Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Indução e pontuação da doença do enxerto versus hospedeiro em modelo murino Xenogeneico e quantificação de células T humanas em tecidos de camundongo utilizando PCR digital

doi: 10.3791/59107 Published: May 23, 2019

Summary

Aqui, nós apresentamos um protocolo para induzir e marcar a doença em um modelo xenogénica da doença do transplantar-contra-anfitrião (xenogvhd). o xenoGVHD fornece um modelo in vivo para estudar a imunossupressão de células T humanas. Adicionalmente, nós descrevemos como detectar pilhas de T humanas nos tecidos com PCR digital como uma ferramenta para quantificar o immunosuppression.

Abstract

A doença aguda do enxerto contra o hospedeiro (DECH) é uma limitação significativa para pacientes que recebem transplante de células-tronco hematopoiéticas como terapia para deficiências hematológicas e malignidades. A DECH aguda ocorre quando as células T do doador reconhecem os tecidos hospedeiros como um antígeno estrangeiro e montam uma resposta imune ao hospedeiro. Os tratamentos atuais envolvem drogas imunossupressoras tóxicas que tornam os pacientes suscetíveis à infecção e recorrência. Assim, há uma pesquisa contínua para fornecer uma terapia aguda de GVHD que possa eficazmente alvejar pilhas de T do doador e reduzir efeitos laterais. Muito deste trabalho pré-clínico usa o modelo murino xenogênico GVHD (xenoGVHD) que permite o teste de terapias imunossupressoras em células humanas em vez de células murinas em um sistema in vivo. Este protocolo descreve como induzir xenoGVHD e como cego e padronizar a pontuação clínica para garantir resultados consistentes. Adicionalmente, este protocolo descreve como usar o PCR digital para detectar pilhas de T humanas em tecidos do rato, que podem subseqüentemente ser usados para quantificar a eficácia de terapias testadas. O modelo de xenoGVHD fornece não somente um modelo para testar terapias de GVHD mas toda a terapia que pode suprimir pilhas de T humanas, que poderiam então ser aplicadas a muitas doenças inflamatórios.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A transplantação hematopoietic allogeneic da pilha de haste (HSCT) transformou-se tratamento rotineiro para os pacientes que sofrem das malignidades hematológicas tais como a leucemia com prognóstico pobre. Uma complicação significativa do TCTH é A doença aguda do enxerto contra o hospedeiro (DECH). Um estudo 2012 relatou que a DECH aguda se desenvolveu em 39% dos pacientes com TCTH recebendo transplantes de doadores irmãos e 59% dos pacientes que receberam transplantes de doadores não relacionados1. A DECH aguda ocorre quando as células T derivadas de doadores atacam os órgãos do receptor. A única terapia bem-sucedida para a DECH é o tratamento com drogas altamente imunossupressoras2, que são altamente tóxicos e aumentam o risco de infecção e recorrência tumoral. Assim, apesar das melhorias que foram feitas na sobrevivência aguda do GVHD nos últimos anos3,4,5, há ainda uma necessidade crítica para terapias melhoradas do GVHD com toxicidade mínima que promovem a remissão a longo prazo.

O objetivo geral dos seguintes métodos é induzir e marcar GVHD xenogénica (xenogvhd). O modelo de xenoGVHD foi desenvolvido como uma ferramenta para induzir a DECH aguda com células humanas, em vez de células murinas, permitindo a tradução mais direta da pesquisa pré-clínica de GVHD para ensaios clínicos6. Este modelo envolve intravenosamente injetar células mononucleares do sangue periférico humano (PBMC) em camundongos Nod-scid Il-2rγnull (NSG) que são irradiados células. As células t humanas injetadas são ativadas por células apresentadoras de antígeno humano (APCs) apresentando antígeno murino e as células t ativadas migram para tecidos distantes, resultando em inflamação sistêmica e, finalmente, morte6,7, 8 . º , 9 anos de , 10. patologia da doença e progressão no modelo xenoGVHD imitar de perto a GVHD aguda humana. Especificamente, as células t humanas patogênicas são reativas às proteínas do complexo de histocompatibilidade Major murino (MHC), que é semelhante à aloreatividade da célula t na GVHD humana6,9. A principal vantagem do modelo xenoGVHD sobre o modelo de incompatibilidade de MHC do mouse, o outro modelo de GVHD amplamente utilizado, é que permite o teste de terapias em células humanas, em vez de células murinas. Isto permite o teste dos produtos que podem diretamente ser traduzidos à clínica sem nenhumas modificações porque são feitos para alvejar pilhas humanas. Recentemente, este modelo foi usado para testar um anticorpo humano de anti-Il-211, pilhas de T reguladoras Thymic humanas (tregs)12 e pilhas de haste mesenquimais humanas13 como tratamentos potenciais para o GVHD agudo. Em um contexto mais largo, este modelo pode ser usado como um ensaio in vivo da supressão para todo o tipo da droga ou da pilha que possa suprimir a atividade humana da pilha de T. Por exemplo, Stockis et al.14 utilizaram o modelo de xenoGVHD para estudar o efeito do bloqueio da integrina αVβ8 na atividade supressora de TREG in vivo. Assim, o modelo de xenoGVHD pode fornecer a introspecção no mecanismo de toda a terapia que alvejam pilhas de T em um ajuste in vivo.

Um método adicional descrito neste protocolo é como detectar pilhas de T humanas em tecidos do rato usando a reacção em cadeia digital do polymerase (dPCR). O objetivo deste método é oferecer uma ferramenta para quantificar a migração e proliferação de células T em tecidos-alvo, que medem a eficácia das terapias imunossupressoras sendo testadas neste modelo. a dPCR é um método relativamente novo para quantificação de ácidos nucleicos15. Momentaneamente, a mistura da reação do PCR é dividida nas divisórias que contêm números pequenos da seqüência do alvo ou do nenhum alvo de todo. A sequência alvo é então amplificada e detectada usando corantes de intercalação de DNA ou sondas fluorescentes específicas do alvo. o dpcr quantifica o número de cópias da sequência de alvos com base na fração de partições positivas e nas estatísticas de Poisson15,16. A detecção de células T com dPCR requer muito menos tecido em comparação com outros métodos alternativos, incluindo citometria de fluxo e histologia, podendo ser realizada em tecido congelado ou fixo. dPCR não requer uma curva padrão para determinar os números de cópia, nem são réplicas técnicas necessárias. Isto reduz a quantidade de reagente e o ADN do molde necessários para dPCR comparado ao PCR quantitativo tradicional (qPCR)16. Particionar a reação de PCR em subreações na dPCR concentra efetivamente alvos17. Assim, o dPCR é primeiramente uma ferramenta para a deteção de alvos raros em uma grande quantidade de ADN do não-alvo. Por exemplo, o dPCR está sendo usado para detectar a contaminação bacteriana no leite18, identificar mutações raras no gene19do receptor do estrogen, e detectar o ADN de circulação do tumor no sangue dos pacientes20. Neste protocolo, o dPCR sere como uma ferramenta eficiente para detectar e quantificar pilhas de T humanas nos tecidos dos ratos com xenoGVHD.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Todos os experimentos de mouse foram realizados em conformidade, e com a aprovação da Universidade de Kansas Medical Center institucional cuidados com animais e Comitê de uso. Todas as amostras de sangue humano saudáveis foram obtidas consentimento informado e com aprovação do Conselho de revisão institucional do centro médico da Universidade de Kansas.

1. irradiação de camundongos NSG

  1. Um dia antes da injeção de PBMC, irradiar camundongos NSG antigos de 8 – 12 semanas (qualquer sexo pode ser usado). Em um gabinete de biossegurança estéril, coloque camundongos em uma gaiola de torta esterilizada ou microisolador. Irradiar camundongos em um cs137 fonte ou pequeno animal irradiador (por exemplo, RS 2000) com uma dose total de 150 cgy com rotação lenta para garantir até mesmo a irradiação.
  2. Coloc ratos em gaiolas limpas em um armário estéril da Biossegurança.

2. preparação de PBMC humano para injecção

  1. Colete sangue humano saudável suficiente para isolar 1,1 x 107 PBMC por mouse. Diluir o sangue heparinizado em um volume igual de soro bovino fetal a 2% (FBS) em soro fisiológico tamponado com fosfato (PBS).
    Nota: com este protocolo, o rendimento de PMBC é geralmente 0,5 – 1 x 107 por 10 ml de sangue total. Cada rato receberá 107 PBMC em 100 ΜL de PBS. O extra 1 x 106 em 10 μL por o rato assegura-se de que cada rato receba a dosagem cheia de PBMC, se há quaisquer edições com seringas de enchimento.
  2. Adicione um meio de gradiente de densidade de separação de linfócitos de 15 mL (por exemplo, Ficoll) a um tubo cônico de 50 mL e, em seguida, sobreponha cuidadosamente até 25 mL de sangue diluído em cima do gradiente de densidade. Centrifugue o tubo contendo gradiente de densidade e sangue diluído a 400 x g por 40 min à temperatura ambiente sem freio.
  3. Colha a interface PBMC em 10 mL de PBS em um tubo cônico de 50 mL. Centrifugue as células a 400 x g durante 10 min. Retire o sobrenadante.
  4. Afrouxe a pelota sacudendo o tubo e ressuscitá-lo em 10 mL de PBS para lavar o PBMC. Centrifugue as células a 400 x g durante 5 min.
  5. Opcional Descarte o sobrenadante e lyse glóbulos vermelhos (RBCs) na pelota da pilha adicionando um volume de tampão do lysis do amônia-cloreto-potássio (ACK) que é igual ao volume da pelota. Ressuscite suavemente o pellet e gire o tubo por 30 – 60 s. Encha o tubo com a mídia RPMI sem soro e Centrifugue o tubo em 400 x g por 5 min.
  6. Retire o sobrenadante e resuspenda o pellet celular em 5 mL de PBS. Contar as células usando Tripan exclusão azul com um hemocitômetro e um microscópio.
  7. Centrifugue as células a 400 x g durante 5 min. Retire o sobrenadante e reressuscitem as células a 1 x 108 células/ml em PBS.

3. retro-injeção orbital de PBMC humano em camundongos21

  1. Coloc uma câmara da anestesia em uma capa do fluxo laminar para manter a esterilidade. Pré-carregue a câmara de anestesia com 5% de isoflurano e 1 L/min de caudal de oxigénio durante 5 min.
  2. Reduza o isoflurano para 2% e coloque os camundongos da mesma gaiola na câmara de anestesia. Uma vez que os ratos perdem endireitar, anestesiar camundongos por 5 min na câmara. Durante este tempo, pré-encha a seringa com 100 μL (1 x 107 pilhas) da suspensão da pilha.
  3. Coloc o rato em uma almofada de aquecimento com seu nariz em um cone do nariz para manter a anestesia. Verifique a perda de consciência por beliscar uma almofada de pé e verificando a falta de reflexo.
  4. Restrain mouse com o polegar e dedo médio. Insira o 28 G 1/2 na agulha com o chanfro para baixo lateral ao canthus medial, através da membrana conjunctival até que a parte traseira do olho esteja alcangado. Retraia ligeiramente a agulha e injete lentamente 100 μL de células (1 x 107 células).
  5. Retire totalmente a agulha e elimine-a correctamente da seringa e da agulha. Feche a pálpebra e aplique uma ligeira pressão no local da injecção com uma esponja de gaze.
  6. Examine o local de injeção para inchaço ou outro trauma visível. Permita que o rato recupere a consciência em uma gaiola estéril alinhada com as toalhas de papel para impedir a aspiração do fundamento antes de mover-se para a gaiola Home. Após qualquer sangramento ter parado, aplique uma única gota de proparacaína ao olho para analgesia.
    Nota: a injeção da veia cauda é um método alternativo de injeção intravenosa de PBMC para este protocolo, conforme descrito por Macholz et al.22.

4. escore clínico da DECH aguda em camundongos (Figura 1)23

  1. Meça a contagem de GVHD cada outro dia até que os ratos alcancem uma contagem de uns 2 e então todos os dias até o dia do sacrifício.
    1. Coloque a gaiola em uma capa de fluxo laminar, retire o alimento e a água e volte a colocar a tampa. Pontuação atividade observando camundongos por 5 min e atribuir pontuações da seguinte forma: 0 = mouse começa a andar dentro de alguns minutos e continua andando em torno da gaiola, 1 = mouse leva um mais de um par de minutos para se levantar e caminha lentamente em torno de gaiola, 2 = mouse não se levanta em 5 min e só caminha quando tocado.
  2. Pesar cada rato em uma taça de vidro e dar um escore de perda de peso : 0 = < 10% de mudança, 1 = 10 – 25% de mudança e 2 = > 25% de mudança.
  3. Enquanto o mouse ainda está no copo, inspecionar para a postura: 0 = normal, 1 = hunching em repouso, 2 = hunching prejudica o movimento; textura de pele: 0 = normal, 1 = rugido leve a moderado, 2 = rufiagem grave e integridade da pele : 0 = normal, 1 = escala de patas/cauda, 2 = áreas óbvias de pele desnaturada (olhar para orelhas, cauda e patas para escamação).
  4. Com cinco categorias e uma pontuação de 0 – 2 para cada categoria, um rato pode atingir uma pontuação máxima de 10. Quando um mouse atinge uma pontuação de 7 ou maior ou atinge 42 dias após a injeção, eutanizar mouse via CO2 eutanásia ou outro método aprovado pelo Comitê de cuidados e uso de animais institucionais locais.
    Nota: para garantir a exatidão dos resultados, a pontuação é realizada por um pesquisador que está cego para os grupos de tratamento24. Adicionalmente, embora > 20% da perda de peso corporal seja o ponto final humano recomendado para muitos protocolos de IACUC, com a aprovação adicional de IACUC da justificação deste protocolo pode ser obtido.

5. colhendo tecidos para DNA genómico de camundongos eutanasiados e isolando DNA genómico

  1. Ratos dissecar usando ferramentas cirúrgicas estéreis. Corte um pequeno pedaço de tecido de cerca de 3 mm x 0,5 mm de tamanho de um órgão de interesse, por exemplo, pulmão, fígado ou baço. Pesar a amostra do tecido e coloc a parte do tecido em um tubo 1,5 mL estéril. Se coletar vários tecidos, lave as ferramentas com etanol entre cortar cada órgão.
  2. Congele os tecidos submergindo os tubos contendo o tecido em nitrogênio líquido até que ele pare de borbulhar e armazene em-80 ° c durante a noite. Descongelar as amostras de tecido e lyse-los de acordo com um DNA genômica (gDNA) kit de isolamento.
  3. Isole o DNA genómico de acordo com as instruções do fabricante, conforme descrito no kit. Certifique-se de notar a quantidade de tecido que foi processado por microlitro de gDNA eluída (mg/μL).
    Nota: os tecidos congelados podem ser armazenados em-80 ° c para processamento em um momento posterior.

6. quantificação de células T humanas utilizando PCR digital (Figura 2)

  1. Prepare reações digitais do PCR de acordo com o protocolo para tinturas de ligação do ADN para a máquina digital do PCR que está sendo usada. Use os seguintes primers específicos para o DNA genómico do Epsilon humano CD3 (seqüência de referência de NCBI: NG_ 007383.1); Iniciador dianteiro: AGGCTGCCTTAACTCCCAAG, primer reverso: GCCCTACCAGCTGTGGAAAC. Estes primers renderá uma única faixa de 105 BP.
    Nota: Adicionar 0,5 μL de uma enzima de restrição, como a HindIII, a cada reacção para digerir o ADN genómico. Certifique-se de testar diferentes diluições de gDNA para otimizar a separação de gotículas positivas e negativas. Adicionalmente, um subconjunto de células T infiltrantes pode ser células T reguladoras não patogênicas. Essas células podem ser quantificadas usando primers adicionais para marcadores de células T regulatórias.
  2. Realize a reacção de PCR digital nas seguintes condições: tampa a 105 ° c, 95 ° c durante 10 min (1 ciclo); 95 ° c para 30 s, rampa 2 ° c/s e 55 ° c por 1 minuto, rampa 2 ° c/s (40 ciclos); 72 ° c por 10 min, 12 ° c Hold.
    Nota: estes parâmetros podem precisar de ser ajustados dependendo do equipamento digital do PCR.
  3. Adquira dados de PCR digital com software de análise. Dados do relatório como números de cópias por mg de tecido utilizando a seguinte equação: (número de cópias/μL) x (μL de gDNA em reacção) x (factor de diluição)/(mg de tecido/μL de gDNA total)

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Os ratos de NSG de idade 8-12-Week irradiados sublethally de ambos os sexos que receberam o PBMC humano começaram a indicar sinais clínicos de GVHD em torno do dia 10 injeção do borne comparados aos ratos do controle negativo que receberam PBS somente (Figura 1a). Camundongos XenoGVHD tiveram sobrevida mediana de 23,5 dias (Figura 1b). Com PCR digital, as células T humanas positivas do Epsilon CD3 podiam ser detectadas nas amostras do pulmão e do fígado dos ratos que receberam o PBMC humano. Amostras de tecido de camundongos injetados com PBS foram utilizadas como controles (Figura 2).

Figure 1
Figura 1: progressão da doença de GVHD. Os ratos machos e fêmeas de NSG de 8-12-week-old irradiados sublethally foram injetaram retroorbitalmente com 1 x 107 PBMC humano (n = 6) ou PBS (n = 4) como um controle negativo. Os dados mostrados são os resultados combinados de três experimentos independentes. (A) escore de GVHD foi medido todos os dias até que os camundongos atingiram uma pontuação de 2 e, em seguida, todos os dias até o dia do sacrifício. Os dados relatados em cada momento para escore de DECH são a média ± escore de SEM dos camundongos vivos combinados com os últimos escores de qualquer camundongo falecido em cada grupo. * p < 0, 5 conforme determinado pelo teste U de Mann Whitney. (B) curva de sobrevida de Kaplan-Meier. A morte foi marcada quando o escore de DECH foi ≥ 7. * p < 0, 5 conforme determinado pelo teste de log-rank. Por favor clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: detecção de células T humanas utilizando PCR digital. Amostras de pulmão e fígado foram coletadas de camundongos que foram injetados orbitalmente com PBS (n = 3) ou 1 x 107 PBMC humano (n = 3) quando os camundongos atingiram um escore de GVHD ≥ 7 ou 42 dias após a injeção. Os dados foram coletados em 3 experimentos independentes. o gDNA foi isolado e a PCR digital foi utilizada para determinar as cópias do Epsilon humano CD3 por miligrama de tecido. (A) parcela de PCR digital representativa de amostras de pulmão e fígado de um rato injetado com PBS ou PBMC. (B) quantificação de cópias do Epsilon humano CD3 por milograma de tecido de camundongos injetados com PBS ou PBMC. * p ≤ 0, 5 conforme determinado pelo teste U de Mann Whitney. Por favor clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A progressão da doença é geralmente consistente no modelo xenoGVHD, mesmo com a injeção de PBMC de diferentes doadores, de modo que vários experimentos podem ser combinados. As etapas chaves exigidas para manter esta consistência são técnica apropriada da injeção de i.v., cegando e marcando consistente. Um estudo de Nervi et al.25 demonstrou que, comparado à injeção venosa da veia cauda, as injeções retroorbitais de PBMC resultaram em Engraftment mais consistente e em DECH mais grave. Leon-rico et al.26 também demonstraram que as injeções retroorbitais resultaram em Engraftment hematopoiético de células-tronco mais consistentes em camundongos em comparação com a injeção da veia cauda. Entretanto, se necessário, as injeções da veia cauda podem ser usadas como método alternativo no modelo de xenogvhd27,28,29.

O problema da variabilidade dos desfechos associados às injeções da veia cauda pode ser reduzido pelo aumento do número de sujeitos. Adicionalmente, é importante que a pessoa que Marc os ratos esteja cega ao tratamento do rato para evitar o viés na pontuação de critérios mais subjetivos tais como a atividade ou a textura da pele. A importância da Pontuação de GVHD cega também foi demonstrada na clínica24. A pessoa que injeta os ratos não deve ser a mesma pessoa marcando os ratos. Se isso não for possível, os tubos de controle e tratamento podem ser randomizados e rotulados com novos ID ' s por outra pessoa (ou seja, o controle é A, o tratamento é B) para que as injeções possam ser cegas. A Pontuação do mouse deve ser realizada em torno da mesma hora todos os dias e no mesmo dia após a injeção entre diferentes experimentos.

Um obstáculo potencial neste modelo é a falta de desenvolvimento de GVHD. Isto poderia ser devido à viabilidade reduzida de PBMC que pode ser endereçada verific a viabilidade de PBMC contando pilhas com azul do Tripan. Se o problema com a viabilidade celular é encontrado, as células podem ser colocadas em PBS suplementado com 2% FBS para melhorar a sobrevivência. Além disso, menos camundongos podem ser injetados em um momento para reduzir as células de tempo sentar à temperatura ambiente. A eficácia da injeção retro-orbital pode ser o problema. Camundongos que são injetados com PBMC, mas não desenvolvem GVHD pode ser eutanasiado e células imunes isoladas de seus baços podem ser analisados para a presença de células humanas via dPCR ou citometria de fluxo. Se houver Engraftment pobres, então há provavelmente um problema com a técnica de injeção. Como um teste da técnica da injeção, os ratos podem ser injetados retro-Orbitally com 200 μL do corante azul de Evans. Se a injeção for bem-sucedida, as orelhas, patas e cauda do mouse ficará azul.

O modelo de xenoGVHD imita pròxima a patogénese e a progressão agudas humanas da doença de GVHD30. Ao contrário do modelo murino da incompatibilidade de MHC GVHD, o modelo de xenogvhd permite o teste do efeito de terapias imunossupressores, incluindo terapias humanas da pilha, em pilhas humanas um pouco do que pilhas murino. Isto reduz a variação devido às diferenças das espécies ao aplicar resultados da pesquisa à clínica. O modelo xenoGVHD também pode servir como um ensaio de supressão in vivo em outros campos da pesquisa de células T. Assim, os resultados dos experimentos que utilizam o modelo xenoGVHD podem ser aplicados a qualquer doença inflamatória mediada por células T humana, além da DECH.

Há limitações do modelo xenoGVHD. Estes incluem variabilidade experimental e possíveis diferenças no tratamento da DECH em relação à clínica. Inconsistências experimentais podem ser decorrentes de diferenças na cepa do mouse, locais de injeção de PBMC, dose de radiação e ambiente microbiano30,31. Assim, os laboratórios que utilizam este modelo devem tentar padronizar esses parâmetros para garantir resultados consistentes. Neste protocolo, descrevemos os métodos de pontuação que ajudam a reduzir a variabilidade na pontuação. Fatores que podem limitar a comparabilidade dos dados de xenoGVHD aos desfechos clínicos incluem a falta de grupos de controle tratados com drogas profiláticas da GVHD e o uso da irradiação como a única fonte de condicionamento no modelo xenoGVHD31. Adicionalmente, o mecanismo de xenogvhd não recapitular completamente a patogénese subjacente na GVHD humana. Por exemplo, são APCs doadores em vez de APCs hospedeiros que ativam células T humanas no modelo xenoGVHD, enquanto os APCs hospedeiros desempenham um papel significativo na GVHD7humana. Assim, como na maioria dos modelos pré-clínicos, existem inconsistências e incompatibilidades entre xenoGVHD e GVHD humano que podem limitar a aplicação de dados gerados a partir do xenoGVHD para a clínica.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Nenhum conflito de interesses declarado.

Acknowledgments

Nós gostaríamos de reconhecer o laboratório de Lane Christenson para fornecer a máquina digital do PCR usada nestas experiências e para o apoio técnico fornecido. Também gostaríamos de agradecer ao Dr. Thomas Yankee por sua orientação e mentoria. Estes estudos foram apoiados pela Fundação família Tripp.

Materials

Name Company Catalog Number Comments
1.5 mL eppendorf tubes Fisher 05-408-129
10 mL serological pipet VWR International 89130-898
10mL BD Vacutainers - Green capped with Sodium Heparin Becton Dickinson 366480
250 µL Ranin pipette tips Rainin 17001118 Do not use other pipettes or pipet tips for droplet generation
50 mL conical tube VWR International 89039-656
96-Well ddPCR plate Bio-Rad 12001925
ACK (Ammonium-Chloride-Potassium) Lysing Buffer Lonza 10-548E Optional
Alcohol Wipes Fisher Scientific 6818
Anesthesia Chamber World Precision Instruments EZ-178 Provided by animal facility
Anesthesia Machine Parkland Scientific PM1002 Provided by animal facility
BD Vacutainer Safety-Lok Blood Collection Set Becton Dickinson 367281
DG8 Cartridges and Gaskets for QX100/QX200 Droplet Generator Bio-Rad 1864007
DNAse and RNAse free Molecular Grade H2O Life Technologies 1811318
Ethyl alcohol, Pure,200 proof, for molecular biology Sigma-Aldrich E7023-500ML
Fetal Bovine Serum Atlanta Biologicals S11150
Ficoll Fisher Scientific 45001750
Insulin Syringe Fisher Scientific 329424
Isoflurane Sigma-Aldrich CDS019936 Provided by animal facility
Liquid nitrogen N/A N/A
Mouse Irradiator Pie Cage Braintree Scientific, Inc. MPC 1 Holds up to 11 mice
Nexcare Gentle Paper Tape (a.k.a. 3M Micropore Surgical Tape / 3/4") Fisher Scientific 19-027-761
P1000 pipetman MidSci A-1000
P200 pipetman MidSci A-200
Pierceable Foil Heat Seal Bio-Rad 1814040
Pipetaid Gilson Macroman Fisher Scientific F110756
Pipet-Lite Multi Pipette L8-200XLS+ Rainin 17013805 Do not use other pipettes or pipet tips for droplet generation
Qiagen DNeasy Blood and Tissue Kit Qiagen 69506
qPCR plates VWR International 89218-292
QX200 Droplet Digital PCR System Bio-Rad 12001925 Includes droplet generator, droplet reader, laptop computer, software, associated component consumables, for EvaGreen or probe-based digital PCR applications
QX200 Droplet Generation Oil for EvaGreen Bio-Rad 1864006
QX200 ddPCR EvaGreen Supermix Bio-Rad 1864033
RNase and DNase-free plate seal Thermo Scientific 12565491
RPMI Advanced 1640 Life Technologies 12633012
Sterile Gauze Pads (2" x 2", 12-Ply) Fisher Scientific 67522
Sterile Phosphate Buffered Saline Fisher Scientific 21040CV
Sterile reservoir VWR International 89094-662
Surgial Scissors Kent Scientific INS600393-4
Surgical Forceps Kent Scientific INS650914-4

DOWNLOAD MATERIALS LIST

References

  1. Jagasia, M., et al. Risk factors for acute GVHD and survival after hematopoietic cell transplantation. Blood. 119, (1), 296-307 (2012).
  2. Bolanos-Meade, J., et al. Phase 3 clinical trial of steroids/mycophenolate mofetil vs steroids/placebo as therapy for acute GVHD: BMT CTN 0802. Blood. 124, (22), quiz 3335 3221-3227 (2014).
  3. Gooley, T. A., et al. Reduced mortality after allogeneic hematopoietic-cell transplantation. New England Journal of Medicine. 363, (22), 2091-2101 (2010).
  4. Hahn, T., et al. Significant improvement in survival after allogeneic hematopoietic cell transplantation during a period of significantly increased use, older recipient age, and use of unrelated donors. Journal of Clinical Oncology. 31, (19), 2437-2449 (2013).
  5. Khoury, H. J., et al. Improved survival after acute graft-versus-host disease diagnosis in the modern era. Haematologica. 102, (5), 958-966 (2017).
  6. King, M. A., et al. Human peripheral blood leucocyte non-obese diabetic-severe combined immunodeficiency interleukin-2 receptor gamma chain gene mouse model of xenogeneic graft-versus-host-like disease and the role of host major histocompatibility complex. Clinical & Experimental Immunology. 157, (1), 104-118 (2009).
  7. Lucas, P. J., Shearer, G. M., Neudorf, S., Gress, R. E. The human antimurine xenogeneic cytotoxic response. I. Dependence on responder antigen-presenting cells. Journal of Immunology. 144, (12), 4548-4554 (1990).
  8. Ito, R., et al. Highly sensitive model for xenogenic GVHD using severe immunodeficient NOG mice. Transplantation. 87, (11), 1654-1658 (2009).
  9. Kawasaki, Y., et al. Comprehensive Analysis of the Activation and Proliferation Kinetics and Effector Functions of Human Lymphocytes, and Antigen Presentation Capacity of Antigen-Presenting Cells in Xenogeneic Graft-Versus-Host Disease. Biology of Blood and Marrow Transplantation. 24, (8), 1563-1574 (2018).
  10. Ito, R., et al. A Novel Xenogeneic Graft-Versus-Host Disease Model for Investigating the Pathological Role of Human CD4(+) or CD8. T Cells Using Immunodeficient NOG Mice. American Journal of Transplantation. 17, (5), 1216-1228 (2017).
  11. Trotta, E., et al. A human anti-IL-2 antibody that potentiates regulatory T cells by a structure-based mechanism. Nature Medicine. 24, (7), 1005-1014 (2018).
  12. Dijke, I. E., et al. Discarded Human Thymus Is a Novel Source of Stable and Long-Lived Therapeutic Regulatory T Cells. American Journal of Transplantation. 16, (1), 58-71 (2016).
  13. Huang, F., et al. Human Gingiva-Derived Mesenchymal Stem Cells Inhibit Xeno-Graft-versus-Host Disease via CD39-CD73-Adenosine and IDO Signals. Frontiers in Immunology. 8, 68 (2017).
  14. Stockis, J., et al. Blocking immunosuppression by human Tregs in vivo with antibodies targeting integrin alphaVbeta8. Proceedings of the National Academy of Sciences of the United States of America. 114, (47), E10161-E10168 (2017).
  15. Vogelstein, B., Kinzler, K. W. Digital PCR. Proceedings of the National Academy of Sciences of the United States of America. 96, (16), 9236-9241 (1999).
  16. Quan, P. L., Sauzade, M., Brouzes, E. dPCR: A Technology Review. Sensors (Basel). 18, (4), (2018).
  17. Sykes, P. J., et al. Quantitation of targets for PCR by use of limiting dilution. Biotechniques. 13, (3), 444-449 (1992).
  18. Ma, H., et al. Evaluation of Bacterial Contamination in Goat Milk Powder Using PacBio Single Molecule Real-Time Sequencing and Droplet Digital PCR. Journal of Food Protection. 1791-1799 (2018).
  19. Vitale, S. R., et al. An optimized workflow to evaluate estrogen receptor gene mutations in small amounts of cell-free DNA. Journal of Molecular Diagnostics. (2018).
  20. Gorgannezhad, L., Umer, M., Islam, M. N., Nguyen, N. T., Shiddiky, M. J. A. Circulating tumor DNA and liquid biopsy: opportunities, challenges, and recent advances in detection technologies. Lab Chip. 18, (8), 1174-1196 (2018).
  21. Yardeni, T., Eckhaus, M., Morris, H. D., Huizing, M., Hoogstraten-Miller, S. Retro-orbital injections in mice. LabAnimal. 40, (5), 155-160 (2011).
  22. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual restraint and common compound administration routes in mice and rats. Journal of Visualized Experiments. (67), (2012).
  23. Cooke, K. R., et al. An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin. Blood. 88, (8), 3230-3239 (1996).
  24. Weisdorf, D. J., et al. Prospective grading of graft-versus-host disease after unrelated donor marrow transplantation: a grading algorithm versus blinded expert panel review. Biology of Blood and Marrow Transplantation. 9, (8), 512-518 (2003).
  25. Nervi, B., et al. Factors affecting human T cell engraftment, trafficking, and associated xenogeneic graft-vs-host disease in NOD/SCID beta2mnull mice. Experimental Hematology. 35, (12), 1823-1838 (2007).
  26. Leon-Rico, D., et al. Comparison of haematopoietic stem cell engraftment through the retro-orbital venous sinus and the lateral vein: alternative routes for bone marrow transplantation in mice. LabAnimal. 49, (2), 132-141 (2015).
  27. Ali, N., et al. Xenogeneic graft-versus-host-disease in NOD-scid IL-2Rgammanull mice display a T-effector memory phenotype. PLoS One. 7, (8), e44219 (2012).
  28. van Rijn, R. S., et al. A new xenograft model for graft-versus-host disease by intravenous transfer of human peripheral blood mononuclear cells in RAG2-/- gammac-/- double-mutant mice. Blood. 102, (7), 2522-2531 (2003).
  29. Wunderlich, M., et al. OKT3 prevents xenogeneic GVHD and allows reliable xenograft initiation from unfractionated human hematopoietic tissues. Blood. 123, (24), e134-e144 (2014).
  30. Schroeder, M. A., DiPersio, J. F. Mouse models of graft-versus-host disease: advances and limitations. Disease Models & Mechanisms. 4, (3), 318-333 (2011).
  31. Zeiser, R., Blazar, B. R. Preclinical models of acute and chronic graft-versus-host disease: how predictive are they for a successful clinical translation? Blood. 127, (25), 3117-3126 (2016).
Indução e pontuação da doença do enxerto versus hospedeiro em modelo murino Xenogeneico e quantificação de células T humanas em tecidos de camundongo utilizando PCR digital
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).More

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter