rotation for at sikre selv bestråling.
  2. Placer musene i rene bure i et sterilt biosikkerheds kabinet.

2. klargøring af humant PBMC til injektion

  1. Indsamle nok sundt humant blod til at isolere 1,1 x 107 PBMC per mus. Hepariniseret blod fortyndes i et tilsvarende volumen på 2% føtal bovint serum (FBS) i fosfatbuffer saltvand (PBS).
    Bemærk: med denne protokol er PMBC-udbyttet generelt 0,5 – 1 x 107 pr. 10 ml fuldblod. Hver mus vil modtage 107 PBMC i 100 μl PBS. Den ekstra 1 x 106 i 10 μl per mus sikrer, at hver mus får den fulde dosis af PBMC, bør der være nogen problemer med påfyldning sprøjter.
  2. Tilsæt 15 mL lymfocyt separations tæthed gradient medium (f. eks, Ficoll) til en 50 mL konisk rør og derefter forsigtigt overlay op til 25 mL fortyndet blod på toppen af tætheden gradient. Centrifugeglasset, der indeholder densitet gradient og fortyndet blod ved 400 x g for 40 min ved stuetemperatur uden bremse.
  3. PBMC-grænsefladen høstes i 10 mL PBS i et 50 mL konisk rør. Cellerne centrifugeres ved 400 x g i 10 min. Fjern supernatanten.
  4. Løsn pellet ved at svirpe røret og resuspendere i 10 ml PBS for at vaske PBMC. Cellerne centrifugeres ved 400 x g i 5 minutter.
  5. Valgfri Kassér supernatanten og lyserøde blodlegemer (RBCs) i celle pellet ved at tilføje en volumen af ammonium-chlorid-kalium (ACK) lysis buffer, der er lig med pellet volumen. Resuspension forsigtigt pellet og hvirvle røret for 30 – 60 s. Fyld røret med serum-fri RPMI-medier og centrifuge røret ved 400 x g i 5 min.
  6. Supernatanten fjernes, og celle pellet gensuspenderes i 5 mL PBS. Tæl cellerne ved hjælp af trypan og et blå udelukkelse med et hemocytometer og et mikroskop.
  7. Cellerne centrifugeres ved 400 x g i 5 min. Fjern supernatanten, og gensuspender cellerne med 1 x 108 celler/ml i PBS.

3. retroorbital injektion af humant PBMC i mus21

  1. Placer et anæstesi kammer i en laminar flow hætte for at opretholde sterilitet. Foroplad anæstesi kammeret med 5% isofluran og 1 L/min oxygen flowhastighed i 5 min.
  2. Reducer isofluran til 2% og sæt mus fra samme bur i anæstesi kammeret. Når musene mister opretningen, anæstetiserer du mus i 5 minutter i kammeret. I løbet af denne tid, pre-fill sprøjte med 100 μL (1 x 107 celler) af cellesuspension.
  3. Placer musen på en varmepude med næsen i en næse kegle for at opretholde anæstesi. Check for tab af bevidsthed ved at klemme en fodpude og kontrol af manglende refleks.
  4. Hold musen tilbage med tommelfingeren og den midterste finger. Indsæt 28 G 1/2 i nålen med facet nedad lateral til mediale canthus, gennem konjunktival membranen, indtil bagsiden af øjet er nået. Træk kanylen lidt tilbage, og Injicer langsomt 100 μL celler (1 x 107 celler).
  5. Træk kanylen helt tilbage og kassér sprøjten og nålen korrekt. Luk øjenlåget og Påfør et mildt Tryk på injektionsstedet med en gaze svamp.
  6. Undersøg injektionsstedet for hævelse eller andre synlige traumer. Lad musen genvinde bevidstheden i et sterilt bur foret med papirhåndklæder for at forhindre aspiration af strøelse, før du flytter til hjem bur. Efter en blødning er stoppet, anvende en enkelt dråbe af proparacaine til øjet for analgesi.
    Bemærk: hale vene injektion er en alternativ metode til intravenøs injektion af PBMC for denne protokol som beskrevet af Macholz et al.22.

4. klinisk scoring af akut GVHD i mus (figur 1)23

  1. Mål GVHD score hver anden dag, indtil mus nå en score på en 2 og derefter hver dag indtil dagen for offer.
    1. Placer buret i en laminar flow hætte, Fjern mad og vand og Sæt låget på igen. Score aktivitet ved at observere mus i 5 min og tildele scoringer som følger: 0 = musen begynder at gå inden for et par minutter og holder gå rundt i bur, 1 = musen tager en mere end et par minutter at komme op og går langsomt rundt i bur, 2 = musen kommer ikke op i 5 min og kun gåture når rørt.
  2. Vejning hver mus i et glasbæger og give et vægttab score: 0 = < 10% ændring, 1 = 10 – 25% ændring og 2 = > 25% ændring.
  3. Mens musen er stadig i bægerglasset, inspicere for kropsholdning: 0 = normal, 1 = sidde i hvile, 2 = sidde svækker bevægelse; pels tekstur: 0 = normal, 1 = mild til moderat pøle, 2 = svær pøle og hudens integritet : 0 = normal, 1 = skalering af poter/hale, 2 = indlysende områder af denuderede hud (se på ører, hale og poter til skalering).
  4. Med fem kategorier og en score på 0 – 2 for hver kategori, kan en mus nå en maksimal score på 10. Når en mus når en score på 7 eller større eller når 42 dage efter injektion, aflive mus via Co2 eutanasi eller anden metode, der er godkendt af den lokale institutionelle dyrepasning og brug udvalg.
    Bemærk: for at sikre nøjagtigheden af resultaterne, er scoringen udført af en forsker, der er blindet til behandlingsgrupperne24. Desuden, selv om > 20% af legemsvægt tab er den anbefalede humane endepunkt for mange IACUC protokoller, med yderligere begrundelse IACUC godkendelse af denne protokol kan opnås.

5. høst af væv til genomisk DNA fra aflives-mus og isolering af genomisk DNA

  1. Dissekere mus ved hjælp af sterile kirurgiske værktøjer. Skær et lille stykke væv omkring 3 mm x 0,5 mm i størrelse fra et organ af interesse, f. eks, lunge, lever, eller milt. Vævsprøven vejes, og vævs stykket placeres i et sterilt 1,5 mL rør. Hvis du samler flere væv, vaske værktøjer med ethanol mellem skæring hvert organ.
  2. Fryse væv ved at nedsænke rørene, der indeholder vævet i flydende nitrogen, indtil det stopper boblende og opbevares i-80 °C natten over. Tø vævsprøverne og lyse dem i henhold til en genomisk DNA (gDNA) isolationssæt.
  3. Isoler genomisk DNA i henhold til producentens anvisninger som beskrevet i sættet. Sørg for at notere mængden af væv, der blev forarbejdet pr. mikroliter af elueret gDNA (mg/μl).
    Bemærk: frosset væv kan opbevares ved-80 °C til forarbejdning på et senere tidspunkt.

6. kvantificering af humane T-celler ved hjælp af digital PCR (figur 2)

  1. Forbered digitale PCR-reaktioner i henhold til protokollen for DNA-bindings farvestoffer til den digitale PCR-maskine, der anvendes. Brug følgende primere specifikt for humant CD3 Epsilon genomisk DNA (NCBI reference sekvens: NG_ 007383.1); Fremad primer: AGGCTGCCTTAACTCCCAAG, reverse primer: GCCCTACCAGCTGTGGAAAC. Disse primere vil give et enkelt bånd på 105 BP.
    Bemærk: tilsæt 0,5 μL af et restriktionsenzym, såsom HindIII, til hver reaktion for at fordøje det genomiske DNA. Sørg for at afprøve forskellige gDNA-fortyndinger for at optimere adskillelsen af positive og negative dråber. Derudover kan en delmængde af infiltrerende T-celler være ikke-sygdomsfremkaldende regulerende T-celler. Disse celler kan kvantificeres ved hjælp af yderligere primere for regulatoriske T celle markører.
  2. Udføre den digitale PCR-reaktion under følgende betingelser: låg ved 105 °C, 95 °C i 10 min (1 cyklus); 95 °C i 30 s, rampe 2 °C/s og 55 °C i 1 min., rampe 2 °C/s (40 cyklusser); 72 °C i 10 min., 12 °C hold.
    Bemærk: disse parametre skal muligvis justeres afhængigt af digitalt PCR-udstyr.
  3. Hent digitale PCR-data med analyse software. Rapportér data som antal kopier pr. mg væv ved hjælp af følgende ligning: (antal kopier/μL) x (μL gDNA i reaktion) x (fortyndingsfaktor)/(mg væv/μL af total gDNA)

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Sublethally bestrålet 8-12-ugers gamle NSG-mus af begge køn, der fik humant PBMC, viste kliniske tegn på GVHD omkring dag 10 efter injektion sammenlignet med negative kontrolmus, der kun modtog PBS (figur 1a). XenoGVHD-mus havde en Median overlevelse på 23,5 dage (figur 1b). Med digital PCR kunne CD3 Epsilon positive humane T-celler påvises i lunge-og leverprøver af mus, der fik humant PBMC. Vævsprøver fra mus, der injiceres med PBS, blev anvendt som kontrol (figur 2).

Figure 1
Figur 1: progression af GVHD-sygdommen. Sublethally bestrålet 8-12-ugers gamle hang-og hunmus blev retroorbitalt injiceret med 1 x 107 humant PBMC (n = 6) eller PBS (n = 4) som negativ kontrol. De viste data er de kombinerede resultater af tre uafhængige eksperimenter. (A) gvhd-score blev målt hver anden dag, indtil mus nåede en score på en 2 og derefter hver dag indtil dagen for ofringen. Data, der rapporteres på hvert tidspunkt for GVHD-score, er den gennemsnitlige ± SEM-score for levende mus kombineret med den sidste score af eventuelle afdøde mus i hver gruppe. * p < 0,05 som bestemt af Mann Whitney U test. B) Kaplan-Meier-kurven for overlevelse. Døden blev markeret, da GVHD score var ≥ 7. * p < 0,05 som bestemt af log-Rank test. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: påvisning af humane T-celler ved hjælp af digital PCR. Der blev indsamlet lunge-og leverprøver fra mus, som var retroorbitalt injiceret med PBS (n = 3) eller 1 x 107 humant PBMC (n = 3), når mus nåede en gvhd-score på ≥ 7 eller 42 dage efter injektionen. Der blev indsamlet data fra 3 uafhængige eksperimenter. gDNA blev isoleret og digital PCR blev brugt til at bestemme kopierne af humant CD3 Epsilon pr. milligram væv. A) REPRÆSENTATIVT digitalt PCR-plot af lunge-og leverprøver fra en mus, der INJICERES med PBS eller PBMC. B) kvantificering af kopier af humant CD3 Epsilon pr. millgram væv fra mus, som INJICERES med PBS eller PBMC. * p ≤ 0,05 som bestemt af Mann Whitney U test. Venligst klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Sygdomsprogression er generelt konsistent i xenoGVHD-modellen, selv med injektion af PBMC fra forskellige donorer, så flere eksperimenter kan kombineres. De vigtigste skridt, der kræves for at opretholde denne konsistens er korrekt i.v. injektion teknik, blændende og konsekvent scoring. En undersøgelse foretaget af Nervi et al.25 viste, at sammenlignet med intravenøs hale vene injektion resulterede retroorbital injektioner af PBMC i mere konsistent engraftment og mere alvorlig gvhd. Leon-Rico et al.26 viste også, at retroorbital injektioner resulterede i mere konsekvent hæmatopoietisk stamcelle engraftment i mus sammenlignet med hale vene injektion. Men hvis det er nødvendigt, kan hale vene injektioner anvendes som en alternativ metode i xenogvhd model27,28,29.

Problemet med variabilitet af udfald forbundet med hale vene injektioner kan reduceres ved at øge antallet af. Desuden er det vigtigt, at den person, der scorer mus er blændet til mus behandling for at undgå bias i scoring af mere subjektive kriterier såsom aktivitet eller pels tekstur. Betydningen af blændet GVHD scoring er også blevet påvist i klinikken24. Den person, der injicerer musene, bør ikke være den samme person, der scorer musene. Hvis dette ikke er muligt, kan kontrol-og behandlingsrør randomiseret og mærket med nye id's af en anden person (dvs. kontrol er en, behandling er B), så injektioner kan være blændet. Mus scoring bør udføres omkring samme tid hver dag og på de samme dage efter injektion mellem forskellige eksperimenter.

En potentiel hindring i denne model er manglen på GVHD-udvikling. Dette kan skyldes nedsat levedygtighed af PBMC, som kan afhjælpes ved at kontrollere levedygtigheden af PBMC ved at tælle celler med trypan og et blå. Hvis der opstår problemer med cellens levedygtighed, kan cellerne sættes i PBS suppleret med 2% FBS for at forbedre overlevelsen. Også, færre mus kan injiceres på et tidspunkt for at reducere tidscellerne sidde ved stuetemperatur. Effekten af den retroorbital injektion kan være problemet. Mus, der injiceres med PBMC, men ikke udvikler gvhd kan være aflives og immunceller isoleret fra deres deres kan analyseres for tilstedeværelsen af humane celler via dpcr eller flow cytometry. Hvis der er dårlig engraftment, så er der sandsynligvis et problem med injektion teknik. Som en test af injektion teknik, kan mus injiceres retro-orbitally med 200 μL af Evans blå farvestof. Hvis injektionen er vellykket, vil ørerne, poterne og halen af musen blive blå.

XenoGVHD-modellen efterligner nøje humant akut GVHD sygdoms patogenese og progression30. I modsætning til murine MHC mismatch GVHD-modellen gør xenoGVHD-modellen det muligt at teste effekten af immunosuppressive behandlinger, herunder humane celle terapier, på humane celler i stedet for murinceller. Dette reducerer variationen på grund af artsforskelle ved anvendelse af forskningsresultater på klinikken. XenoGVHD-modellen kan også fungere som en in vivo-undertrykkelses analyse inden for andre områder af T-celle forskning. Resultater fra eksperimenter, der anvender xenoGVHD-modellen, kan således anvendes på enhver menneskelig T-cellemedieret inflammatorisk sygdom ud over GVHD.

Der er begrænsninger i xenoGVHD-modellen. Disse omfatter eksperimentel variation og mulige forskelle i GVHD-behandling sammenlignet med klinikken. Eksperimentelle uoverensstemmelser kan stamme fra forskelle i musestamme, steder af PBMC injektion, strålingsdosis og mikrobielle miljø30,31. Laboratorier, som anvender denne model, bør således forsøge at standardisere disse parametre for at sikre ensartede resultater. I denne protokol beskriver vi scoringsmetoder, der hjælper med at reducere variabiliteten i scoring. Faktorer, som kan begrænse sammenligneligheden af xenoGVHD-data til kliniske resultater, omfatter manglen på kontrolgrupper, der er behandlet med GVHD-profylaktiske lægemidler, og brugen af bestråling som den eneste kilde til konditionering i xenoGVHD-modellen31. Desuden giver xenoGVHD-mekanismen ikke en fuldstændig gentagelse af den underliggende patogenese i human GVHD. For eksempel er det donor APCs i stedet for Host APCs, der aktiverer humane T-celler i xenoGVHD-modellen, hvorimod Host APCs spiller en væsentlig rolle i human GVHD7. Som med de fleste prækliniske modeller er der således uoverensstemmelser og inkompatibiliteter mellem xenoGVHD og human GVHD, der kan begrænse anvendelsen af data genereret fra xenoGVHD til klinikken.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Ingen interessekonflikter anmeldt.

Acknowledgments

Vi vil gerne anerkende laboratoriet i Lane Christenson for at levere den digitale PCR-maskine, der anvendes i disse eksperimenter, og for den leverede tekniske support. Vi vil også gerne takke Dr. Thomas Yankee for hans vejledning og mentorskab. Disse undersøgelser blev støttet af Tripp Family Foundation.

Materials

Name Company Catalog Number Comments
1.5 mL eppendorf tubes Fisher 05-408-129
10 mL serological pipet VWR International 89130-898
10mL BD Vacutainers - Green capped with Sodium Heparin Becton Dickinson 366480
250 µL Ranin pipette tips Rainin 17001118 Do not use other pipettes or pipet tips for droplet generation
50 mL conical tube VWR International 89039-656
96-Well ddPCR plate Bio-Rad 12001925
ACK (Ammonium-Chloride-Potassium) Lysing Buffer Lonza 10-548E Optional
Alcohol Wipes Fisher Scientific 6818
Anesthesia Chamber World Precision Instruments EZ-178 Provided by animal facility
Anesthesia Machine Parkland Scientific PM1002 Provided by animal facility
BD Vacutainer Safety-Lok Blood Collection Set Becton Dickinson 367281
DG8 Cartridges and Gaskets for QX100/QX200 Droplet Generator Bio-Rad 1864007
DNAse and RNAse free Molecular Grade H2O Life Technologies 1811318
Ethyl alcohol, Pure,200 proof, for molecular biology Sigma-Aldrich E7023-500ML
Fetal Bovine Serum Atlanta Biologicals S11150
Ficoll Fisher Scientific 45001750
Insulin Syringe Fisher Scientific 329424
Isoflurane Sigma-Aldrich CDS019936 Provided by animal facility
Liquid nitrogen N/A N/A
Mouse Irradiator Pie Cage Braintree Scientific, Inc. MPC 1 Holds up to 11 mice
Nexcare Gentle Paper Tape (a.k.a. 3M Micropore Surgical Tape / 3/4") Fisher Scientific 19-027-761
P1000 pipetman MidSci A-1000
P200 pipetman MidSci A-200
Pierceable Foil Heat Seal Bio-Rad 1814040
Pipetaid Gilson Macroman Fisher Scientific F110756
Pipet-Lite Multi Pipette L8-200XLS+ Rainin 17013805 Do not use other pipettes or pipet tips for droplet generation
Qiagen DNeasy Blood and Tissue Kit Qiagen 69506
qPCR plates VWR International 89218-292
QX200 Droplet Digital PCR System Bio-Rad 12001925 Includes droplet generator, droplet reader, laptop computer, software, associated component consumables, for EvaGreen or probe-based digital PCR applications
QX200 Droplet Generation Oil for EvaGreen Bio-Rad 1864006
QX200 ddPCR EvaGreen Supermix Bio-Rad 1864033
RNase and DNase-free plate seal Thermo Scientific 12565491
RPMI Advanced 1640 Life Technologies 12633012
Sterile Gauze Pads (2" x 2", 12-Ply) Fisher Scientific 67522
Sterile Phosphate Buffered Saline Fisher Scientific 21040CV
Sterile reservoir VWR International 89094-662
Surgial Scissors Kent Scientific INS600393-4
Surgical Forceps Kent Scientific INS650914-4

DOWNLOAD MATERIALS LIST

References

  1. Jagasia, M., et al. Risk factors for acute GVHD and survival after hematopoietic cell transplantation. Blood. 119, (1), 296-307 (2012).
  2. Bolanos-Meade, J., et al. Phase 3 clinical trial of steroids/mycophenolate mofetil vs steroids/placebo as therapy for acute GVHD: BMT CTN 0802. Blood. 124, (22), quiz 3335 3221-3227 (2014).
  3. Gooley, T. A., et al. Reduced mortality after allogeneic hematopoietic-cell transplantation. New England Journal of Medicine. 363, (22), 2091-2101 (2010).
  4. Hahn, T., et al. Significant improvement in survival after allogeneic hematopoietic cell transplantation during a period of significantly increased use, older recipient age, and use of unrelated donors. Journal of Clinical Oncology. 31, (19), 2437-2449 (2013).
  5. Khoury, H. J., et al. Improved survival after acute graft-versus-host disease diagnosis in the modern era. Haematologica. 102, (5), 958-966 (2017).
  6. King, M. A., et al. Human peripheral blood leucocyte non-obese diabetic-severe combined immunodeficiency interleukin-2 receptor gamma chain gene mouse model of xenogeneic graft-versus-host-like disease and the role of host major histocompatibility complex. Clinical & Experimental Immunology. 157, (1), 104-118 (2009).
  7. Lucas, P. J., Shearer, G. M., Neudorf, S., Gress, R. E. The human antimurine xenogeneic cytotoxic response. I. Dependence on responder antigen-presenting cells. Journal of Immunology. 144, (12), 4548-4554 (1990).
  8. Ito, R., et al. Highly sensitive model for xenogenic GVHD using severe immunodeficient NOG mice. Transplantation. 87, (11), 1654-1658 (2009).
  9. Kawasaki, Y., et al. Comprehensive Analysis of the Activation and Proliferation Kinetics and Effector Functions of Human Lymphocytes, and Antigen Presentation Capacity of Antigen-Presenting Cells in Xenogeneic Graft-Versus-Host Disease. Biology of Blood and Marrow Transplantation. 24, (8), 1563-1574 (2018).
  10. Ito, R., et al. A Novel Xenogeneic Graft-Versus-Host Disease Model for Investigating the Pathological Role of Human CD4(+) or CD8. T Cells Using Immunodeficient NOG Mice. American Journal of Transplantation. 17, (5), 1216-1228 (2017).
  11. Trotta, E., et al. A human anti-IL-2 antibody that potentiates regulatory T cells by a structure-based mechanism. Nature Medicine. 24, (7), 1005-1014 (2018).
  12. Dijke, I. E., et al. Discarded Human Thymus Is a Novel Source of Stable and Long-Lived Therapeutic Regulatory T Cells. American Journal of Transplantation. 16, (1), 58-71 (2016).
  13. Huang, F., et al. Human Gingiva-Derived Mesenchymal Stem Cells Inhibit Xeno-Graft-versus-Host Disease via CD39-CD73-Adenosine and IDO Signals. Frontiers in Immunology. 8, 68 (2017).
  14. Stockis, J., et al. Blocking immunosuppression by human Tregs in vivo with antibodies targeting integrin alphaVbeta8. Proceedings of the National Academy of Sciences of the United States of America. 114, (47), E10161-E10168 (2017).
  15. Vogelstein, B., Kinzler, K. W. Digital PCR. Proceedings of the National Academy of Sciences of the United States of America. 96, (16), 9236-9241 (1999).
  16. Quan, P. L., Sauzade, M., Brouzes, E. dPCR: A Technology Review. Sensors (Basel). 18, (4), (2018).
  17. Sykes, P. J., et al. Quantitation of targets for PCR by use of limiting dilution. Biotechniques. 13, (3), 444-449 (1992).
  18. Ma, H., et al. Evaluation of Bacterial Contamination in Goat Milk Powder Using PacBio Single Molecule Real-Time Sequencing and Droplet Digital PCR. Journal of Food Protection. 1791-1799 (2018).
  19. Vitale, S. R., et al. An optimized workflow to evaluate estrogen receptor gene mutations in small amounts of cell-free DNA. Journal of Molecular Diagnostics. (2018).
  20. Gorgannezhad, L., Umer, M., Islam, M. N., Nguyen, N. T., Shiddiky, M. J. A. Circulating tumor DNA and liquid biopsy: opportunities, challenges, and recent advances in detection technologies. Lab Chip. 18, (8), 1174-1196 (2018).
  21. Yardeni, T., Eckhaus, M., Morris, H. D., Huizing, M., Hoogstraten-Miller, S. Retro-orbital injections in mice. LabAnimal. 40, (5), 155-160 (2011).
  22. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual restraint and common compound administration routes in mice and rats. Journal of Visualized Experiments. (67), (2012).
  23. Cooke, K. R., et al. An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin. Blood. 88, (8), 3230-3239 (1996).
  24. Weisdorf, D. J., et al. Prospective grading of graft-versus-host disease after unrelated donor marrow transplantation: a grading algorithm versus blinded expert panel review. Biology of Blood and Marrow Transplantation. 9, (8), 512-518 (2003).
  25. Nervi, B., et al. Factors affecting human T cell engraftment, trafficking, and associated xenogeneic graft-vs-host disease in NOD/SCID beta2mnull mice. Experimental Hematology. 35, (12), 1823-1838 (2007).
  26. Leon-Rico, D., et al. Comparison of haematopoietic stem cell engraftment through the retro-orbital venous sinus and the lateral vein: alternative routes for bone marrow transplantation in mice. LabAnimal. 49, (2), 132-141 (2015).
  27. Ali, N., et al. Xenogeneic graft-versus-host-disease in NOD-scid IL-2Rgammanull mice display a T-effector memory phenotype. PLoS One. 7, (8), e44219 (2012).
  28. van Rijn, R. S., et al. A new xenograft model for graft-versus-host disease by intravenous transfer of human peripheral blood mononuclear cells in RAG2-/- gammac-/- double-mutant mice. Blood. 102, (7), 2522-2531 (2003).
  29. Wunderlich, M., et al. OKT3 prevents xenogeneic GVHD and allows reliable xenograft initiation from unfractionated human hematopoietic tissues. Blood. 123, (24), e134-e144 (2014).
  30. Schroeder, M. A., DiPersio, J. F. Mouse models of graft-versus-host disease: advances and limitations. Disease Models & Mechanisms. 4, (3), 318-333 (2011).
  31. Zeiser, R., Blazar, B. R. Preclinical models of acute and chronic graft-versus-host disease: how predictive are they for a successful clinical translation? Blood. 127, (25), 3117-3126 (2016).
Induktion og scoring af graft-versus-Host-sygdom i en xenogen Murinmodel og kvantificering af humane T-celler i muse væv ved hjælp af digital PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).More

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter