Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Bir Xenogeneic Murine modelinde Graft-versus-Host hastalığının indüksiyon ve skorlama ve dijital PCR kullanarak fare dokularında ınsan T hücrelerinin ölçümü

doi: 10.3791/59107 Published: May 23, 2019

Summary

Burada, bir xenogeneic Graft-versus-Host hastalığı (xenoGVHD) modelinde hastalığı teşvik etmek ve puan vermek için bir protokol sunuyoruz. xenoGVHD, insan T hücrelerinin bağışıklık bastırılmasını incelemek için bir in vivo modeli sağlar. Ayrıca, immunobastırma ölçmek için bir araç olarak dijital PCR ile dokularda insan T hücrelerinin nasıl algılanmasını açıklar.

Abstract

Akut Greft-versus-Host hastalığı (GVHD), hematolojik eksiklikler ve malignite tedavisi olarak hematopoetik kök hücre nakli yapan hastalar için önemli bir sınırlamadır. Akut GVHD, donör T hücrelerinin bir yabancı antijen olarak ana dokular tanımak ve ev sahipliği için bir bağışıklık yanıtı monte oluşur. Mevcut tedaviler enfeksiyon ve nüks duyarlı hastalar render toksik immünrepresif ilaçlar içerir. Böylece, etkili bir şekilde donör T hücrelerini hedef ve yan etkileri azaltmak akut GVHD tedavisi sağlamak için sürekli araştırma vardır. Bu öncesi klinik çalışmanın çoğu, bir in vivo sistemde murine hücreleri yerine insan hücrelerinde immünopresif tedavilerin test edilmesini sağlayan ksenojen GVHD (xenogvhd) duvar modelini kullanır. Bu protokol, xenoGVHD 'ye nasıl neden olduğunu ve tutarlı sonuçlar sağlamak için klinik skorlamayı nasıl kör ve standartlaştırmayı özetliyor. Ayrıca, bu protokol, daha sonra test edilen tedavilerin etkinliğini ölçmek için kullanılabilecek fare dokularında insan T hücrelerini algılamak için dijital PCR nasıl kullanılacağını açıklar. XenoGVHD modeli sadece GVHD terapileri test etmek için bir model ancak daha sonra birçok inflamatuar hastalıklara uygulanabilir insan T hücrelerini bastırabilir herhangi bir tedavi sağlar.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Allojeneik hematopoetik kök hücre nakli (HSCT), lösemi gibi hematolojik malignite hastalarında kötü prognoz ile rutin tedavi haline gelmiştir. HSCT 'nin önemli bir komplikasyonu akut Greft-versus-Host hastalığıdır (GVHD). Bir 2012 çalışma, akut GVHD 'nin HSCT hastalarının% 39 ' inde, kardeş bağışçılardan nakil alan hastaların% 59 ' inde, alakasız bağışçılar1' den nakli alan hastalarda geliştiği bildirildi. Akut GVHD, donör türeyen T hücrelerinin alıcı organlarına saldırırken oluşur. GVHD için tek başarılı terapi, son derece toksik olan ve enfeksiyon ve tümör nüks riskini artıran, son derece immünpresif ilaçlar2ile tedavi etmektir. Böylece, son yıllarda akut GVHD hayatta kalımına yapılan iyileştirmeler rağmen3,4,5, hala uzun vadeli remisyon teşvik minimal toksisite ile geliştirilmiş GVHD tedaviler için kritik bir ihtiyaç vardır.

Aşağıdaki yöntemlerin genel amacı, xenogeneic GVHD 'yi (xenoGVHD) teşvik etmek ve puanlar etmektir. XenoGVHD modeli klinik deneyler için önceden klinik GVHD araştırma daha doğrudan çeviri için izin murine hücreleri yerine insan hücreleri ile akut GVHD ikna etmek için bir araç olarak geliştirilmiştir6. Bu model, intravenöz olarak insan periferik kan mononükleer hücreleri enjekte eder (PBMC) içine NOD-SCID IL-2Rγnull (NSG) sublethally ışınlanmış fareler. Enjekte insan T hücreleri insan antijen sunan hücreler tarafından aktive edilir (APCs) murine antijeni sunan ve aktif T hücreleri sistemik inflamasyona neden uzak dokulara göç ve sonuçta ölüm6,7, 8 , 9 , 10. hastalık patolojisi ve xenoGVHD modelinde progresyon yakından insan akut GVHD taklit. Özellikle, patojenik insan t hücreleri, insan GVHD6,9' da T hücresi kodlamaktadırlar 'a benzeyen, murine büyük histouyumluluk kompleksi (MHC) proteinlerine reaktif olmaktadır. XenoGVHD modelinin birincil avantajı fare MHC-uyuşmazlığı modeli, diğer yaygın olarak kullanılan GVHD modeli üzerinde, insan hücreleri yerine murine hücreler üzerinde tedaviler test etmek için izin verir. Bu, insan hücrelerini hedef almak için yapılan herhangi bir değişiklik olmadan doğrudan kliniğe tercüme edilebilir ürünlerin test etmek için izin verir. Son zamanlarda, bu model bir insan anti-IL-2 antikor test etmek için kullanılan11, insan timik düzenleyici T hücreleri (tregs)12 ve insan mesenkimal kök hücreleri13 akut GVHD için potansiyel tedaviler olarak. Daha geniş bir bağlamda, bu model, insan T hücresi etkinliğini bastırabilir herhangi bir ilaç veya hücre türü için bir in vivo bastırma tahlil olarak kullanılabilir. Örneğin, stockis ve al.14 , xenogvhd modelini, αvβ8 entegrenin engelleme efektini in vivo olarak Treg baskılayıcı aktivitesinde incelemek için kullandı . Böylece, xenoGVHD modeli bir in vivo ayarında T hücrelerini hedefleyen herhangi bir tedavinin mekanizması içine anlayış sağlayabilir.

Bu protokolde açıklanan ek bir yöntem, dijital polimeraz zincir reaksiyonu (dPCR) kullanarak fare dokularındaki insan T hücrelerini nasıl algılayabilirsiniz. Bu yöntemin amacı, bu modelde test edilen immünosupresif tedavilerin etkinliğini ölçen hedef dokularda T hücrelerinin göç ve proliferasyonu ölçmek için bir araç sunması. dPCR, nükrenik asitlerin ölçülmesini belirlemek için nispeten yeni bir yöntemdir15. Kısaca, PCR reaksiyon karışımı, hedef dizinin az sayıda veya hiçbir hedef içeren bölümlere ayrılır. Hedef dizi daha sonra güçlendirilir ve DNA enterkalasyon boyalar veya floresan hedef spesifik problar kullanılarak algılanır. dpcr pozitif bölümler ve Poisson istatistikleri15,16kesir dayalı hedef dizinin kopya sayısını nicelik. DPCR ile T hücrelerinin tespiti, Akış sitometrisi ve histolojisi de dahil olmak üzere diğer alternatif yöntemlerle karşılaştırıldığında çok daha az doku gerektirir ve dondurulmuş veya sabit doku üzerinde yapılabilir. dPCR kopya numaralarını belirlemek için standart bir eğri gerektirmez, ne de teknik çoğaltır gereklidir. Bu, geleneksel nicel PCR (qPCR)16Ile karşılaştırıldığında dpcr için gereken reaktif ve şablon DNA miktarını azaltır. PCR reaksiyonunun dPCR 'de alt reaksiyonlarına bölünmesi, hedefleri17' ye yoğunlaşır. Böylece, dPCR öncelikle olmayan hedef DNA büyük miktarda nadir hedefleri tespiti için bir araçtır. Örneğin, dPCR süt bakteriyel kontaminasyonu algılamak için kullanılan18, östrojen reseptör geni nadir mutasyonlar belirlemek19, ve hastaların KANıNDA dolaşan tümör DNA algılamak20. Bu protokolde dPCR, xenoGVHD ile fare dokularında insan T hücrelerini tespit etmek ve ölçmek için etkili bir araç olarak hizmet vermektedir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tüm fare denemeleri uygunluk ve onayı ile yapıldı, Kansas Üniversitesi Tıp Merkezi kurumsal hayvan bakımı ve kullanım Komitesi. Tüm sağlıklı insan kanı örnekleri bilgilendirilmiş onay altında ve Kansas Üniversitesi Tıp Merkezi 'nde kurumsal Inceleme Kurulu onayı ile elde edildi.

1. NSG fareler ışınlama

  1. PBMC enjeksiyonu için bir gün önce, 8 – 12 haftalık NSG fareler (ya seks kullanılabilir) radyasyona. Steril bir Biyogüvenlik kabininde, fare sterilize edilmiş bir pasta kafesi veya mikroizolatörde yer. Bir CS137 kaynak veya küçük hayvan radyatörü (örn., RS 2000) ırradiate fareler toplam doz Ile 150 cGy yavaş rotasyon bile ışınlama sağlamak için.
  2. Steril Biyogüvenlik kabininde fareler temiz kafeslere yerleştirin.

2. enjeksiyon için insan PBMC hazırlanması

  1. 1,1 x 107 PBMC fare başına izole etmek için yeterli sağlıklı insan kanı toplayın. Fosfat tamponlu tuzlu (PBS) içinde 2% fetal sığır serumu (FBS) eşit hacimli heparinize kan seyreltilir.
    Not: Bu protokol Ile, PMBC verim genellikle 0,5 – 1 x 107 başına 10 ml tam kan. Her fare, PBS 100 μL 'de 107 PBMC alacaktır. Ekstra 1 x 106 ın 10 μL başına fare her fare PBMC tam doz almasını sağlar, herhangi bir sorun olması gerekir şırınga doldurma.
  2. 15 mL lenfosit ayırma yoğunluğu degrade Orta (örneğin, Ficoll) bir 50 mL konik tüp ekleyin ve daha sonra dikkatle yoğunluk gradyan üzerine 25 mL seyreltilmiş kan kadar bindirme. Yoğunluk degradesi ve seyreltilmiş kanı içeren tüpü 400 x g 'de, fren olmadan oda sıcaklığında 40 dakika boyunca santrifüjün.
  3. 50 mL konik tüpte PBMC arayüzünü 10 mL PBS 'ye topla. 400 x g 'de hücrelerin Santrifüjü 10 dakika boyunca kaldırın.
  4. PBMC yıkamak için 10 ml PBS tüp ve pelletini Flicking tarafından Pelet gevşetin. 400 x g 'de hücreleri 5 dakika santrifüjler.
  5. Isteğe bağlı Pelet hacmine eşit olan amonyum klorür-potasyum (ACK) liziz tamponunun bir hacmini ekleyerek hücre peleti içinde süpernatant ve Lyse kırmızı kan hücrelerini (RBCs) atın. Yavaşça Pelet pelletini ve girdap tüp 30-60 s. dolgu tüp serum-ücretsiz rpmi medya ve santrifüj tüp 400 x g 5 dakika.
  6. Süpernatant çıkarın ve PBS 5 ml hücre Pelet yeniden askıya. Bir hemokytometer ve mikroskop ile tripan mavi dışlama kullanarak hücreleri saymak.
  7. Hücreleri 5 dk. 400 x g 'de santrifüjler, PBS 'de 1 x 108 hücreli/ml 'de süpernatant ve pelletini hücrelerini çıkarın.

3. Retro-farelere ınsan PBMC orbital enjeksiyon21

  1. Sterilitesi korumak için bir laminar akış kaputu bir anestezi odası yerleştirin. Anestezi odasını 5 dakika boyunca% 5 isofluran ve 1 L/dak oksijen debisi ile ön şarj edin.
  2. Isoflurane 'i% 2 ' ye azaltın ve aynı kafesten anestezi odasına fareler koyun. Fareler nişan aldıktan sonra, 5 dakika boyunca farelere anestezi yapın. Bu süre zarfında, 100 μL (1 x 107 hücreli) hücreli süspansiyon ile şırıngayı önceden doldurun.
  3. Anestezi korumak için bir burun koni içinde burun ile bir Isıtma Pad üzerine fare yerleştirin. Bir ayak Pad pinching ve refleks eksikliği kontrol ederek bilinç kaybını kontrol edin.
  4. Başparmak ve orta parmak ile fareyi restrain. 28 G 1/2 iğne içine eğim ile medial canthus lateral aşağı yerleştirin, konjonktival membran göz geri ulaşılana kadar. İğneyi biraz geri çekin ve 100 μL hücre (1 x 107 hücre) yavaşça enjekte edilir.
  5. İğneyi tamamen geri çekin ve şırınga ve iğneyi düzgün bir şekilde atın. Göz kapağı kapatın ve bir gazlı bez sünger ile enjeksiyon site hafif basınç uygulayın.
  6. Şişme veya diğer görünür travma için enjeksiyon site inceleyin. Fare ev kafesi geçmeden önce yatak aspirasyonu önlemek için kağıt havlu ile kaplı steril bir kafes içinde bilinç yeniden kazanmak için izin verin. Herhangi bir kanama durdu sonra, analjezi için göz proparakain tek bir damla uygulayın.
    Not: kuyruk ven enjeksiyonu, Macholz ve al.22tarafından açıklandığı gibi bu protokol için PBMC intravenöz enjeksiyonu alternatif bir yöntemdir.

4. farelerde akut GVHD 'nin klinik skorlaması (Şekil 1)23

  1. Ölçü GVHD puan her gün fareler bir puan ulaşmak kadar 2 ve sonra her gün kurban gün kadar.
    1. Kafes bir laminar akış kaputu yerleştirin, gıda ve su kaldırmak ve kapağı geri koymak. 5 dakika fareler gözlemleyerek ve puanları aşağıdaki gibi atamak tarafından puanı aktivite : 0 = fare birkaç dakika içinde yürüyüş başlar ve kafes etrafında yürümeye devam eder, 1 = fare almak için bir kaç dakika sürer ve kafes etrafında yavaşça yürüyor, 2 = fare yukarı alamadım 5 dakika ve sadece dokundu zaman yürür.
  2. Bir cam kabı her fare tartmak ve kilo kaybı puanı vermek: 0 = <% 10 değişim, 1 = 10 – 25% değişim ve 2 = >% 25 değişim.
  3. Fare hala Beaker iken, duruşiçin kontrol edin: 0 = normal, 1 = dinlenirken hunching, 2 = hunching hareket zarar; kürk dokusu: 0 = normal, 1 = hafif için orta ruffling, 2 = şiddetli ruffling, ve cilt bütünlüğü : 0 = normal, 1 = pençeleri/kuyruk ölçekleme, 2 = denuded cildin belirgin alanları (kulak, kuyruk ve ölçekleme için pençeleri bakın).
  4. Beş kategori ve her kategori için 0 – 2 puan ile bir fare maksimum 10 puan ulaşabilir. Bir fare 7 veya daha büyük bir puan ulaştığında veya 42 gün sonrası enjeksiyon ulaştığında, CO2 ötenazi veya yerel kurumsal hayvan bakımı ve kullanım Komitesi tarafından onaylanmış diğer yöntem aracılığıyla ötenize fare.
    Not: sonuçların doğruluğunu sağlamak Için Puanlama24tedavi gruplarına kör olan bir araştırmacı tarafından gerçekleştirilir. Buna ek olarak, >% 20 ' si vücut kilo kaybı için tavsiye edilen insancıl uç noktadır, ancak bu protokolün ilave gerekçesi ile ıAKLUC onayı alınabilir.

5. ötenize farelerden genomik DNA için doku toplama ve genomik DNA 'Yı izole etme

  1. Steril Cerrahi aletler kullanarak fareler dissect. 3 mm x 0,5 mm büyüklüğünde küçük bir doku parçasını, örneğin, akciğer, karaciğer veya dalak gibi bir ilgi organından keser. Doku örneği tartmak ve steril 1,5 mL tüp doku parçası yerleştirin. Birden fazla doku toplama, her organ kesme arasında etanol ile yıkama araçları.
  2. Sıvı azot içinde doku içeren tüpler alt ederek dondurmak dokulara kadar köpüren durur ve mağaza-80 °C gece. Doku örneklerini çözün ve genomik DNA (gDNA) yalıtım setine göre onları Lyse.
  3. Üretici talimatlarına göre genomik DNA 'Yı kitte açıklandığı şekilde yalıtın. Elüe gdna (mg/μL) mikrolitre başına işlenen doku miktarını Not emin olun.
    Not: Frozen dokular daha sonra işleme için-80 °C ' de depolanabilir.

6. dijital PCR kullanarak insan T hücrelerinin ölçülmesini (Şekil 2)

  1. Dijital PCR reaksiyonlarını, kullanılan dijital PR makinesi için DNA bağlama boyaları protokolüne göre hazırlayın. İnsan CD3 Epsilon genomik DNA için özel aşağıdaki astar kullanın (NCBı referans sırası: NG_ 007383.1); İleri astar: AGGCTGCCTTAACTCCCAAG, ters astar: GCCCTACCAGCTGTGGAAAC. Bu astar 105 BP tek bir bant verecektir.
    Not: genomik DNA 'yı sindirmek için her reaksiyon için Hindııı gibi bir kısıtlama enziminin 0,5 μL değerini ekleyin. Pozitif ve negatif damlacıklar ayrımı optimize etmek için farklı gDNA dilüsyonları test emin olun. Ayrıca, T hücrelerinin infiltrasyon bir alt kümesi patojenik olmayan düzenleyici T hücreleri olabilir. Bu hücreler düzenleyici T hücre işaretçileri için ek astar kullanılarak nicelik olabilir.
  2. Aşağıdaki koşullarda dijital PCR reaksiyonu gerçekleştirin: 105 °C ' de kapak, 95 °C ' de 10 dakika (1 döngü); 95 °C 30 s, rampa 2 °C/s ve 55 °C 1 dakika, rampa 2 °C/s (40 döngüleri); 72 ° 10 dk, 12 °C tutun.
    Not: Bu parametrelerin dijital PCR ekipmanlara bağlı olarak ayarlanması gerekebilir.
  3. Analiz yazılımı ile dijital PCR verilerini edinin. Aşağıdaki denklemin kullanıldığı doku mg başına kopya sayısı olarak rapor verileri: (kopya/μL) x (reaksiyonda gDNA μL) x (seyreltme faktörü)/(Toplam gDNA mg doku/μL)

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Sublethally ışınlanmış 8-12-hafta eski NSG fareleri insan PBMC alınan her iki cinsiyetlerin gün etrafında GVHD klinik belirtileri görüntülemeye başladı 10 sadece PBS alınan negatif kontrol fareler ile karşılaştırıldığında Enjeksiyon sonrası (Şekil 1a). XenoGVHD fareler bir Median hayatta kalma 23,5 gün vardı (Şekil 1B). Dijital PCR ile, CD3 Epsilon pozitif insan T hücreleri insan PBMC alınan fareler akciğer ve karaciğer örnekleri tespit edilebilir. PBS ile enjekte edilen farelerden gelen doku örnekleri kontrol olarak kullanılmıştır (Şekil 2).

Figure 1
Şekil 1: GVHD hastalığı ilerlemesi. Sublethally ışınlanmış 8-12-Week-yaşlı erkek ve kadın NSG fareler Retro-orbitally 1 x 107 insan PBMC (n = 6) veya PBS (n = 4) negatif kontrol olarak enjekte edildi. Gösterilen veriler, üç bağımsız denemelerin birleştirilmiş sonuçlarından oluşur. (A) GVHD skoru her gün, fareler 2 ve sonra her gün kurban gününe kadar bir puan ulaşıncaya kadar ölçülmüştür. GVHD skoru için her zaman noktasında bildirilen veriler, her grupta ölen farelerin son skorları ile birlikte canlı farelerin ortalama ± SEM puanından ibaret. * p < 0,05 Mann Whitney U testi ile belirlenir. (B) Kaplan-Meier hayatta kalma eğrisi. GVHD skoru ≥ 7 olduğunda ölüm işaretli. * p < 0,05 log-Rank testi tarafından belirlenir. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 2
Şekil 2: dijital PCR kullanarak ınsan T hücrelerinin tespiti. PBS (n = 3) veya 1 x 107 insan PBMC (n = 3) ile Retro-orbitally enjekte edilen farelerden akciğer ve karaciğer numuneleri toplandı, fareler bir GVHD puanına ulaştığında ≥ 7 veya 42 gün Enjeksiyon sonrası. Veriler 3 bağımsız deneyden toplandı. gDNA izole edildi ve dijital PCR doku miligram başına insan CD3 Epsilon kopyalarını belirlemek için kullanıldı. (A) PBS veya PBMC ile enjekte edilen bir fareden akciğer ve karaciğer numunelerinin temsili dijital PCR arsa. (B) PBS veya PBMC ile enjekte edilen farelerden doku millgram BAŞıNA insan CD3 Epsilon kopyalarının ölçülür. * p ≤ 0,05, Mann Whitney U testi ile belirlenir. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hastalık ilerlemesi genellikle xenoGVHD modelinde tutarlı, hatta farklı bağış PBMC enjeksiyon ile, bu yüzden birden fazla deney kombine edilebilir. Bu tutarlılığı korumak için gereken önemli adımlar doğru serum enjeksiyon tekniği, kör edici ve tutarlı skorlama. Nervi ve ark.25 tarafından yapılan bir çalışmada, intravenöz kuyruk ven enjeksiyonu ile karşılaştırıldığında, PBMC Retro orbital enjeksiyonları daha tutarlı Engraftman ve daha şiddetli GVHD sonuçlandı göstermiştir. Leon-Rico ve al.26 Ayrıca, Retro-orbital enjeksiyonları kuyruk ven enjeksiyonu ile karşılaştırıldığında fareler daha tutarlı hematopoetik kök hücre Engraftman sonuçlandı göstermiştir. Ancak, gerekirse, kuyruk ven enjeksiyonları xenogvhd modelinde alternatif bir yöntem olarak kullanılabilir27,28,29.

Kuyruk ven enjeksiyonları ile ilişkili sonuçların değişkenlik sorunu konu sayısını artırarak azaltılabilir. Ayrıca, fareler Puanlama kişinin hareket veya kürk dokusu gibi daha öznel kriterlerin skorlama önyargı önlemek için fare tedavisi için kör olduğu önemlidir. Kör edilmiş GVHD skorlama önemi de klinikte gösterildi24. Fareler enjekte kişi fareler Puanlama aynı kişi olmamalıdır. Bu mümkün değilse, kontrol ve tedavi tüpleri randomize edilebilir ve başka bir kişi tarafından yeni KIMLIK ile etiketlenmiş (yani, kontrol A, tedavi B) bu yüzden enjeksiyonları kör olabilir. Fare skorlama her gün aynı zamanda ve farklı deneyler arasında aynı gün sonrası enjeksiyon yapılmalıdır.

Bu modelde bir potansiyel engel GVHD gelişimi eksikliği. Bu tripan mavi hücreler sayarak PBMC canlılığı kontrol ederek ele alınabilir PBMC azaltılmış canlılığı nedeniyle olabilir. Hücre canlılığı ile sorun karşılaşıldığında, hücreler hayatta kalmak için% 2 FBS ile tamamlayıcı PBS koymak olabilir. Ayrıca, daha az fareler zaman hücreleri oda sıcaklığında oturmak azaltmak için bir kerede enjekte edilebilir. Retro-orbital enjeksiyonu etkinliği sorun olabilir. PBMC ile enjekte edilir ama GVHD geliştirmez fareler ötenize olabilir ve onların dalağı izole bağışıklık hücreleri dpcr veya akış sitometri aracılığıyla insan hücrelerinin varlığı için analiz edilebilir. Eğer zayıf engraftment varsa, o zaman muhtemelen enjeksiyon tekniği ile ilgili bir sorun vardır. Enjeksiyon tekniğinin bir testi olarak, fareler Evans mavi boya 200 μL ile Retro-orbitally enjekte edilebilir. Enjeksiyon başarılı olursa, fare kulakları, pençeleri ve kuyruk mavi dönecek.

XenoGVHD modeli, insan akut GVHD hastalığı patogenezi ve progresyonu30' a yakından taklit eder. Murine MHC uyuşmazlığı GVHD modelinin aksine, xenoGVHD modeli, insan hücresi tedavileri de dahil olmak üzere immünonpresif tedavilerin, duvar hücrelerinin yerine insan hücrelerinde etkisini test etmenizi sağlar. Bu klinik araştırma sonuçları uygularken türlerin farklılıkları nedeniyle varyasyonu azaltır. XenoGVHD modeli de T hücre araştırma diğer alanlarda bir in vivo bastırma tahlil olarak hizmet verebilir. Böylece, xenoGVHD modelini kullanan deneylerden gelen sonuçlar, GVHD 'ye ek olarak herhangi bir insan T hücresi aracılı inflamatuar hastalığa uygulanabilir.

XenoGVHD modelinin sınırlamaları vardır. Bunlar, klinik ile karşılaştırıldığında deneysel değişkenlik ve GVHD tedavisinde olası farklar içerir. Deneysel tutarsızlık fare gerilme farklılıkları, PBMC enjeksiyon siteleri, radyasyon dozu ve mikrobiyal çevre olabilir30,31. Böylece, bu modeli kullanan laboratuvarlar tutarlı sonuçlar sağlamak için bu parametreleri standartlaştırmak etmeye çalışmalıdır. Bu protokolde, Puanlama içindeki değişkenliği azaltmaya yardımcı olan Puanlama yöntemlerini açıklayacağız. XenoGVHD verilerinin klinik sonuçlara karşılaştırılmasını kısıtlayan faktörler arasında, GVHD profilaktik ilaçlar ile tedavi edilen kontrol gruplarının eksikliği ve xenoGVHD modelinde31' de tek klima kaynağı olarak ışınlama kullanımı yer alabilir. Ayrıca, xenogvhd mekanizması tamamen insan GVHD temel patogenezi özetlemek değil. Örneğin, xenoGVHD modelinde insan T hücrelerini etkinleştiren ev sahibi APCs yerine donör APU 'ları, ana bilgisayar APU 'ları ise insan GVHD7' de önemli bir rol oynamaktadır. Böylece, çoğu klinik öncesi modellerde olduğu gibi, xenogvhd ve insan GVHD 'si arasında xenoGVHD 'den kliniğe oluşturulan verilerin uygulanması sınırlayabilen tutarsızlık ve uyumsuzluklar vardır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Herhangi bir ilgi çakışması ilan edildi.

Acknowledgments

Biz bu deneyler ve sağlanan teknik destek için kullanılan dijital PCR makine sağlamak için Lane Christenson Laboratuvarı kabul etmek istiyoruz. Ayrıca Dr. Thomas Yankee 'e rehberlik ve mentorluk için teşekkür etmek istiyoruz. Bu çalışmalar Tripp Aile Vakfı tarafından destekleniyor.

Materials

Name Company Catalog Number Comments
1.5 mL eppendorf tubes Fisher 05-408-129
10 mL serological pipet VWR International 89130-898
10mL BD Vacutainers - Green capped with Sodium Heparin Becton Dickinson 366480
250 µL Ranin pipette tips Rainin 17001118 Do not use other pipettes or pipet tips for droplet generation
50 mL conical tube VWR International 89039-656
96-Well ddPCR plate Bio-Rad 12001925
ACK (Ammonium-Chloride-Potassium) Lysing Buffer Lonza 10-548E Optional
Alcohol Wipes Fisher Scientific 6818
Anesthesia Chamber World Precision Instruments EZ-178 Provided by animal facility
Anesthesia Machine Parkland Scientific PM1002 Provided by animal facility
BD Vacutainer Safety-Lok Blood Collection Set Becton Dickinson 367281
DG8 Cartridges and Gaskets for QX100/QX200 Droplet Generator Bio-Rad 1864007
DNAse and RNAse free Molecular Grade H2O Life Technologies 1811318
Ethyl alcohol, Pure,200 proof, for molecular biology Sigma-Aldrich E7023-500ML
Fetal Bovine Serum Atlanta Biologicals S11150
Ficoll Fisher Scientific 45001750
Insulin Syringe Fisher Scientific 329424
Isoflurane Sigma-Aldrich CDS019936 Provided by animal facility
Liquid nitrogen N/A N/A
Mouse Irradiator Pie Cage Braintree Scientific, Inc. MPC 1 Holds up to 11 mice
Nexcare Gentle Paper Tape (a.k.a. 3M Micropore Surgical Tape / 3/4") Fisher Scientific 19-027-761
P1000 pipetman MidSci A-1000
P200 pipetman MidSci A-200
Pierceable Foil Heat Seal Bio-Rad 1814040
Pipetaid Gilson Macroman Fisher Scientific F110756
Pipet-Lite Multi Pipette L8-200XLS+ Rainin 17013805 Do not use other pipettes or pipet tips for droplet generation
Qiagen DNeasy Blood and Tissue Kit Qiagen 69506
qPCR plates VWR International 89218-292
QX200 Droplet Digital PCR System Bio-Rad 12001925 Includes droplet generator, droplet reader, laptop computer, software, associated component consumables, for EvaGreen or probe-based digital PCR applications
QX200 Droplet Generation Oil for EvaGreen Bio-Rad 1864006
QX200 ddPCR EvaGreen Supermix Bio-Rad 1864033
RNase and DNase-free plate seal Thermo Scientific 12565491
RPMI Advanced 1640 Life Technologies 12633012
Sterile Gauze Pads (2" x 2", 12-Ply) Fisher Scientific 67522
Sterile Phosphate Buffered Saline Fisher Scientific 21040CV
Sterile reservoir VWR International 89094-662
Surgial Scissors Kent Scientific INS600393-4
Surgical Forceps Kent Scientific INS650914-4

DOWNLOAD MATERIALS LIST

References

  1. Jagasia, M., et al. Risk factors for acute GVHD and survival after hematopoietic cell transplantation. Blood. 119, (1), 296-307 (2012).
  2. Bolanos-Meade, J., et al. Phase 3 clinical trial of steroids/mycophenolate mofetil vs steroids/placebo as therapy for acute GVHD: BMT CTN 0802. Blood. 124, (22), quiz 3335 3221-3227 (2014).
  3. Gooley, T. A., et al. Reduced mortality after allogeneic hematopoietic-cell transplantation. New England Journal of Medicine. 363, (22), 2091-2101 (2010).
  4. Hahn, T., et al. Significant improvement in survival after allogeneic hematopoietic cell transplantation during a period of significantly increased use, older recipient age, and use of unrelated donors. Journal of Clinical Oncology. 31, (19), 2437-2449 (2013).
  5. Khoury, H. J., et al. Improved survival after acute graft-versus-host disease diagnosis in the modern era. Haematologica. 102, (5), 958-966 (2017).
  6. King, M. A., et al. Human peripheral blood leucocyte non-obese diabetic-severe combined immunodeficiency interleukin-2 receptor gamma chain gene mouse model of xenogeneic graft-versus-host-like disease and the role of host major histocompatibility complex. Clinical & Experimental Immunology. 157, (1), 104-118 (2009).
  7. Lucas, P. J., Shearer, G. M., Neudorf, S., Gress, R. E. The human antimurine xenogeneic cytotoxic response. I. Dependence on responder antigen-presenting cells. Journal of Immunology. 144, (12), 4548-4554 (1990).
  8. Ito, R., et al. Highly sensitive model for xenogenic GVHD using severe immunodeficient NOG mice. Transplantation. 87, (11), 1654-1658 (2009).
  9. Kawasaki, Y., et al. Comprehensive Analysis of the Activation and Proliferation Kinetics and Effector Functions of Human Lymphocytes, and Antigen Presentation Capacity of Antigen-Presenting Cells in Xenogeneic Graft-Versus-Host Disease. Biology of Blood and Marrow Transplantation. 24, (8), 1563-1574 (2018).
  10. Ito, R., et al. A Novel Xenogeneic Graft-Versus-Host Disease Model for Investigating the Pathological Role of Human CD4(+) or CD8. T Cells Using Immunodeficient NOG Mice. American Journal of Transplantation. 17, (5), 1216-1228 (2017).
  11. Trotta, E., et al. A human anti-IL-2 antibody that potentiates regulatory T cells by a structure-based mechanism. Nature Medicine. 24, (7), 1005-1014 (2018).
  12. Dijke, I. E., et al. Discarded Human Thymus Is a Novel Source of Stable and Long-Lived Therapeutic Regulatory T Cells. American Journal of Transplantation. 16, (1), 58-71 (2016).
  13. Huang, F., et al. Human Gingiva-Derived Mesenchymal Stem Cells Inhibit Xeno-Graft-versus-Host Disease via CD39-CD73-Adenosine and IDO Signals. Frontiers in Immunology. 8, 68 (2017).
  14. Stockis, J., et al. Blocking immunosuppression by human Tregs in vivo with antibodies targeting integrin alphaVbeta8. Proceedings of the National Academy of Sciences of the United States of America. 114, (47), E10161-E10168 (2017).
  15. Vogelstein, B., Kinzler, K. W. Digital PCR. Proceedings of the National Academy of Sciences of the United States of America. 96, (16), 9236-9241 (1999).
  16. Quan, P. L., Sauzade, M., Brouzes, E. dPCR: A Technology Review. Sensors (Basel). 18, (4), (2018).
  17. Sykes, P. J., et al. Quantitation of targets for PCR by use of limiting dilution. Biotechniques. 13, (3), 444-449 (1992).
  18. Ma, H., et al. Evaluation of Bacterial Contamination in Goat Milk Powder Using PacBio Single Molecule Real-Time Sequencing and Droplet Digital PCR. Journal of Food Protection. 1791-1799 (2018).
  19. Vitale, S. R., et al. An optimized workflow to evaluate estrogen receptor gene mutations in small amounts of cell-free DNA. Journal of Molecular Diagnostics. (2018).
  20. Gorgannezhad, L., Umer, M., Islam, M. N., Nguyen, N. T., Shiddiky, M. J. A. Circulating tumor DNA and liquid biopsy: opportunities, challenges, and recent advances in detection technologies. Lab Chip. 18, (8), 1174-1196 (2018).
  21. Yardeni, T., Eckhaus, M., Morris, H. D., Huizing, M., Hoogstraten-Miller, S. Retro-orbital injections in mice. LabAnimal. 40, (5), 155-160 (2011).
  22. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual restraint and common compound administration routes in mice and rats. Journal of Visualized Experiments. (67), (2012).
  23. Cooke, K. R., et al. An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin. Blood. 88, (8), 3230-3239 (1996).
  24. Weisdorf, D. J., et al. Prospective grading of graft-versus-host disease after unrelated donor marrow transplantation: a grading algorithm versus blinded expert panel review. Biology of Blood and Marrow Transplantation. 9, (8), 512-518 (2003).
  25. Nervi, B., et al. Factors affecting human T cell engraftment, trafficking, and associated xenogeneic graft-vs-host disease in NOD/SCID beta2mnull mice. Experimental Hematology. 35, (12), 1823-1838 (2007).
  26. Leon-Rico, D., et al. Comparison of haematopoietic stem cell engraftment through the retro-orbital venous sinus and the lateral vein: alternative routes for bone marrow transplantation in mice. LabAnimal. 49, (2), 132-141 (2015).
  27. Ali, N., et al. Xenogeneic graft-versus-host-disease in NOD-scid IL-2Rgammanull mice display a T-effector memory phenotype. PLoS One. 7, (8), e44219 (2012).
  28. van Rijn, R. S., et al. A new xenograft model for graft-versus-host disease by intravenous transfer of human peripheral blood mononuclear cells in RAG2-/- gammac-/- double-mutant mice. Blood. 102, (7), 2522-2531 (2003).
  29. Wunderlich, M., et al. OKT3 prevents xenogeneic GVHD and allows reliable xenograft initiation from unfractionated human hematopoietic tissues. Blood. 123, (24), e134-e144 (2014).
  30. Schroeder, M. A., DiPersio, J. F. Mouse models of graft-versus-host disease: advances and limitations. Disease Models & Mechanisms. 4, (3), 318-333 (2011).
  31. Zeiser, R., Blazar, B. R. Preclinical models of acute and chronic graft-versus-host disease: how predictive are they for a successful clinical translation? Blood. 127, (25), 3117-3126 (2016).
Bir Xenogeneic Murine modelinde Graft-versus-Host hastalığının indüksiyon ve skorlama ve dijital PCR kullanarak fare dokularında ınsan T hücrelerinin ölçümü
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).More

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter