Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Induksjon og scoring av pode-versus-host sykdom i en Xenogeneic murine modell og kvantifisering av menneskelige T celler i mus vev ved hjelp av digital PCR

doi: 10.3791/59107 Published: May 23, 2019

Summary

Her presenterer vi en protokoll for å indusere og score sykdom i en xenogeneic pode-versus-host sykdom (xenoGVHD) modell. xenoGVHD gir en in vivo-modell for å studere immunsuppresjon av menneskelige T-celler. I tillegg beskriver vi hvordan du kan oppdage menneskelige T-celler i vev med digital PCR som et verktøy for å kvantifisere immunsuppresjon.

Abstract

Akutt pode-versus-host sykdom (GVHD) er en betydelig begrensning for pasienter som får blodkreft stilk cellen transplantasjon som terapi for hematologiske mangler og ondartet. Akutt GVHD oppstår når donor T celler anerkjenner vert vev som et utenlandsk antigen og montere en immunrespons til verten. Nåværende behandlinger involverer giftige immunsuppressiv medikamenter som gjør pasienter utsatt for infeksjon og gjentakelse. Dermed er det pågående forskning for å gi en akutt GVHD terapi som effektivt kan målrette donor T celler og redusere bivirkninger. Mye av dette pre-klinisk arbeid bruker xenogenic GVHD (xenoGVHD) murine modell som gjør det mulig for testing av immunsuppressiv behandling på menneskelige celler i stedet for murine celler i en in vivo system. Denne protokollen skisserer hvordan å indusere xenoGVHD og hvordan å blinde og standardisere klinisk scoring for å sikre konsistente resultater. I tillegg beskriver denne protokollen hvordan du bruker digital PCR til å oppdage menneskelige T-celler i mus vev, som senere kan brukes til å kvantifisere effekten av testede terapier. Den xenoGVHD modellen gir ikke bare en modell for å teste GVHD terapier, men noen terapi som kan undertrykke menneskelige T-celler, som deretter kan brukes på mange inflammatoriske sykdommer.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Allogene blodkreft stilk cellen transplantasjon (HSCT) har blitt rutinemessig behandling for pasienter som lider av hematologiske ondartet som leukemi med dårlig prognose. En betydelig komplikasjon av HSCT er akutt pode-versus-host sykdom (GVHD). En 2012 studie rapporterte at akutt GVHD utviklet i 39% av HSCT pasienter som fikk transplantasjon fra søsken givere og 59% av pasientene som fikk transplantasjon fra urelaterte donorer1. Akutt GVHD oppstår når donor-avledet T-celler angriper mottakerens organer. Den eneste vellykkede terapi for GVHD er behandling med svært immunsuppressiv narkotika2, som er svært giftig og øke risikoen for infeksjon og tumor tilbakefall. Således, til tross for forbedringer som er gjort i akutt GVHD overlevelse de siste årene3,4,5, er det fortsatt et kritisk behov for økt GVHD behandling med minimal toksisitet som fremmer langsiktig remisjon.

Det overordnede målet med følgende metoder er å indusere og score xenogeneic GVHD (xenoGVHD). Den xenoGVHD modellen ble utviklet som et verktøy for å indusere akutt GVHD med menneskelige celler i stedet for murine celler som tillater mer direkte oversettelse av pre-klinisk GVHD forskning til kliniske studier6. Denne modellen innebærer intravenøs injeksjon av humant perifere blod mononukleære celler (PBMC) i NOD-SCID IL-2Rγnull (NSG) mus som er subletalt bestrålt. Injisert menneskelige T-celler aktiveres av humant antigen presentere celler (APCs) presenterer murine antigen og aktiverte T celler migrere til fjerne vev som resulterer i systemisk betennelse og til slutt død6,7, 8 på alle , 9 andre priser , 10. sykdom patologi og progresjon i xenoGVHD modellen tett etterligne menneskelige akutt GVHD. Spesielt er de patogene menneskelige T-celler reaktive til murine Major histocompatibility Complex (MHC) proteiner, som ligner på T-cellen alloreactivity i Human GVHD6,9. Den primære fordelen med xenoGVHD modellen over musen MHC-konflikt modell, den andre mye brukt GVHD modell, er det gir mulighet for testing av terapier på menneskelige celler i stedet for murine celler. Dette gjør det mulig for testing av produkter som direkte kan oversettes til klinikken uten noen modifikasjoner fordi de er laget for å målrette menneskelige celler. Nylig har denne modellen blitt brukt til å teste et menneske anti-IL-2 antistoff11, Human Tymusatrofi regulatoriske T-celler (Tregs)12 og menneskelige Mesenchymal stamceller13 som potensielle behandlinger for akutt GVHD. I en større sammenheng kan denne modellen brukes som en in vivo undertrykkelse analysen for ethvert legemiddel eller celle type som kan undertrykke menneskelig T celle aktivitet. For eksempel brukte stockis et al.14 xenoGVHD modellen til å studere effekten av blokkering integrin ΑVβ8 på treg undertrykkende aktivitet in vivo. Dermed kan xenoGVHD modellen gi innsikt i mekanismen for enhver terapi målretting T-celler i en in vivo innstilling.

En ekstra metode som er beskrevet i denne protokollen er hvordan man skal oppdage menneskelige T-celler i mus vev ved hjelp av digitale polymerase kjedere reaksjon (dPCR). Målet med denne metoden er å tilby et verktøy for å kvantifisere migrasjon og spredning av T-celler i målet vev, som måler effekten av immunsuppressiv terapier testes i denne modellen. dPCR er en relativt ny metode for kvantifisering av nukleinsyre syrer15. Kort sagt er PCR reaksjonsblandingen delt inn i partisjoner som inneholder små antall mål sekvensen eller ikke noe mål i det hele tatt. Mål sekvensen forsterkes og oppdages ved hjelp av DNA-interkalering fargestoffer eller fluorescerende mål spesifikke sonder. dPCR kvantifiserer antall eksemplarer av mål sekvensen basert på brøkdel av positive partisjoner og Poisson ' s statistikk15,16. Oppdage T-celler med dPCR krever mye mindre vev sammenlignet med andre alternative metoder, inkludert Flow flowcytometri og histologi, og kan utføres på frossen eller fast vev. dPCR krever ikke en standard kurve for å finne kopi numre, og det er heller ikke tekniske replikerer som kreves. Dette reduserer mengden av reagens og mal DNA som trengs for dPCR sammenlignet med tradisjonell kvantitativ PCR (qPCR)16. Partisjonering av PCR-reaksjonen i sub-reaksjoner i dPCR konsentrerer effektivt mål17. Således er dPCR primært et verktøy for påvisning av sjeldne mål i en stor mengde ikke-Target DNA. For eksempel, dPCR brukes til å oppdage bakteriell forurensning i melk18, identifisere sjeldne mutasjoner i østrogen reseptoren genet19, og oppdage sirkulerende tumor DNA i blodet av pasienter20. I denne protokollen, dPCR fungerer som et effektivt verktøy for å oppdage og kvantifisere menneskelige T-celler i vev av mus med xenoGVHD.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle musen eksperimenter ble utført i samsvar, og med godkjenning fra, University of Kansas Medical Center institusjonelle Animal Care og use Committee. Alle friske menneskelige blodprøver ble innhentet under informert samtykke og med godkjennelse fra den institusjonelle Review Board ved University of Kansas Medical Center.

1. bestråling av NSG Mouse

  1. En dag før injeksjon med PBMC irradiate 8 – 12 uker gamle NSG-mus (begge kjønn kan brukes). I et sterilt biosafety kabinett, plasser mus i en sterilisert Pie bur eller microisolator. Irradiate mus i en cs137 kilde eller små dyr irradiator (f. eks RS 2000) med en total dose på 150 cGy med langsom rotasjon for å sikre jevn bestråling.
  2. Plasser mus i rene bur i et sterilt biosafety kabinett.

2. utarbeidelse av humant PBMC for injeksjon

  1. Samle nok sunt menneskeblod å isolere 1,1 x 107 PBMC per mus. Fortynne heparinisert blod i et likt volum på 2% fosterets storfe serum (FBS) i fosfat bufret saltvann (PBS).
    Merk: med denne protokollen er PMBC-avkastningen vanligvis 0,5 – 1 x 107 per 10 ml hele blod. Hver mus vil motta 107 PBMC i 100 ΜL av PBS. Den ekstra 1 x 106 i 10 μL per mus sikrer at hver mus får full dosering av PBMC, bør det være noen problemer med fylling sprøyter.
  2. Legge til 15 mL lymfocytter separasjon tetthet gradient medium (f. eks, Ficoll) til en 50 mL konisk rør og deretter forsiktig overlegg opp til 25 mL fortynnet blod på toppen av tettheten gradient. Sentrifuger røret inneholder tetthet gradient og fortynnet blod ved 400 x g for 40 min ved romtemperatur uten brems.
  3. Harvest PBMC-grensesnittet til 10 mL PBS i et 50 mL konisk rør. Sentrifuger cellene ved 400 x g i 10 min. Fjern supernatanten.
  4. Løsne pellet ved å sveipe rør og resuspend i 10 mL PBS å vaske PBMC. Sentrifuger cellene ved 400 x g i 5 min.
  5. Valgfritt Kast supernatanten og lyse røde blodceller (RBC) i celle pellet ved å legge til et volum av ammonium-klorid-kalium (ACK) lyseringsbuffer som er lik pellet volumet. Resuspend forsiktig på pellet og virvel røret i 30 – 60 s. Fyll rør med serum frie RPMI-medier og sentrifuger røret ved 400 x g i 5 min.
  6. Fjern supernatanten og re-suspendere celle pellet i 5 mL PBS. Tell cellene ved hjelp av trypan blå utelukkelse med en hemocytometer og et mikroskop.
  7. Sentrifuger cellene ved 400 x g i 5 min. Fjern supernatanten og resuspend celler ved 1 x 108 celler/ml i PBS.

3. retro-orbital injeksjon av menneskelig PBMC til mus21

  1. Plasser en anestesi kammer i en laminær Flow hette for å opprettholde sterilitet. Pre-charge anestesi kammeret med 5% isoflurane og 1 L/min oksygen strømningshastighet i 5 min.
  2. Reduser isoflurane til 2% og putte mus fra samme bur inn i anestesi kammeret. Når mus mister rettende, bedøve mus i 5 min i kammeret. I løpet av denne tiden, pre-fylle sprøyten med 100 μL (1 x 107 celler) av celle suspensjon.
  3. Plasser musen på en varmepute med nesen i en nese kjegle for å opprettholde anestesi. Sjekk for tap av bevissthet ved å knipe en fot pad og se etter mangel på refleks.
  4. Holde musen med tommelen og langfingeren. Sett inn 28 G 1/2 i nålen med skråkant ned sideveis til midtre canthus, gjennom konjunktival membranen til baksiden av øyet er nådd. Trekk forsiktig ut nålen og Injiser langsomt 100 μL av celler (1 x 107 celler).
  5. Trekk kanylen helt ut og kast sprøyten og nålen riktig. Lukk øyelokket og påfør mildt Trykk på injeksjonsstedet med en gasbind svamp.
  6. Undersøk injeksjonsstedet for hevelse eller andre synlige traumer. La musen til å gjenvinne bevisstheten i et sterilt bur foret med papirhåndklær for å hindre aspirasjon av sengetøy før du flytter til hjemmet buret. Etter noen blødning har stoppet, Påfør en enkelt dråpe proparacaine til øyet for analgesi.
    Merk: hale vene injeksjon er en alternativ metode for intravenøs injeksjon av PBMC for denne protokollen som beskrevet av Macholz et al.22.

4. klinisk scoring av akutt GVHD i mus (figur 1)23

  1. Mål GVHD score annenhver dag til mus nå en poengsum på en 2 og deretter hver dag frem til dagen for offer.
    1. Plasser buret i en laminær strømnings hette, Fjern mat og vann og sett lokket på igjen. Score aktivitet ved å observere mus i 5 min og tilordne score som følger: 0 = musen begynner å gå i et par minutter og holder vandre rundt buret, 1 = musen tar mer enn et par minutter å komme opp og går sakte rundt buret, 2 = musen ikke stå opp i 5 min og går bare når rørt.
  2. Veie hver mus i et glass beger og gi et vekttap score: 0 = < 10% endring, 1 = 10-25% endring og 2 = > 25% endring.
  3. Mens musen er fortsatt i begeret, inspisere for holdning: 0 = normal, 1 = hunching i ro, 2 = hunching svekker bevegelsen; pels tekstur: 0 = normal, 1 = mild til moderat ruffling, 2 = alvorlig ruffling, og hudens integritet : 0 = normal, 1 = skalering av poter/hale, 2 = åpenbare områder av var avdekt hud (se på ører, hale og poter for skalering).
  4. Med fem kategorier og en poengsum på 0 – 2 for hver kategori kan en mus nå en maksimums poengsum på 10. Når en mus når en poengsum på 7 eller større eller når 42 dager etter injeksjon, euthanize musen via CO2 dødshjelp eller annen metode som er godkjent av den lokale institusjonelle Animal Care og use Committee.
    Merk: for å sikre nøyaktigheten av resultatene, er scoring utført av en forsker som er blindet til behandling grupper24. I tillegg, selv om > 20% av kroppsvekt tap er anbefalt humane endepunkt for mange IACUC-protokoller, med ytterligere begrunnelse IACUC godkjenning av denne protokollen kan skaffes.

5. høsting vev for genomisk DNA fra euthanized mus og isolere genomisk DNA

  1. Analysere mus ved hjelp av sterile kirurgiske verktøy. Skjær et lite stykke vev ca 3 mm x 0,5 mm i størrelse fra et organ av interesse, f. eks, lunge, lever, eller milt. Veie vevsprøven og plasser vevet brikken i et sterilt 1,5 mL rør. Hvis samle flere vev, vaske verktøy med etanol mellom skjæring hvert organ.
  2. Frys vev ved å submerging rørene som inneholder vevet i flytende nitrogen til det stopper bobler og oppbevares i-80 ° c over natten. Tin vevsprøvene og lyse dem i henhold til et genomisk DNA (gDNA) isolasjons sett.
  3. Isoler genomisk DNA i henhold til produsentens instruksjoner som beskrevet i settet. Pass på å merke mengden av vev som ble behandlet per mikroliter av eluert gDNA (mg/μL).
    Merk: frosset vev kan oppbevares ved-80 ° c for behandling på et senere tidspunkt.

6. kvantifisering av menneskelige T-celler som bruker digital PCR (figur 2)

  1. Klargjør digitale PCR-reaksjoner i henhold til protokollen for DNA-bindende fargestoffer for den digitale PCR-maskinen som brukes. Bruk følgende primere spesifikke for humant CD3 Epsilon genomisk DNA (NCBI referanse sekvens: NG_ 007383.1); Forward primer: AGGCTGCCTTAACTCCCAAG, omvendt primer: GCCCTACCAGCTGTGGAAAC. Disse primere vil gi en enkelt band av 105 BP.
    Merk: tilsett 0,5 μL av et Begrensnings enzym, slik som HindIII, til hver reaksjon for å fordøye genomisk DNA. Pass på å teste ut forskjellige gDNA fortynninger å optimalisere separasjon av positive og negative dråper. I tillegg kan et delsett av infiltrere T-celler være ikke-patogene regulatoriske T-celler. Disse cellene kan være kvantifisert ved hjelp av ekstra primere for regulatoriske T celle markører.
  2. Utfør den digitale PCR-reaksjonen under følgende forhold: lokk ved 105 ° c, 95 ° c i 10 min (1 syklus); 95 ° c i 30 s, rampe 2 ° c/s og 55 ° c i 1 min, rampe 2 ° c/s (40 sykluser); 72 ° c i 10 min, 12 ° c hold.
    Merk: disse parametrene må kanskje justeres avhengig av digitalt PCR-utstyr.
  3. Skaff deg digitale PCR-data med analyseprogramvare. Rapportdata som antall eksemplarer per mg av vev ved hjelp av følgende ligning: (antall eksemplarer/μL) x (μL av gDNA i reaksjon) x (fortynnings faktor)/(mg vev/μL av totalt gDNA)

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Subletalt bestrålt 8-12-uke gamle NSG mus av begge kjønn som fikk menneskelige PBMC begynte å vise kliniske tegn på GVHD rundt dag 10 etter injeksjon sammenlignet med negative kontroll mus som fikk PBS bare (figur 1a). XenoGVHD-mus hadde en median overlevelse på 23,5 dager (figur 1B). Med digital PCR, CD3 Epsilon positive menneskelige T-celler kan påvises i lungene og leveren prøver av mus som fikk menneskelige PBMC. Vevsprøver fra mus injisert med PBS ble brukt som kontroller (figur 2).

Figure 1
Figur 1: GVHD sykdomsprogresjon. Subletalt bestrålt 8-12-uke gamle mannlige og kvinnelige NSG mus ble retro-orbitally injisert med 1 x 107 Human PBMC (n = 6) eller PBS (n = 4) som en negativ kontroll. Data som vises er de kombinerte resultatene av tre uavhengige eksperimenter. (A) GVHD score ble målt annenhver dag til mus nådde en score på en 2 og deretter hver dag frem til dagen for offer. Data rapportert på hvert tidspunkt for GVHD score er gjennomsnittlig ± SEM score på levende mus kombinert med den siste scorene til noen avdøde mus i hver gruppe. * p < 0,05 som bestemt av mann Whitney U-test. (B) Kaplan-Meier-kurve for overlevelse. Døden var merket da GVHD score var ≥ 7. * p < 0,05 som bestemmes av log-Rank test. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: påvisning av menneskelige T-celler ved hjelp av digital PCR. Lunge-og leverprøver ble samlet inn fra mus som ble orbitally injisert med PBS (n = 3) eller 1 x 107 Human PBMC (n = 3) når mus NÅDDE en GVHD-poengsum på ≥ 7 eller 42 dager etter injeksjon. Data ble samlet inn fra 3 uavhengige eksperimenter. gDNA ble isolert og digital PCR ble brukt til å bestemme kopier av menneskelige CD3 Epsilon per milligram av vev. (A) REPRESENTATIVE Digital PCR-plott av lunge-og leverprøver fra en mus INJISERT med PBS eller PBMC. (B) kvantifisering av eksemplarer av humant CD3 Epsilon per millgram av vev fra mus INJISERT med PBS eller PBMC. * p ≤ 0,05 som bestemt av mann Whitney U-test. Vennligst klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Sykdomsprogresjon er generelt konsistent i xenoGVHD-modellen, selv med injeksjon av PBMC fra ulike donorer, slik at flere eksperimenter kan kombineres. De viktigste trinnene som kreves for å opprettholde denne konsistensen er riktig IV injeksjon teknikk, blendende og konsistent scoring. En studie av Nervi et al.25 viste at sammenlignet med intravenøs hale vene injeksjon, retro-orbital INJEKSJONER av PBMC resulterte i mer konsistent engraftment og mer alvorlig GVHD. Leon-Rico et al.26 viste også at retro-orbital injeksjoner resulterte i mer konsistent blodkreft stilk cellen engraftment i mus i forhold til halen blodåre injeksjon. Men, om nødvendig, kan hale vene injeksjoner brukes som en alternativ metode i xenoGVHD modellen27,28,29.

Problemet med variasjon av utfall forbundet med hale vene injeksjoner kan reduseres ved å øke antall. I tillegg er det viktig at personen scoring musene er blindet til mus behandling for å unngå skjevhet i scoring av mer subjektive kriterier som aktivitet eller pels tekstur. Betydningen av blindet GVHD scoring har også blitt demonstrert i klinikken24. Personen som injiserer musene bør ikke være den samme personen som skårer musene. Hvis dette ikke er mulig, kontroll og behandling rør kan være randomisert og merket med nye ID ' s av en annen person (dvs. kontroll er A, er behandling B), slik at injeksjoner kan bli blindet. Mouse scoring bør utføres rundt samme tid hver dag og på samme dagene etter injeksjon mellom ulike eksperimenter.

En potensiell hindring i denne modellen er mangelen på GVHD utvikling. Dette kan skyldes redusert levedyktighet av PBMC som kan håndteres ved å kontrollere levedyktigheten til PBMC ved å telle celler med trypan blå. Hvis problemer med celle levedyktighet er oppstått, kan cellene bli satt i PBS supplert med 2% FBS å forbedre overlevelse. Dessuten kan færre mus injiseres på en gang for å redusere tiden cellene sitter ved romtemperatur. Effekten av retro-orbital injeksjon kan være problemet. Mus som injiseres med PBMC men ikke utvikle GVHD kan være euthanized og immunceller isolert fra deres spleens kan analyseres for tilstedeværelse av menneskelige celler via dPCR eller flyt flowcytometri. Hvis det er dårlig engraftment, så er det sannsynligvis et problem med injeksjon teknikk. Som en test av injeksjon teknikk, kan mus injiseres retro-orbitally med 200 μL av Evans blå fargestoff. Hvis injeksjonen er vellykket, ørene, poter og halen av musen vil bli blå.

Den xenoGVHD modellen etterligner tett menneskelig akutt GVHD sykdom patogenesen og progresjon30. I motsetning til murine MHC-samsvarende GVHD-modell, gjør xenoGVHD-modellen det mulig å teste effekten av immunsuppressiv terapier, inkludert humane celle terapier, på humane celler i stedet for murine celler. Dette reduserer variasjonen på grunn av Arts forskjeller når du søker forskningsresultater på klinikken. Den xenoGVHD modellen kan også tjene som en in vivo undertrykkelse analysen i andre felt av T celle forskning. Dermed resultater fra eksperimenter ved hjelp av xenoGVHD modellen kan brukes på alle menneskelige T celle-mediert inflammatorisk sykdom i tillegg til GVHD.

Det er begrensninger av xenoGVHD-modellen. Disse inkluderer eksperimentell variasjon og mulige forskjeller i GVHD-behandling sammenlignet med klinikken. Eksperimentelle inkonsekvenser kan stamme fra forskjeller i musen belastning, nettsteder av PBMC injeksjon, stråledose og mikrobiell miljø30,31. Derfor bør laboratorier som bruker denne modellen forsøke å standardisere disse parametrene for å sikre konsistente resultater. I denne protokollen beskriver vi poengberegningsmetoder som bidrar til å redusere variasjon i poengregning. Faktorer som kan begrense sammenlignbarhet av xenoGVHD data til kliniske utfall inkluderer mangelen på kontroll grupper behandlet med GVHD forebyggende narkotika og bruk av bestråling som den eneste kilden til condition i xenoGVHD modell31. I tillegg er mekanismen av xenoGVHD ikke helt recapitulate den underliggende patogenesen i menneskelig GVHD. For eksempel er det donor APCs stedet vert APCs som aktiverer menneskelige T-celler i xenoGVHD modellen, mens vert APCs spille en betydelig rolle i menneskelig GVHD7. Således, som med de fleste pre-kliniske modeller, er det inkonsekvenser og inkompatibilitet mellom xenoGVHD og menneskelige GVHD som kan begrense anvendelsen av data generert fra xenoGVHD til klinikken.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Ingen konflikter av interesse erklært.

Acknowledgments

Vi ønsker å anerkjenne laboratoriet til Lane Christenson for å gi den digitale PCR maskinen som brukes i disse eksperimentene og for den tekniske støtten som tilbys. Vi vil også gjerne takke Dr. Thomas Yankee for hans veiledning og mentorer. Disse studiene ble støttet av Tripp Family Foundation.

Materials

Name Company Catalog Number Comments
1.5 mL eppendorf tubes Fisher 05-408-129
10 mL serological pipet VWR International 89130-898
10mL BD Vacutainers - Green capped with Sodium Heparin Becton Dickinson 366480
250 µL Ranin pipette tips Rainin 17001118 Do not use other pipettes or pipet tips for droplet generation
50 mL conical tube VWR International 89039-656
96-Well ddPCR plate Bio-Rad 12001925
ACK (Ammonium-Chloride-Potassium) Lysing Buffer Lonza 10-548E Optional
Alcohol Wipes Fisher Scientific 6818
Anesthesia Chamber World Precision Instruments EZ-178 Provided by animal facility
Anesthesia Machine Parkland Scientific PM1002 Provided by animal facility
BD Vacutainer Safety-Lok Blood Collection Set Becton Dickinson 367281
DG8 Cartridges and Gaskets for QX100/QX200 Droplet Generator Bio-Rad 1864007
DNAse and RNAse free Molecular Grade H2O Life Technologies 1811318
Ethyl alcohol, Pure,200 proof, for molecular biology Sigma-Aldrich E7023-500ML
Fetal Bovine Serum Atlanta Biologicals S11150
Ficoll Fisher Scientific 45001750
Insulin Syringe Fisher Scientific 329424
Isoflurane Sigma-Aldrich CDS019936 Provided by animal facility
Liquid nitrogen N/A N/A
Mouse Irradiator Pie Cage Braintree Scientific, Inc. MPC 1 Holds up to 11 mice
Nexcare Gentle Paper Tape (a.k.a. 3M Micropore Surgical Tape / 3/4") Fisher Scientific 19-027-761
P1000 pipetman MidSci A-1000
P200 pipetman MidSci A-200
Pierceable Foil Heat Seal Bio-Rad 1814040
Pipetaid Gilson Macroman Fisher Scientific F110756
Pipet-Lite Multi Pipette L8-200XLS+ Rainin 17013805 Do not use other pipettes or pipet tips for droplet generation
Qiagen DNeasy Blood and Tissue Kit Qiagen 69506
qPCR plates VWR International 89218-292
QX200 Droplet Digital PCR System Bio-Rad 12001925 Includes droplet generator, droplet reader, laptop computer, software, associated component consumables, for EvaGreen or probe-based digital PCR applications
QX200 Droplet Generation Oil for EvaGreen Bio-Rad 1864006
QX200 ddPCR EvaGreen Supermix Bio-Rad 1864033
RNase and DNase-free plate seal Thermo Scientific 12565491
RPMI Advanced 1640 Life Technologies 12633012
Sterile Gauze Pads (2" x 2", 12-Ply) Fisher Scientific 67522
Sterile Phosphate Buffered Saline Fisher Scientific 21040CV
Sterile reservoir VWR International 89094-662
Surgial Scissors Kent Scientific INS600393-4
Surgical Forceps Kent Scientific INS650914-4

DOWNLOAD MATERIALS LIST

References

  1. Jagasia, M., et al. Risk factors for acute GVHD and survival after hematopoietic cell transplantation. Blood. 119, (1), 296-307 (2012).
  2. Bolanos-Meade, J., et al. Phase 3 clinical trial of steroids/mycophenolate mofetil vs steroids/placebo as therapy for acute GVHD: BMT CTN 0802. Blood. 124, (22), quiz 3335 3221-3227 (2014).
  3. Gooley, T. A., et al. Reduced mortality after allogeneic hematopoietic-cell transplantation. New England Journal of Medicine. 363, (22), 2091-2101 (2010).
  4. Hahn, T., et al. Significant improvement in survival after allogeneic hematopoietic cell transplantation during a period of significantly increased use, older recipient age, and use of unrelated donors. Journal of Clinical Oncology. 31, (19), 2437-2449 (2013).
  5. Khoury, H. J., et al. Improved survival after acute graft-versus-host disease diagnosis in the modern era. Haematologica. 102, (5), 958-966 (2017).
  6. King, M. A., et al. Human peripheral blood leucocyte non-obese diabetic-severe combined immunodeficiency interleukin-2 receptor gamma chain gene mouse model of xenogeneic graft-versus-host-like disease and the role of host major histocompatibility complex. Clinical & Experimental Immunology. 157, (1), 104-118 (2009).
  7. Lucas, P. J., Shearer, G. M., Neudorf, S., Gress, R. E. The human antimurine xenogeneic cytotoxic response. I. Dependence on responder antigen-presenting cells. Journal of Immunology. 144, (12), 4548-4554 (1990).
  8. Ito, R., et al. Highly sensitive model for xenogenic GVHD using severe immunodeficient NOG mice. Transplantation. 87, (11), 1654-1658 (2009).
  9. Kawasaki, Y., et al. Comprehensive Analysis of the Activation and Proliferation Kinetics and Effector Functions of Human Lymphocytes, and Antigen Presentation Capacity of Antigen-Presenting Cells in Xenogeneic Graft-Versus-Host Disease. Biology of Blood and Marrow Transplantation. 24, (8), 1563-1574 (2018).
  10. Ito, R., et al. A Novel Xenogeneic Graft-Versus-Host Disease Model for Investigating the Pathological Role of Human CD4(+) or CD8. T Cells Using Immunodeficient NOG Mice. American Journal of Transplantation. 17, (5), 1216-1228 (2017).
  11. Trotta, E., et al. A human anti-IL-2 antibody that potentiates regulatory T cells by a structure-based mechanism. Nature Medicine. 24, (7), 1005-1014 (2018).
  12. Dijke, I. E., et al. Discarded Human Thymus Is a Novel Source of Stable and Long-Lived Therapeutic Regulatory T Cells. American Journal of Transplantation. 16, (1), 58-71 (2016).
  13. Huang, F., et al. Human Gingiva-Derived Mesenchymal Stem Cells Inhibit Xeno-Graft-versus-Host Disease via CD39-CD73-Adenosine and IDO Signals. Frontiers in Immunology. 8, 68 (2017).
  14. Stockis, J., et al. Blocking immunosuppression by human Tregs in vivo with antibodies targeting integrin alphaVbeta8. Proceedings of the National Academy of Sciences of the United States of America. 114, (47), E10161-E10168 (2017).
  15. Vogelstein, B., Kinzler, K. W. Digital PCR. Proceedings of the National Academy of Sciences of the United States of America. 96, (16), 9236-9241 (1999).
  16. Quan, P. L., Sauzade, M., Brouzes, E. dPCR: A Technology Review. Sensors (Basel). 18, (4), (2018).
  17. Sykes, P. J., et al. Quantitation of targets for PCR by use of limiting dilution. Biotechniques. 13, (3), 444-449 (1992).
  18. Ma, H., et al. Evaluation of Bacterial Contamination in Goat Milk Powder Using PacBio Single Molecule Real-Time Sequencing and Droplet Digital PCR. Journal of Food Protection. 1791-1799 (2018).
  19. Vitale, S. R., et al. An optimized workflow to evaluate estrogen receptor gene mutations in small amounts of cell-free DNA. Journal of Molecular Diagnostics. (2018).
  20. Gorgannezhad, L., Umer, M., Islam, M. N., Nguyen, N. T., Shiddiky, M. J. A. Circulating tumor DNA and liquid biopsy: opportunities, challenges, and recent advances in detection technologies. Lab Chip. 18, (8), 1174-1196 (2018).
  21. Yardeni, T., Eckhaus, M., Morris, H. D., Huizing, M., Hoogstraten-Miller, S. Retro-orbital injections in mice. LabAnimal. 40, (5), 155-160 (2011).
  22. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual restraint and common compound administration routes in mice and rats. Journal of Visualized Experiments. (67), (2012).
  23. Cooke, K. R., et al. An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin. Blood. 88, (8), 3230-3239 (1996).
  24. Weisdorf, D. J., et al. Prospective grading of graft-versus-host disease after unrelated donor marrow transplantation: a grading algorithm versus blinded expert panel review. Biology of Blood and Marrow Transplantation. 9, (8), 512-518 (2003).
  25. Nervi, B., et al. Factors affecting human T cell engraftment, trafficking, and associated xenogeneic graft-vs-host disease in NOD/SCID beta2mnull mice. Experimental Hematology. 35, (12), 1823-1838 (2007).
  26. Leon-Rico, D., et al. Comparison of haematopoietic stem cell engraftment through the retro-orbital venous sinus and the lateral vein: alternative routes for bone marrow transplantation in mice. LabAnimal. 49, (2), 132-141 (2015).
  27. Ali, N., et al. Xenogeneic graft-versus-host-disease in NOD-scid IL-2Rgammanull mice display a T-effector memory phenotype. PLoS One. 7, (8), e44219 (2012).
  28. van Rijn, R. S., et al. A new xenograft model for graft-versus-host disease by intravenous transfer of human peripheral blood mononuclear cells in RAG2-/- gammac-/- double-mutant mice. Blood. 102, (7), 2522-2531 (2003).
  29. Wunderlich, M., et al. OKT3 prevents xenogeneic GVHD and allows reliable xenograft initiation from unfractionated human hematopoietic tissues. Blood. 123, (24), e134-e144 (2014).
  30. Schroeder, M. A., DiPersio, J. F. Mouse models of graft-versus-host disease: advances and limitations. Disease Models & Mechanisms. 4, (3), 318-333 (2011).
  31. Zeiser, R., Blazar, B. R. Preclinical models of acute and chronic graft-versus-host disease: how predictive are they for a successful clinical translation? Blood. 127, (25), 3117-3126 (2016).
Induksjon og scoring av pode-versus-host sykdom i en Xenogeneic murine modell og kvantifisering av menneskelige T celler i mus vev ved hjelp av digital PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).More

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter