Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Células-tronco derivadas virais AG-specific T da haste suprimir a replicação de HBV em ratos

doi: 10.3791/60043 Published: September 25, 2019

Summary

Aqui apresentamos um protocolo para a supressão efetiva da replicação do vírus da hepatite B (HBV) em camundongos utilizando a transferência de células adotivas (ACT) de linfócitos T específicos de antígenos virais derivados de células-tronco (AG). Este procedimento pode ser adaptado para a imunoterapia baseada em ACT potencial da infecção por HBV.

Abstract

A infecção pelo vírus da hepatite B (HBV) é uma questão de saúde global. Com mais de 350 milhões pessoas afetadas em todo o mundo, a infecção pelo HBV continua sendo a principal causa de câncer hepático. Esta é uma grande preocupação, especialmente nos países em desenvolvimento. A falha do sistema imunitário para montar uma resposta eficaz de encontro ao HBV conduz à infecção crônica. Embora a vacina HBV está presente e novos medicamentos antivirais estão sendo criados, a erradicação das células de vírus-reservatório continua a ser um grande tema de saúde. Descrito aqui é um método para a geração de antígeno viral (AG)-linfócitos T citotóxicos CD8+ específicos (CTLs) derivados de células-tronco pluripotentes induzidas (iPSCs) (ou seja, IPSC-CTLs), que têm a capacidade de suprimir a replicação do HBV. A replicação de HBV é induzida eficientemente nos ratos através da injeção hidrodinâmico de um Plasmid da expressão de HBV, de paav/HBV 1.2, no fígado. Então, a superfície de HBV AG-específico iPSC-CTLs do rato é transferida adoptivamente, que suprime extremamente a replicação de HBV no fígado e no sangue assim como impede a expressão da superfície AG de HBV nos hepatocytes. Este método demonstra a replicação de HBV nos ratos após a injeção hidrodinâmico e que os CTLs AG-específicos virais derivado da pilha de haste podem suprimir a replicação de HBV. Este protocolo fornece um método útil para a imunoterapia de HBV.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Após a infecção aguda, o sistema imunológico adaptativo (i.e., imunidade humoral e celular) controla a maior parte da hepatite aguda relacionada ao HBV. Ainda, um número de povos nas regiões HBV-endêmicas não pode eliminar os vírus e subseqüentemente converter como indivíduos crônicos. Mais de 25% dos pacientes crônicos (> 250 milhões de pessoas) em todo o mundo desenvolvem doença hepática progressiva, resultando em cirrose hepática e/ou carcinoma hepatocelular (HCC)1. Como resultado, a erradicação de células insistentemente infectadas permanece um problema geral de salubridade, embora haja uma vacina disponível2 e inúmeros medicamentos antivirais estão em desenvolvimento. O tratamento padrão para a infecção pelo HBV inclui análogos de IFN-α, nucleósidos e nucleotídeo. Estes agentes têm a atividade antiviral direta e capacidades modulatórias imunes. No entanto, a soroconversão do antígeno de HBe (AG)+ portadores com anticorpo anti-HBe (AB) e a perda de ácido deoxirribonucleico do HBV SÉRICO (DNA) aparecem individualmente em aproximadamente 20% dos pacientes tratados, e o controle imunológico total do vírus verificada pela privação do HBsAg não é superior a 5%3. Além disso, a resposta ao tratamento muitas vezes não é durável. A vacinação profiláctica com HBs recombinante AG é altamente eficaz em impedir a infecção, mas a vacinação terapêutica de HBs Ag não é eficaz. Claramente, as respostas imunes mediadas por células T desempenham um papel crítico no controle da infecção pelo HBV e comprometimento hepático; no entanto, em pacientes com hepatite crônica, as células T HBV-reativas são freqüentemente excluídas, disfuncionais ou convertem exaustos4,5,6. Consequentemente, em indivíduos com infecção persistente por HBV, nenhuma tentativa de restabelecer a imunidade específica do HBV (i.e., imunidade à base de células T) por meio de remédio antiviral, citocinas imuno-modulatórias ou imunização curativa alcançaram sucesso.

A transferência celular adotiva (Act) de células T específicas do HBV AG é um tratamento eficiente direcionado para eventualmente erradicar os hepatócitos remanescentes wih HBV7,8. O ato de CTLs HBV-específicos em ratos HBV-contaminados foi mostrado para causar a hepatite transiente, suave, e uma gota dramática em transcritos do ácido ribonucleico de HBV (RNA) nos hepatocytes. Nesses estudos, a CTLs não inibiu a transcrição dos genes do HBV, mas melhorou a degradação das transcrições do HBV9. As CTLs específicas do HBV são importantes para prevenir a infecção viral e mediar a depuração do HBV10,11. Para remédios baseados em ato, a expansão in vitro de células T específicas do HBV com alta reatividade para a reinstalação in vivo tem sido sugerida como um método ideal12,13,14; no entanto, as abordagens atuais são restritas em relação às suas habilidades para gerar, separar e cultivar quantidades e qualidades apropriadas de células T específicas do HBV de pacientes para as terapias potenciais.

Embora os ensaios clínicos apresentem segurança, praticidade e atividade terapêutica prospectiva de tratamentos à base de células por meio de células T projetadas que são específicas para hepatócitos infectados pelo vírus HBV, há preocupações sobre os efeitos desfavoráveis ocorrendo das respostas auto-imunes por causa do cross-Reactivity doreceptor de célulaT de misemparelhamento (TCR)15,16, reconhecimentodo AG do fora-alvo pelo TCR17 não específico e em-alvo fora-toxicidade por um receptor quimérico de AG (carro) 18 anos de , 19 com tecidos saudáveis. Atualmente, as células T geneticamente modificadas, que só têm persistência a curto prazo in vivo, são geralmente células T intermediárias ou posteriores. Até o momento, as células-tronco pluripotentes (PSCs) são a única fonte disponível para gerar alto número de células T ingênuas de tipo único AG-específico20,21,22,23. Os PSCs induzidos (iPSCs) são convertidos simplesmente das pilhas somáticas de um paciente com o uso da transdução do gene de diversos fatores da transcrição. Como resultado, os iPSCs apresentam características semelhantes às das células-tronco embrionárias (ESCs)24. Devido à flexibilidade e possibilidade para a capacidade infinita de autorenovar, além da reposição tecidual, tratamentos baseados em iPSC podem ser amplamente aplicados na medicina regenerativa. Além disso, os regimentos subjacentes iPSCs podem substancialmente melhorar terapias Cell-Based atuais.

O objetivo geral deste método é gerar uma grande quantidade de CTLs específicos do HBV de iPSCs (ou seja, iPSC-CTLs) para imunoterapia baseada em ACT. As vantagens sobre técnicas alternativas são que iPSC-CTLs específico do HBV têm um único-tipo TCR e phenotype ingênuo, que conduz a mais desenvolvimento da pilha de T da memória após o ato. É demonstrado que o ACT de iPSC-CTLs específicos do HBV aumenta a migração de células T CD8+ funcionais no fígado e reduz a replicação do HBV em ambos os fígados e sangue de camundongos administrados. Este método revela um uso potencial de iPSC-CTLs AG-específicos virais para a imunoterapia de HBV e pode ser adaptado para gerar outras pilhas AG-específicas virais de iPSC-T para a imunoterapia viral.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Todos os experimentos com animais são aprovados pelo Comitê de cuidados com animais da Universidade do Texas a & M (IACUC; #2018-0006) e são conduzidos em conformidade com as diretrizes da Associação para a avaliação e acreditação de cuidados com animais de laboratório. Os camundongos são usados durante 6 – 9 semanas de idade.

1. geração de células de t CD8+ específicas virais AG de iPSCs (células t IPSC-CD8+ )

  1. Criação dos construtos retrovirais
    Nota: os genes TCR α e β estão ligados à sequência de autoclivagem 2A. O vetor retroviral mscv-ires-dsred (MIDR) é dsred+ 23.
    1. Subclone HBs183-191 (flltrilti)-específico a2-restrito humano-murine híbrido TCR (s183 TCR) genes (vα 34 e Vβ28) no MIDR para criar a construção de MIDR S183 (Figura 1a)25.
  2. Transdução anti-retroviral
    Nota: as células Platinum-E (Plat-E) são utilizadas para a embalagem de retrovírus (portadores de genes TCR s183), que serão utilizados para a transdução anti-retroviral. As pilhas de plat-E são as pilhas de empacotamento eficazes do retrovírus que são subjacentes às pilhas 293T, que foram desenvolvidas por meio das construções de empacotamento originais através do promotor EF1α para expressar a proteína retroviral da estrutura, incluindo a mordaça, o pol, e o env ecotropic.
    1. Em um prato da cultura de 100 milímetros, sementes 3 x 106 Plat-E pilhas em 8 ml do meio de cultura de DMEM que contem o soro fetal da vitela de 10% (FCS) em uma incubadora em 37 ° c com 5% co2, 1 dia antes do transfection.
    2. No dia 0, transfecção a construção de s183 MIDR nas pilhas de plat-E usando um reagente25do transfection do ADN.
    3. No dia 1, semente 1 x 106 iPSCs (GFP+) em uma placa de cultura pré-revestida de gelatina.
    4. Nos dias 2 – 3, colete o sobrenadante contendo retrovírus da cultura de células Plat-E para transduce iPSCs com o s183 TCR na presença de solução de 1,6-dibromohexano25.
    5. No dia 4, Trypsinize o s183 TCR gene-transfoiado iPSCs, centrifugador em 400 x g para 5 minutos e semente 3 × 105 iPSCs em um prato da cultura de 100 milímetros pré-revestido com 3 x 106 pilhas de alimentador SNL76/7 (irSNL76/7) irradiados25.
    6. No dia 5 ou 6 de confluência, Trypsinize as células, centrífuga em 400 x g por 5 min e processo de triagem celular. Gating em pilhas vivos, classifica GFP e DsRED pilhas dobro-positivas (os iPSCs gene-transduados de s183 TCR) usando um classificador de alta velocidade da pilha. Similar à etapa 1.2.5, coculture as pilhas classificadas em irSNL76/7 pilhas do alimentador para o uso futuro25.
  3. Diferenciação de células T iPSC-CD8+ específicas do HBV
    Nota: as pilhas stromal OP9-DL1/DL4 sobre-expressão ambos os ligantes do entalhe DL1 e DL4, e cocultivando iPSCs com os iPSCs podem promover a diferenciação sinalização-negociada entalhe da pilha de T26.
    1. Cultivar s183 TCR (s183/iPSCs) em monocamada de células OP9-DL1-DL4 em meio médio essencial (MEM) contendo 20% de soro bovino fetal (FBS)27. Inclua murino Flt3 ligante (mflt-3L; concentração final = 5 ng/ml) na cultura.
    2. No dia 0, semente 0,5 – 1,0 x 105 S183/iPSCs em um prato de cultura de 10 cm previamente cultivado com células OP9-DL1-DL4. Valide que as células OP9-DL1-DL4 estão em uma condição de confluência de 80% – 90%.
    3. No dia 5, enxágüe os iPSCs com 10 mL de solução salina tamponada com fosfato (PBS), Aspire o PBS, acrescente-o a 4 mL de 0,25% de tripsina e incubar em uma incubadora de 37 ° c por 10 min. depois, adicione um adicional de 8 mL de mídia iPSC para acabar com a digestão de tripsina. Acumule todas as soluções digestivas contendo as células e Centrifugue a 400 x g por 5 min a 15 – 30 ° c.
    4. Aspirar o sobrenadante e suspender as células em 10 mL de meios de comunicação iPSC. Transfira a suspensão celular para uma nova placa de Petri de 10 cm e incubar em uma incubadora por 30 min a 37 ° c.
    5. Após 30 min, colete a mídia iPSC contendo as células flutuantes. Passe a suspensão da célula através de um filtro de células de 70 μm e calcule o número da célula.
    6. Sementes 5 x 105 células no prato de cultura previamente cultivadas OP9-DL1-DL4 células com uma condição de 80% – 90% confluente como descrito na etapa 1.3.1.
      Nota: para diferenciação de células T, cada 2 – 3 dias, as células derivadas de iPSC precisam re-SEED com uma camada fresca das células OP9-DL1-DL4.
  4. Avaliação
    1. Alterações morfológicas de diferenciando iPSCs
      1. Observe as células um microscópio em vários dias.
        Nota: no dia 5, as colônias têm características mesoderma-like, exibindo uma morfologia clássica da eixo-forma que assemelha-se aos fibroblasto dérmicos humanos e ao crescimento sustentado in vitro. No dia 8, pequenos aglomerados redondos de células começam a aparecer.
    2. Análise de diferenciando iPSCs por citometria de fluxo
      1. Em vários dias de cocultura, analisar células derivadas de iPSC como descrito anteriormente25 (Figura 1B, C).
    3. Análise funcional de diferenciando iPSCs
      1. No dia 28 da cocultura, colete células T iPSC-CD8+ de culturas através da colheita das células flutuantes, Trypsinize as células remanescentes com 0,25% tripsina, re-suspender em 8 ml de mídia IPSC, centrifugar por 5 min em 400 x g em 15-30 ° c, retire a mídia, em seguida, ressuscite as células em 10 mL de mídia.
      2. Mantenha as pilhas re-suspendidas em um prato fresco de 10 cm em uma incubadora de 37 ° c por 30 minutos e monte as pilhas de flutuação. Em seguida, lave as células um vezes com um PBS frio.
      3. Incubar 3 x 106 T células-empobrecido esplenócitos (CD4-CD8-) de baços de H-2 classe I knockout, HLA-a 2.1-transgenic (HHD) camundongos com 5 μm s183 peptídeo (flltrilti) em 200 μL de mídia a 4 ° c por 30 min.
      4. Produza uma mistura de células t de IPSC-CD8+ com esplócito pulsado com peptídeo s183 (células t: esplenócitos = 1:4; Use 0,75 x 106 células t). Incubar a mistura de células a 37 ° c em uma incubadora de CO2 para 40 h. Durante os últimos 7 h, adicione 4 μL de brefeldin A diluído na cultura (concentração final de 1.000 x, que será diluída em meios de cultura 1x) para bloquear os processos de transporte durante a ativação celular.
      5. Manchar as células e realizar a análise citométrica do fluxo de IFN-γ intracelular como descrito anteriormente (Figura 2).

2. indução da replicação do HBV através da entrega hidrodinâmica de plasmídeo VHB

Nota: a construção de pAAV/HBV 1.2 foi gerada como descrita previamente9. O DNA completo do HBV 1,2 é incorporado no vetor pAAV.

  1. Entregas hidrodinâmicas de plasmídeo VHB através da veia cauda
    1. Aqueça camundongos HHD usando uma lâmpada de calor por 5 min na gaiola, a fim de dilatar a veia cauda.
    2. Deter o animal por meio de um refreador, e as caudas limpas do rato com 70% de spray de etanol.
    3. Entrega de plasmídeo no fígado.
    4. Meça o peso corporal do mouse usando uma escala de medição.
    5. Diluir 10 μg de plasmídeo VHB no equivalente a 8% de PBS em massa corporal (por exemplo, 1,6 mL para um rato de 20 g). Carregue o plasmídeo diluído numa seringa de 3 mL com uma agulha hipodérmica de 26 G × 12"(0,45 × 12 mm).
    6. Localize uma das duas veias da cauda lateral no terço médio da cauda e posicione a agulha em qualquer veia lateral. Administrar a injeção contendo plasmídeo VHB através da veia cauda dentro de 3-5 s.
  2. Quantificação da viremia do soro sanguíneo de camundongos infectados
    Nota: a replicação do HBV ocorre a partir do dia 3 – 35 no soro do rato. Os picos de replicação de DNA no dia 7 e reduz gradualmente. O DNA do HBV não é liberado do soro até o dia 35.
    1. Coleção do soro de sangue dos ratos contaminados
      1. Colete aproximadamente 0,1 mL de sangue em um tubo de microcentrífuga de cada mouse em 3, 5, 7 e 10 dias após a infecção por sangramento retroorbital em um tubo de microcentrífuga de 1,5 mL, em seguida, incubar à temperatura ambiente (RT) por 20 min.
      2. Centrifugue a amostra a 6.000 x g durante 15 min a 4 ° c e colete o sobrenadante sérico após a centrifugação.
    2. Purify o ADN do soro de sangue usando um jogo comercialmente disponível da extração do ADN que segue as recomendações do fabricante. Resumidamente, lyse as células em uma coluna à base de sílica, executar as lavas, e extrair o DNA, acrescentando 100% etanol para a coluna de eluição e centrifugação em 6000 x g por 1 min. elute o dna em 50 μL de água RNase-livre.
    3. Use 100 ng de DNA de HBV da eluição para a análise do PCR do tempo real. Use os seguintes primers e sondas: forward 5 ' TAGGAGGCTGTAGGCATAAATTGG 3 '; Reverse 5 ' GCACAGCTTGGAGGCTTGT 3 '; sonda 5 ' TCACCTCTGCCTAATC 3 '.
      1. Use o genoma do HBV contendo plasmídeo (pAAV/HBV 1.2) para a curva padrão e realize PCR em tempo real em um volume total de 10 μL (Figura 3).
    4. Configure a reação de PCR em um volume total de 10 μL, conforme mostrado na tabela 1.
    5. Configurar o programa do PCR no termociclador como mostrado na tabela 2. A taxa de transição programada da temperatura é 20 ° c/s para a desnaturação/recozimento e 5 ° c/s para a extensão. Meça a fluorescência na extremidade da fase de recozimento para cada ciclo para a monitoração do PCR do tempo real.

3. redução da replicação do HBV por ACT de células T de iPSC-CD8+ específicas virais AG

  1. Transferência de células adoptivas (ACT)
    1. Diferenciar s183/iPSCs (1.3.7) sobre as células OP9-DL1-DL4 estromal na presença de mFlt-3L e mIL-7 por 8 dias, conforme descrito na seção 1,3.
    2. No dia 22, colete células T iPSC-CD8+ da placa de 10 cm com tripsina, em seguida, lave e ressuscite cada placa de 10 cm em 10 ml de mídia fresca. Adicione as pilhas a uma placa fresca de 10 cm e retorne à incubadora por 30 minutos como feito na seção 1,3. Após 30 min, colete células flutuantes.
    3. Use um filtro de nylon de 70 μm para passar as células para eliminar clusters de células e contar o número da célula. Adapte as células a uma concentração de 1,5 x 107 células/ml em solução de PBS a frio e use um filtro de nylon de 70 μm para passar as células para eliminar clusters de células novamente, se necessário. Mantenha as células no gelo até o ACT.
    4. Injete 200 μL de suspensão celular (3 x 106 células) em camundongos HHD de 4 – 6 semanas de idade através da veia cauda.
  2. Indução da replicação do HBV
    1. No dia 14 após a transferência celular, realize a entrega hidrodinâmica do plasmídeo VHB através da veia cauda, conforme descrito na seção 2,1.
  3. Detecção de proteínas de vírus do fígado infectado
    1. Sacrifique camundongos nos dias 3, 5, 7, 14 e 21 pós-infecção. Para a eutanásia, em cada gaiola, use 1 – 2 L de dióxido de carbono (CO2) na primeira etapa. Quando o animal desenvolve a perda de consciência, ganhe a taxa de fluxo de CO2 em torno de 4 – 5 L/min. Realize a eutanásia do rato usando a inalação do co2 .
    2. Separe o fígado cortando a pele da superfície do peritônio que utiliza tesouras e fórceps e arrastando ligeiramente o fígado para trás para descobrir a pele interna que alinha a cavidade peritoneal. Colete e corte amostras de fígado (comprimento x largura x altura = 0,5 cm x 0,5 cm X 0,3 cm) dos camundongos infectados para caber facilmente na gaveta de incorporação e bloco em formalina tampão neutro de 10% para 4 – 24 h.
    3. Descalcificar o fígado samplesusing 2,5 M ácido fórmico; Enxaguar em xileno por 3 min, enxaguar 2x em 100% etanol, enxaguar 2x em 95% etanol, enxaguar 2x em água deionizada (DI) por 2 min, em seguida, descalcificar as amostras de fígado em 1 mM de ácido etilenodiaminotetracético (EDTA) correspondentemente. Manusear a uma temperatura de sub-ebulição (90 ° c) durante 20 min.
    4. Resfrie os tecidos fixos do fígado por 30 min. Enxague os tecidos com 1X PBS por 4 min e incorpore os tecidos em parafina. Desidratar os tecidos em uma série de concentrações crescentes de etanol para substituir a água, e depois mergulhar na imersão de xileno. Incorporar os tecidos infiltrados em blocos de cera. Faça o corte uniformemente vertical e horizontal para manchar. Prepare secções de 4 μm com um micrótomo deslizante.
    5. Passar as seções através da desparaffinização e reidratação usando xileno e etanol, em seguida, executar a coloração imunofluorescente das seções.
    6. Manchar as secções com 200 μL de anticorpos específicos para a superfície do HBV (1:100 diluição na solução de bloqueio). Incubar as seções com o anticorpo para 2 h em RT em uma câmara umidificada de 75% – 100%, e lave 5x em 1X PBS por 5 min.
    7. Use um reagente anti-fade contendo 4 ', 6-diamidino-2-phenylindole (DAPI) para coloração nuclear para neutralizar as lâminas. Adicione a lamínula com cerca de 300 μL da solução de coloração DAPI diluída (300 nM em 1X PBS) e valide toda a cobertura coberta. Mantenha os slides no escuro a 4 ° c até a inspeção um microscópio fluorescente.
  4. Infiltração de células inflamatórias em camundongos infectados
    1. Sacrifique camundongos como descrito na etapa 3.3.1. Colete o fígado e faça seções conforme descrito na etapa 3.3.4.
    2. Manchar a seção com hematoxilina e eosina (H & E) para avaliar a infiltração de células inflamatórias no fígado.
    3. Armazene corrediças no escuro em 4 ° c até uma análise mais adicional um microscópio fluorescente.
    4. Visualize slides um microscópio de fluorescência para detectar a infiltração de células inflamatórias no fígado (Figura 4).
  5. Deteção do ADN de HBV do fígado contaminado
    1. Isolamento do DNA viral.
    2. Eutanizar camundongos e recolher as amostras de fígado de acordo com a seção 3,3.
    3. Lyse os tecidos hepáticos no tampão de Lise Nonindet P-40 (NP-40) (50 mM TRIS-HCL, 1 mM EDTA, 1% NP-40) contendo um cocktail inibidor da protease.
    4. Centrifugue momentaneamente em 16.000 x g para remover os núcleos e os restos da pilha.
    5. Incubar o lisado citoplasmático com nuclease micrococcal (nuclease S7; 150 unidades/mL) e CaCl2 (5 mm) a 37 ° c por 90 min para degradar o ácido nucleico fora dos nucleocapsídeos (NCS).
    6. Inative a nuclease S7 pela adição de 10 mM de EDTA.
    7. Precipeie os nucleocapsídeos com polietileno glicol (PEG), interrompa por 0,5% Dodecil sulfato de sódio (SDS), e digerir com 0,6 mg/ml proteinase K (PK) a 37 ° c por 1 h.
    8. Recupere os ácidos nucleicos virais pela extração de clorofórmio fenol e precipitação de etanol.
    9. Resolva o DNA viral extraído em um gel de agarose de 1,2% e detecte pela análise padrão do Southern blot usando uma sonda de DNA HBV com rótulo de32 P.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Como mostrado aqui, as células de T de iPSC-CD8+ específicas do HBV viral AG são geradas por um sistema de cultura in vitro. Após o ato destas pilhas AG-específicas virais de T IPSC-CD8+ suprimir substancialmente a replicação de HBV em um modelo murino (arquivo suplementar 1). Os IPSC do rato são transfomeados com a construção retroviral de MIDR que codifica um gene híbrido do HBV TCR do humano-rato (HBS183-191-specific, s183), a seguir os iPSCs gene-transvados são cocultivados com as pilhas OP9-DL1/DL4 que expressam ligantes do entalhe (DL1 e DL4) moléculas na presença de rFlt3L e rIL-7. No dia 28 da cocultura in vitro, as células derivadas do iPSC expressem substancialmente o TCR CD3 e o AG específico (marcadores de células T). A análise citométrica do fluxo dapopulação CD3 +CD8+ mostra que a TRANSDUÇÃO do HBV TCR aumenta dramaticamente a geração de células T s183-específicas do vírus CD8+ (Figura 1).

No 28º dia de cocultura in vitro, as células CD4-CD8+ single-positive (SP) IPSC-CD8+ t são isoladas e estimuladas por esplócito t-empobrecido pulsado com peptídeo s183, e a produção de citocinas é avaliada. Os iPSC-CTLs produzem grandes quantidades de IL-2 e IFN-you como detectados por coloração intracelular ou ELISA (Figura 2). A infecção por HBV é induzida em camundongos HLA-A 2.1 transgênicos (HHD) por injeção hidrodinâmica de 10 μg de plasmídeo de DNA de pAAV/HBV 1.2 através das veias da cauda de camundongos. A replicação do HBV é detectada a partir do dia 3 – 21 no soro de camundongos HHD. Os picos de replicação de DNA no dia 6 e reduzem gradualmente usando a análise de PCR em tempo real (Figura 3).

Duas semanas após o ACT, os camundongos são desafiados com uma injeção hidrodinâmica de plasmídeo de DNA pAAV/HBV 1.2. O Titer viral é medido por PCR em tempo real do soro em vários temporais após a injeção. Os resultados demonstram que a replicação viral é significativamente reduzida em todos os temporais dos camundongos que receberam células T virais do HBV em relação aos camundongos que receberam células de controle (Figura 4a). A expressão da proteína de superfície do HBV também é examinada no fígado no cenário de tratamento acima. Os camundongos são eutanasiados em vários dias após a injeção de HBV e as amostras de fígado são isoladas para exame histológico. As amostras são manchadas para a proteína de superfície de HBV e examinadas um microscópio de fluorescência. A proteína superficial do HBV é observada como substancialmente diminuída nos camundongos que receberam pré-IPSC-CTLs específicos ao vírus do HBV, em comparação com os camundongos que receberam células controle (Figura 4B). Este experimento demonstra claramente que as células T de iPSC-CD8+ , específicas do vírus AG, têm a capacidade de reduzir a replicação do HBV no modelo murino.

Figure 1
Figura 1: geração de células T de iPSC-CD8+ de vírus do HBV viral AG específicas.
Os iPSCs do rato são transfomeados com as seguintes construções retrovirais: HBs183-91 TCR (MIDR-s183 TCR) ou ova257 – 264 TCR (MIDR-ova TCR), e os iPSCs transvados são cocultivados com pilhas STROMAL de OP9-DL1/DL4 para a diferenciação da linhagem de T. (A) representação esquemática do construto retroviral MIDR-S183 TCR expressando TCR s183-specific. = Sinal de embalagem; 2a = seqüência de autoclivagem 2a de picornavírus; LTR = repetições de terminais longos. (B) morfologia da diferenciação das células T nos dias 0, 7, 14 e 22. (C) análise citométrica de fluxo para as células derivadas do IPSC no dia 28. Células CD3+CD8+ (esquerda) são fechadas como indicado e analisadas para a expressão de CD8 e TCRVβ28 (direita). Os dados mostrados são representativos de três experimentos individuais. Os valores representam média ± DP (* * p < 0, 1; testes t pareados). Por favor clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: análise funcional das células T de iPSC-CD8+ específicas do HBV viral AG.
No 28º dia de cocultura in vitro, as células SP CD8+s183 TCR pentâmero+ IPSC-T são classificadas. As pilhas de IPSC-t e as pilhas de t CD8+ transfoquem com MIDR-s183 TCR são estimuladas por esplenócitos t-depleted (APCs) dos ratos de HHD e pulsado com o peptide s183 (flltrilti). (A) coloração intracelular de IFN-ti após 7 h (gated em células CD8+ ) (T/APCs = 1:4). (B) Elisa de IFN-γ após 40 h. os dados mostrados são representativos de três experimentos individuais. Os valores representam média ± DP (n.s., p > 0, 5; testes t pareados). Por favor clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: indução da replicação do HBV em camundongos HHD por injeção hidrodinâmica.
Os ratos de HHD são administrados intravenosos com o plasmídeo de HBV através da injeção hidrodinâmico da veia de cauda. 10 μg do plasmídeo é injetado com 8% de PBS em massa corporal total. Em pontos de tempo indicados após a injeção, o soro é isolado do sangue e o ADN é extraído para o PCR do tempo real. Os dados mostrados são representativos de três experimentos individuais. Os valores representam média ± DP. os dados são representativos de cinco camundongos por grupo de três experimentos independentes. Por favor clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: redução da replicação do HBV por ACT de células T de iPSC-CD8+ de AG específicas virais.
Os ratos de HHD são intravenosamente transferidos adoptivamente com progenitores AG-específicos virais de célula T de iPSC-CD8+ (no dia 22 da cultura in vitro) e administrados com o PLASMÍDEO de HBV na semana 2 após a transferência da pilha. (A) cópias do soro HBV. Nos temporais indicados após a injeção, o soro é isolado do sangue, e o ADN é extraído para a análise do PCR do tempo real. Os dados mostrados são representativos de três experimentos individuais. Os valores representam média ± DP. (B) histologia do tecido hepático. Camundongos são eutanasiados no dia 8 infecção pós-HBV. As amostras de fígado são isoladas e manchadas para a examinação histologic. O painel superior mostra a expressão da proteína HBsAg em camundongos infectados (coloração IHC) e o painel inferior mostra a infiltração de células inflamatórias (ele-coloração). Os dados são representativos de cinco camundongos por grupo de três experimentos independentes. Por favor clique aqui para ver uma versão maior desta figura.

Molde do ADN 2 ml de
Mistura do mestre da hibridação do ADN ((polymerase do ADN de Taq, amortecedor da reação do PCR, 10 milímetros MgCl2, e mistura de dNTP) 1 ml de
25 mM MgCl2 0,8 ml
0,3 μM a sonda 3 ml de
5 μM de cada primer 3,2 ml
Total 10 ml de

Tabela 1: volume de reacção da PCR

Temperatura Tempo
Desnaturação 95 ° c 5 s
Recozimento 53 ° c 10 de s
Extensão 72 ° c 20 de s
5 ° c

Tabela 2: programa de PCR

Arquivo suplementar 1: Por favor, clique aqui para baixar este arquivo.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Este protocolo apresenta um método para gerar o IPSC-CTLs AG-específico viral para o uso como o ato para suprimir a replicação de HBV em um modelo murino. Na infecção crônica por HBV, o genoma viral forma um mini cromossomo estável, o DNA circular covalentemente fechado (cccDNA) que pode persistir ao longo da vida útil do hepatócito. Alvejar o afastamento do mini cromossoma viral pode conduzir a uma cura da infecção crônica de HBV. A terapia antiviral atual visa a transcriptase reversa do vírus, mas raramente estabelece controle imunológico sobre a replicação do HBV impulsionada pelo cccDNA. As CTLs CD8+ específicas do HBV podem mediar o abate dos hepatócitos infectados e acelerar a depuração do cccDNA. No entanto, as CTLs específicas do HBV são excluídas, disfuncionais ou sucumbir à exaustão em pacientes com infecção crônica pelo HBV. O ato com o CTLs específico para HBV é um tratamento favorável para a infecção crônica pelo HBV28,29. A memória Naive ou central linfócitos t derivados de células t (i.e., células imunes altamente reativas) são efetores ideais para terapias baseadas em ACT devido à sua grande proliferação, menor tendência de morte em comparação com células terminalmente diferenciadas, e excelente capacidade de responder a citocinas homeostáticas. No entanto, tal ACT muitas vezes não é viável devido a dificuldades na obtenção de números suficientes de CTLs de pacientes. Tem sido mostrado previamente que a reprogramação de CTLs AG-específicas ou deT regs de iPSCs pode ser usada para terapias Cell-Based20,23,27,30. Este relatório demonstra um método para gerar IPSC-CTLs AG-específicos virais e para usar estas pilhas para a imunoterapia Act-baseada em um modelo murino da replicação de HBV.

Embora existam modelos de camundongo transgênicos da replicação do HBV, esses modelos são desafiadores porque a tolerância central induzida pelos produtos do gene transgênico faz com que os camundongos sejam imunotolerantes às AGS do HBV. Além disso, camundongos transgênicos não são adequados para monitorar a depuração viral, pois o genoma do HBV integrado persiste em cada célula do mouse31,32. Também, apesar de que as vacinas bem sucedidas foram desenvolvidas para impedir a infecção, o tratamento ou a imunoterapia depois que a infecção de HBV não foi desenvolvida. Além disso, as aproximações experimentais à patogénese de HBV foram impedidas porque a escala do anfitrião da infecção de HBV é limitada aos homens e aos chimpanzés, e o sistema in vitro da cultura para a propagação de HBV não é suficiente. Células T CD8+ são promissoras células efetoras contra vários tipos de infecção viral; no entanto, a resposta da célula T contra o HBV não é abundante. A especificidade, o funcionamento e a falta de números suficientes para montar uma resposta imune podem ser a causa. Este relato revela o método de injeção hidrodinâmica que induz eficientemente a replicação do HBV em camundongos. O método permite a entrega de uma grande quantidade de plasmídeo HBV diretamente no fígado. O modelo exibe viremia contínua por mais de 8 semanas com detecção de mRNA HBV, proteína e DNA em dias diferentes após a injeção. Este método para a replicação do HBV em camundongos é útil para a imunoterapia do HBV.

Em resumo, a replicação de HBV foi induzida com sucesso nos ratos através do procedimento hidrodinâmico da injeção, e os IPSC-CTLs AG-específicos virais foram usados como a imunoterapia para a replicação de HBV. No entanto, existem duas limitações do método: (1) mais de três semanas de diferenciação de células T in vitro podem reduzir as aplicações translacionais das células T geradas para ACT; e (2) a injeção hidrodinâmica do HBV pode induzir eficientemente a replicação do HBV no fígado; Entretanto, não dá forma ao cccDNA, que é a razão principal para a infecção persistente de HBV. No entanto, o método fornece uma abordagem alternativa para a replicação e o tratamento do HBV. Um regime de combinação usando drogas anti-HBV e o ACT de iPSC-CTLs específicos de AG viral provavelmente reduzirá os reservatórios de HIV, resultando em uma terapia para a infecção crônica por HIV.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Os autores agradecem o Dr. Adam J Gehring do Instituto de pesquisa do hospital geral de Toronto para fornecer cDNA para HBs183-91 (s183) (FLLTRILTI)-específico a2-restringiu genes TCR híbridos humanos-murine, e Dr. Pei-Jer Chen da Universidade Nacional de Formosa para fornecer construção de pAAV/HBV 1,2. Este trabalho é apoiado pelo Instituto Nacional de saúde Grant R01AI121180, R01CA221867 e R21AI109239 para J. S.

Materials

Name Company Catalog Number Comments
HHD mice Institut Pasteur, Paris, France H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice
iPS-MEF-Ng-20D-17 RIKEN Cell Bank APS0001
SNL76/7 ATCC SCRC-1049
OP9 ATCC CRL-2749
pAAV/HBV1.2 plasmid Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan) HBV DNA construct
HBs183-91(s183) (FLLTRILTI)-specific TCR genes Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada) FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (Vα34 and Vβ28)
OVA257–264-specific TCR genes Dr. Dario A. Vignali (University of Pittsburgh, PA) SIINFEKL-specific H-2Kb-restricted TCR genes
Anti-CD3 (17A2) antibody Biolegend 100236
Anti-CD44 (IM7) antibody BD Pharmingen 103012
Anti-CD4 (GK1.5) antibody Biolegend 100408
Anti-CD8 (53-6.7) antibody Biolegend 100732
Anti-IFN-γ (XMG1.2) antibody Biolegend 505810
Anti-TNF-a (MP6-XT22) antibody Biolegend 506306
α-MEM Invitrogen A10490-01
Anti-HBs antibody Thermo Fisher MA5-13059
ACK Lysis buffer Lonza 10-548E
Brefeldin A Sigma B7651
DMEM Invitrogen ABCD1234
FBS Hyclone SH3007.01
FACSAria Fusion cell sorter BD 656700
Gelatin MilliporeSigma G9391
GeneJammer Agilent 204130
HLA-A201-HBs183-91-PE pentamer Proimmune F027-4A - 27
HRP Anti-Mouse Secondary Antibody Invitrogen A27025
mFlt-3L Peprotech 250-31L
mIL-7 Peprotech 217-17
Nuclease S7 Roche 10107921001
Paraformaldehyde MilliporeSigma P6148-500G Caution: Allergenic, Carcenogenic, Toxic
Permeabilization buffer Biolegend 421002
Polybrene MilliporeSigma 107689
ProLong™ Gold Antifade Mountant with DAPI Invitrogen P36931
QIAamp MinElute Virus Spin Kit Qiagen 57704

DOWNLOAD MATERIALS LIST

References

  1. Scaglione, S. J., Lok, A. S. Effectiveness of hepatitis B treatment in clinical practice. Gastroenterology. 142, (6), 1360-1368 (2012).
  2. Osiowy, C. From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity. Human Vaccines & Immunotherapeutics. 14, (8), 2093-2097 (2018).
  3. Gish, R. G., et al. Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B. Journal of Viral Hepatitis. 17, (1), 16-22 (2010).
  4. Kurktschiev, P. D., et al. Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction. Journal of Experimental Medicine. 211, (10), 2047-2059 (2014).
  5. Fisicaro, P., et al. Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B. Gastroenterology. 138, (2), 682-693 (2010).
  6. Schurich, A., et al. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathogens. 9, (3), 1003208 (2013).
  7. Gehring, A. J., et al. Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines. Journal of Hepatology. 55, (1), 103-110 (2011).
  8. Xia, Y., et al. Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis. Gastroenterology. 150, (1), 194-205 (2016).
  9. Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection. Proceedings of the National Academy of Sciences U.S.A. 103, (47), 17862-17867 (2006).
  10. Wong, P., Pamer, E. G. CD8 T cell responses to infectious pathogens. Annual Review of Immunology. 21, 29-70 (2003).
  11. Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. Dynamics of hepatitis B virus clearance in chimpanzees. Proceedings of the National Academy of Sciences USA. 102, (49), 17780-17785 (2005).
  12. Hinrichs, C. S., et al. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proceedings of the National Academy of Sciences U.S.A. 106, (41), 17469-17474 (2009).
  13. Hinrichs, C. S., et al. Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy. Blood. 117, (3), 808-814 (2011).
  14. Kerkar, S. P., et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. Journal of Immunotherapy. 34, (4), 343-352 (2011).
  15. Kuball, J., et al. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood. 109, (6), 2331-2338 (2007).
  16. van Loenen, M. M., et al. Mixed T cell receptor dimers harbor potentially harmful neoreactivity. Proceedings of the National Academy of Sciences USA. 107, (24), 10972-10977 (2010).
  17. Cameron, B. J., et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Science Translational Medicine. 5, (197), (2013).
  18. Fedorov, V. D., Themeli, M., Sadelain, M. PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses. Science Translational Medicine. 5, (215), (2013).
  19. Maus, M. V., et al. T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunolology Research. 1, (1), 26-31 (2013).
  20. Haque, R., et al. Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity. Journal of Immunology. 189, (3), 1228-1236 (2012).
  21. Vizcardo, R., et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 12, (1), 31-36 (2013).
  22. Nishimura, T., et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 12, (1), 114-126 (2013).
  23. Lei, F., et al. In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance. Cancer Research. 71, (14), 4742-4747 (2011).
  24. Kim, J. B., et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 136, (3), 411-419 (2009).
  25. Lei, F., Haque, R., Xiong, X., Song, J. Directed differentiation of induced pluripotent stem cells towards T lymphocytes. Journal of Visualized Experiments. (63), e3986 (2012).
  26. Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells. OncoImmunology. 6, (2017).
  27. Haque, M., et al. Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells. Cell Transplantation. 25, (5), 811-827 (2016).
  28. Tan, A. T., et al. Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology. (2019).
  29. Wu, L. L., et al. Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice. Hepatology. (2019).
  30. Haque, M., et al. Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes. Journal of Clinical Investigation Insights. (2019).
  31. Chisari, F. V., et al. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proceedings of the National Academy of Sciences USA. 84, (19), 6909-6913 (1987).
  32. Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. Journal of Immunology. 154, (5), 2504-2515 (1995).
Células-tronco derivadas virais AG-specific T da haste suprimir a replicação de HBV em ratos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).More

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter