Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Stamcelle afledte virale AG-specifikke T-lymfocytter undertrykker HBV-replikation i mus

doi: 10.3791/60043 Published: September 25, 2019

Summary

Præsenteret her er en protokol til effektiv undertrykkelse af hepatitis B virus (HBV) replikation i mus ved at udnytte adoptiv celle overførsel (ACT) af stamcelle-afledte viral antigen (AG)-specifikke T-lymfocytter. Denne procedure kan tilpasses til potentiel ACT-baseret immunterapi af HBV-infektion.

Abstract

Hepatitis B virus (HBV) infektion er et globalt sundhedsproblem. Med over 350.000.000 mennesker ramt på verdensplan, HBV-infektion er fortsat den førende årsag til leverkræft. Det er et stort problem, især i udviklingslandene. Svigt af immunsystemet til at montere en effektiv respons mod HBV fører til kronisk infektion. Selv om HBV vaccine er til stede, og nye antivirale lægemidler er ved at blive skabt, udryddelse af virus-reservoir celler er fortsat et stort sundheds emne. Beskrevet her er en metode til generering af viral antigen (AG)-specifikke CD8+ cytotoksiske T-lymfocytter (CTLS) afledt af inducerede pluripotente stamceller (ipscs) (dvs. IPSC-CTLS), som har evnen til at undertrykke HBV-replikation. HBV-replikation induceres effektivt i mus gennem Hydrodynamisk injektion af et HBV-ekspression plasmid, pAAV/HBV 1.2, i leveren. Derefter, HBV overflade AG-specifikke mus iPSC-CTLs er adoptivt overført, hvilket i høj grad undertrykker HBV-replikation i leveren og blodet samt forhindrer HBV overflade AG ekspression i hepatocytter. Denne metode demonstrerer HBV-replikation i mus efter Hydrodynamisk injektion, og at stamcelle afledte virale AG-specifikke CTL'er kan undertrykke HBV-replikation. Denne protokol giver en nyttig metode til HBV-immunterapi.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Efter akut infektion kontrollerer det adaptive immunsystem (dvs. humorale og cellulær immunitet) hovedparten af akut HBV-relateret hepatitis. Stadig, en række mennesker i HBV-endemiske regioner kan ikke fjerne virus og efterfølgende konvertere som kroniske individer. Mere end 25% af kroniske patienter (> 250 millioner mennesker) på verdensplan udvikler progressiv leversygdom, hvilket resulterer i levercirrhose og/eller hepatocellulært karcinom (HCC)1. Som følge heraf er udryddelse af insisterende inficerede celler fortsat et generelt problem med hensyn til sundhed, selv om der er en tilgængelig vaccine2 , og talrige antivirale lægemidler er under udvikling. Standard behandling for HBV-infektion omfatter IFN-α, nukleosid og nukleotidanaloger. Disse agenter har direkte antiviral aktivitet og immunmodulerende kapaciteter. Ikke desto mindre optræder serokonverteringen af HBe- antigen (AG) + bærere med anti-HBE-antistof (AB) og tab af serum HBV-deoxyribonukleinsyre (DNA) individuelt hos ca. 20% af de behandlede patienter, og hele den immunologiske kontrol af virusset kontrolleret ved fratagelse af HBsAg er ikke mere end 5%3. Desuden er reaktionen på behandlingen ofte ikke holdbar. Profylaktisk vaccination med rekombinant HBs AG er yderst effektiv til at forebygge infektion, men terapeutisk HBs AG vaccination er ikke effektiv. Det er klart, T celle-medieret immunrespons spiller en afgørende rolle i at kontrollere HBV-infektion og leverinsufficiens; Men, hos kronisk hepatitis patienter, HBV-reaktive T-celler er ofte slettet, dysfunktionelle, eller konvertere udmattet4,5,6. Derfor, hos personer med vedvarende HBV-infektion, ingen forsøg på at genindføre HBV-specifik immunitet (dvs. T celle-baseret immunitet) ved hjælp af anti-viral retsmiddel, immuno-modulerende cytokiner, eller helbredende immunisering har opnået succes.

Adoptiv celle overførsel (Act) af HBV AG-specifikke T-celler er en effektiv behandling rettet til i sidste ende udrydde resterende hepatocytter wih HBV7,8. Act af HBV-specifikke CTL'er til HBV-inficerede mus har vist sig at forårsage forbigående, mild hepatitis, og et dramatisk fald i HBV ribonucleinsyre Acid (RNA) transkriptioner i hepatocytter. I disse undersøgelser hæmmer CTLs ikke transkriptionen af HBV-gener, men forbedrede nedbrydningen af HBV-transkriptioner9. HBV-specifikke CTL'er er vigtige for at forebygge virus infektion og mægle clearance af HBV10,11. For Act-baserede retsmidler, in vitro udvidelse af HBV-specifikke T-celler med en høj reaktivitet for in vivo genbosætning er blevet foreslået at være en ideel metode12,13,14; ikke desto mindre er de nuværende tilgange begrænset med hensyn til deres evne til at generere, adskille og dyrke passende mængder og kvaliteter af HBV-specifikke T-celler fra patienter til de potentielle terapier.

Selv om kliniske forsøg nuværende sikkerhed, praktisk, og potentiel terapeutisk aktivitet af celle-baserede behandlinger ved hjælp af konstruerede T-celler, der er specifikke for HBV-virus-inficerede hepatocytter, der er bekymringer om de ugunstige virkninger som følge af autoimmune reaktioner på grund af tvær reaktivitet fra mispluftning T celle receptor (TCR)15,16, off-Target AG anerkendelse af ikke-specifik TCR17 og on-Target off-toksicitet af en chimerisk AG receptor (bil) 18 , 19 med sundt væv. I øjeblikket er de genetisk modificerede T-celler, som kun har kortvarige persistens in vivo, sædvanligvis mellemliggende eller senere Effector T-celler. Til dato, pluripotente stamceller (PSCs) er den eneste kilde til rådighed til at generere et stort antal naive enkelt-type AG-specifikke T-celler20,21,22,23. Inducerede kvikskranker (iPSCs) omdannes simpelthen fra en patients somatiske celler ved hjælp af gentransduktion af flere transkriptionsfaktorer. Som følge heraf har iPSCs samme karakteristika som embryonale stamceller (ESCs)24. På grund af fleksibiliteten og muligheden for uendelig evne til at forny sig selv, ud over vævs udskiftning, kan iPSC-baserede behandlinger anvendes bredt i regenerativ medicin. Desuden kan regimenter underliggende iPSCs væsentligt forbedre de nuværende cellebaserede terapier.

Det overordnede mål med denne metode er at generere en stor mængde HBV-specifikke CTL'er fra iPSCs (dvs. iPSC-CTLs) til ACT-baseret immunterapi. Fordelene i forhold til alternative teknikker er, at HBV-specifikke iPSC-CTL'er har en enkelt-type TCR og naiv fænotype, hvilket resulterer i mere hukommelse T celle udvikling efter handlingen. Det påvises, at den handling af HBV-specifikke iPSC-CTLs øger migrationen af funktionelle CD8+ T celler i leveren og reducerer HBV-replikation i både lever og blod af administrerede mus. Denne metode afslører en potentiel anvendelse af virale AG-specifikke iPSC-CTL'er til HBV-immunterapi og kan tilpasses til at generere andre virale AG-specifikke iPSC-T-celler til viral immunterapi.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle dyreforsøg er godkendt af Texas A & M University Animal Care Komité (IACUC; #2018-0006) og gennemføres i overensstemmelse med retningslinjerne for foreningen for vurdering og akkreditering af Laboratoriedyrs pleje. Mus anvendes under 6 – 9 ugers alderen.

1. generering af virale AG-specifikke CD8+ t-celler fra ipscs (IPSC-CD8+ t-celler)

  1. Oprettelse af retrovirale konstruktioner
    Bemærk: TCR α og β gener er forbundet med 2A selv klødende sekvens. Den retrovirale vektor mscv-IRES-dsred (midr) er dsred+ 23.
    1. Sub-klon HBs183-191 (flltrilti)-specifikke a2-begrænset Human-murine hybrid TCR (S183 TCR) gener (vα 34 og Vβ28) i midr at skabe S183 midr konstruktion (figur 1A)25.
  2. Retroviral transduktion
    Bemærk: platin-E (plat-e) cellerne anvendes til emballering af retrovira (transporterer s183 TCR gener), som vil blive anvendt til antiretroviral transduktion. Plat-E cellerne er en effektiv retrovirus emballage celler underliggende 293T celler, som blev udviklet ved hjælp af unikke emballage konstruktioner via EF1α Promoter til at udtrykke antiretroviral struktur protein, herunder gag, pol, og ecotropic env.
    1. På en 100 mm kultur skål, frø 3 x 106 plat-E celler i 8 ml DMEM kulturmedium indeholdende 10% føtal kalveserum (FCS) i en inkubator ved 37 °c med 5% Co2, 1 dag før transfection.
    2. På dag 0, transficere s183 midr konstruere i plat-E celler ved hjælp af en DNA transfektering reagens25.
    3. På dag 1, frø 1 x 106 ipscs (gfp+) i en gelatine præ-belagt kultur plade.
    4. På dag 2 – 3, indsamle retrovira-indeholdende supernatanten fra plat-E cellekultur til at transduce iPSCs med s183 TCR i nærværelse af 1,6-dibromohexan opløsning25.
    5. På dag 4, trypsinize s183 TCR gen-transduced iPSCs, centrifuge ved 400 x g i 5 min og frø 3 × 105 ipscs i en 100 mm kultur skål præ-belagt med 3 x 106 bestrålede SNL76/7 (irSNL76/7) feeder celler25.
    6. På dag 5 eller 6 af sammenløbet, trypsinize cellerne, centrifuge ved 400 x g i 5 min og proces for celle sortering. Gating på levende celler, sortere GFP og DsRED dobbelt-positive celler (s183 TCR gen-transduced iPSCs) ved hjælp af en høj hastighed celle sortering. Svarende til trin 1.2.5, co-kultur de sorteres celler på irSNL76/7 feeder celler til fremtidig brug25.
  3. Differentiering af HBV-specifikke iPSC-CD8+ T-celler
    Bemærk: OP9-DL1/DL4 stromale celler over Express både notch ligander DL1 og DL4, og co-culturing ipscs med ipscs kan fremme notch signalering-medieret T Celledifferentiering26.
    1. Grow s183 TCR-gentransducerede ipscs (s183/ipscs) i OP9-DL1-DL4 celle-enkeltlags i α-minimum Essential medium (MEM)-medier, der indeholder 20% føtal bovint serum (FBS)27. Omfatter murine Flt3 ligand (mFlt-3L; endelig koncentration = 5 ng/mL) i kulturen.
    2. På dag 0, Seed 0.5-1.0 x 105 S183/ipscs i en 10 cm kultur skål tidligere dyrket med OP9-DL1-DL4 celler. Valider, at OP9-DL1-DL4 cellerne er i en tilstand på 80%-90% sammenhæng.
    3. På dag 5 skylles Ipsc'erne med 10 mL fosfat-bufferet saltvand (PBS), Aspirer ud af PBS, tilsættes dette til 4 mL 0,25% trypsin og inkuberer i en 37 °C-inkubator i 10 min. derefter tilsættes en supplerende 8 mL iPSC-medie for at ophøre med trypsin-fordøjelsen. Saml alle fordøjelses opløsninger, der indeholder cellerne, og centrifugeres ved 400 x g i 5 minutter ved 15 – 30 °c.
    4. Aspirér supernatanten, og resuspender cellerne i 10 mL iPSC-medier. Cellesuspensionen overføres til en ny 10 cm Petri plade, og inkubatoren inkubates i 30 min ved 37 °C.
    5. Efter 30 min, indsamle iPSC medier, der indeholder de flydende celler. Pass cellesuspensionen gennem en 70 μm celle sien og beregne celle nummeret.
    6. Frø 5 x 105 celler i kulturen skålen tidligere dyrket OP9-DL1-DL4 celler med en tilstand på 80%-90% flydende som beskrevet i trin 1.3.1.
      Bemærk: for T Celledifferentiering, hver 2 – 3 dage, iPSC-afledte celler har brug for at re-frø med et nyt lag af OP9-DL1-DL4 celler.
  4. Evaluering
    1. Morfologiske ændringer af differentierende iPSCs
      1. Observere celler under et mikroskop på forskellige dage.
        Bemærk: på dag 5, kolonier har mesoderm-lignende egenskaber, udstiller en klassisk spindel-form morfologi ligner humane Dermal fibroblaster og vedvarende vækst in vitro. Ved dag 8 begynder små runde klynger af celler at dukke op.
    2. Analyse af differentiering af iPSCs ved flow cytometri
      1. På forskellige dage af co-kultur, analysere iPSC-afledte celler som beskrevet tidligere25 (figur 1B, C).
    3. Funktionel analyse af differentierende iPSCs
      1. På dag 28 i co-kultur, indsamle iPSC-CD8+ T celler fra kulturer gennem høst de flydende celler, trypsinize de resterende celler med 0,25% trypsin, re-suspendere i 8 ml af IPSC medier, centrifuge i 5 min ved 400 x g ved 15 – 30 °c, fjerne medierne, derefter opslæmmes cellerne i 10 mL medier.
      2. Opbevar de re-suspenderede celler i en frisk 10 cm skål i en 37 °C inkubator i 30 min og Saml de flydende celler. Derefter skylles cellerne en gange med en kold PBS.
      3. Inkubér 3 x 106 T celle-depleterede splenocytter (CD4-CD8-) fra deres af H-2 klasse I knockout, HLA-a 2.1-transgene (HHD) mus med 5 μM s183 peptid (flltrilti) i 200 μl medier ved 4 °c i 30 min.
      4. Fremstil en blanding af iPSC-CD8+ T-celler med splenocytter, der er pulseret med s183 peptid (T-celler: splenocytter = 1:4; Brug 0,75 x 106 T-celler). Der inkubates i blandingen af celler ved 37 °C i en CO2 -inkubator for 40 h. I løbet af de sidste 7 timer tilsættes 4 μL fortyndet brefeldin A i kulturen (den endelige koncentration på 1.000 x, som vil blive fortyndet i 1x kultur medier) for at blokere transport processerne under celle aktivering.
      5. Cellerne og udføre flow cytometrisk analyse af intracellulær IFN-γ som beskrevet tidligere (figur 2).

2. induktion af HBV-replikation gennem Hydrodynamisk levering af HBV-plasmid

Bemærk: pAAV/HBV 1.2-konstruktionen blev genereret som beskrevet tidligere9. HBV 1,2 komplet DNA er indarbejdet i Vector pAAV.

  1. Hydrodynamiske leverancer af HBV plasmid gennem hale vene
    1. Opvarm HHD-mus ved hjælp af en varmelampe i 5 min i buret for at dilatere hale vene.
    2. Tilbageholde dyret ved hjælp af en fastholdelses, og rene muse haler med 70% ethanol spray.
    3. Levering af plasmid i leveren.
    4. Mål musens legemsvægt ved hjælp af en måleskala.
    5. 10 μg HBV plasmid fortyndes i 8% ækvivalent af Body Mass PBS (f. eks. 1,6 mL for en 20 g mus). Fortyndet plasmid i en 3 mL sprøjte med en 26 G × 12"(0,45 × 12 mm) hypodermic nål.
    6. Find en af de to laterale hale vener i den midterste tredjedel af halen og Placer nålen i enten lateral vene. Injicér injektionen indeholdende HBV plasmid gennem hale vene inden for 3-5 s.
  2. Kvantificering af observeres fra blod serum fra inficerede mus
    Bemærk: HBV-replikering sker fra dag 3 – 35 i muse serum. DNA-replikeringen toppe på dag 7 og reducerer gradvist. HBV-DNA udskilles ikke fra serum indtil dag 35.
    1. Opsamling af blod serum fra inficerede mus
      1. Der opsamles ca. 0,1 mL blod i et mikrocentrifuge glas fra hver mus på 3, 5, 7 og 10 dage efter infektion med retroorbital blødning i et 1,5 mL mikrocentrifuge glas, og derefter inkubates ved stuetemperatur (RT) i 20 min.
      2. Prøven centrifugeres ved 6.000 x g i 15 minutter ved 4 °c, og serum supernatanten opsamles efter centrifugering.
    2. Rense DNA fra blod serum ved hjælp af et kommercielt tilgængeligt DNA-ekstraktions udstyr efter fabrikantens anvisninger. Kortvarigt, lysere cellerne i en silica-baseret kolonne, udføre vaskene, og udtrække DNA ved at tilføje 100% ethanol til elueringssøjlen og centrifuger ved 6000 x g i 1 min. eluere dna i 50 ΜL RNase-frit vand.
    3. Brug 100 ng af HBV-DNA fra elueringsprocessen for realtids PCR-analyse. Brug følgende primere og sonder: Forward 5 ' taggaggctgtaggcataaattgg 3 '; omvendt 5 ' GCACAGCTTGGAGGCTTGT 3 '; Probe 5 ' TCACCTCTGCCTAATC 3 '.
      1. Brug HBV-genom indeholdende plasmid (pAAV/HBV 1.2) til standardkurve og Udfør realtids-PCR i et samlet volumen på 10 μL (figur 3).
    4. PCR-reaktionen indstilles i et samlet volumen på 10 μL som vist i tabel 1.
    5. Indstil PCR-programmet i termocycleren som vist i tabel 2. Den programmerede temperatur Overgangshastighed er 20 °C/s for denaturering/annealing og 5 °C/s for forlængelse. Mål fluorescensen i slutningen af udglødnings fasen for hver cyklus for realtids PCR-overvågning.

3. reduktion af HBV-replikering ved ACT af viral AG-specifikke iPSC-CD8+ T-celler

  1. Overførsel af adoptivceller (ACT)
    1. Differentiere s183/iPSCs (1.3.7) på OP9-DL1-DL4 stromale celler i nærværelse af mFlt-3L og mIL-7 i 8 dage som beskrevet i punkt 1,3.
    2. På dag 22 opsamles iPSC-CD8+ T-celler fra 10 cm pladen med trypsin, derefter vaskes og resuspenderes hver 10 cm plade i 10 ml friske medier. Tilsæt cellerne til en frisk 10 cm plade og vend tilbage til inkubator i 30 min som det er gjort i afsnit 1,3. Efter 30 min, indsamle flydende celler.
    3. Brug en 70 μm nylon si til at passere celler for at eliminere celle klynger og tælle celle nummeret. Tilpasse cellerne til en koncentration på 1,5 x 107 celler/ml i kold PBS opløsning og bruge en 70 μm nylon si til at passere celler for at eliminere celle klynger igen, hvis det er nødvendigt. Hold cellerne på is, indtil handlingen.
    4. Injicer 200 μL cellesuspension (3 x 106 celler) i 4 – 6 uger gamle HHD-mus gennem hale vene.
  2. Induktion af HBV-replikation
    1. På dag 14 efter celle overførsel, udføre den hydrodynamiske levering af HBV plasmid gennem hale vene som beskrevet i punkt 2,1.
  3. Påvisning af virus protein fra inficerede lever
    1. Ofrer mus på dag 3, 5, 7, 14 og 21 efter infektion. For eutanasi skal du i hvert bur bruge 1 – 2 L kuldioxid (CO2) i første fase. Når dyret udvikler tabet af bevidsthed, få CO2 flowhastighed omkring 4 – 5 L/min. udføre mus eutanasi ved hjælp af co2 indånding.
    2. Adskille leveren ved at skære overfladen huden af bughinden udnytte saks og pincet og lidt trække leveren tilbage for at afdække den indre hud foring bughulen. Indsamle og skære leverprøver (længde x bredde x højde = 0,5 cm x 0,5 cm X 0,3 cm) af de inficerede mus til at passe let ind i indlejring kassette og blok i 10% neutral buffer formalin for 4 – 24 h.
    3. Decalcify leveren samplesusing 2,5 M myresyre; Skyl i xylen i 3 min., skyl 2x i 100% ethanol, skyl 2x i 95% ethanol, skyl 2x i deioniseret (DI) vand i 2 minutter, og afkald derefter lever prøverne i 1 mM ethylendiamintetraeddikesyre (EDTA) tilsvarende. Ved en sub-kogende temperatur (90 °C) i 20 min.
    4. Afkøl det faste levervæv i 30 min. Skyl vævene med 1x PBS i 4 min og Integrer vævet i paraffin. Dehydrere vævet i en række stigende koncentrationer af ethanol til at erstatte vandet, og derefter fordybe sig i xylen fordybelse. Integrer det infiltrerede væv i voksblokke. Lav jævnt lodret og vandret skæring til farvning. Forbered 4 μm sektioner med en glidende mikrotom.
    5. Passere afsnittene gennem deparaffinisering og rehydrering ved hjælp af xylen og ethanol, derefter udføre immunfluorescent farvning af sektionerne.
    6. Afsnittene med 200 μL HBV-overflade AG-specifikt antistof (1:100 fortynding i blokerings opløsningen) plette. Der inkubatér sektionerne med antistoffet i 2 timer ved RT i et 75% – 100% befuret kammer, og vask 5x i 1x PBS i 5 min.
    7. Brug et anti-fade reagens, der indeholder 4 ', 6-diamidino-2-phenylindol (DAPI) til nuklear farvning for at modvirke diasene. Læg dæksedlen med ca. 300 μL af den fortyndede DAPI-farvningsopløsning (300 nM i 1x PBS), og validerer hele dæksedlen, som er dækket. Opbevar gliderne i mørke ved 4 °C, indtil de inspiceres under et fluorescerende mikroskop.
  4. Inflammatorisk celleinfiltration i inficerede mus
    1. Offer mus som beskrevet i trin 3.3.1. Saml leveren og lav sektioner som beskrevet i trin 3.3.4.
    2. Plette afsnittet med hematoxylinlegemer og eosin (H & E) for at evaluere infiltration af inflammatoriske celler i leveren.
    3. Opbevar slides i mørke ved 4 °C indtil yderligere analyse under et fluorescerende mikroskop.
    4. Visualiser slides under et fluorescens mikroskop for at detektere infiltrationen af inflammatoriske celler i leveren (figur 4).
  5. HBV-DNA-påvisning af inficeret lever
    1. Isolering af viral DNA.
    2. Euthanize mus og indsamle de leverprøver i henhold til punkt 3,3.
    3. Lyse leveren væv i Nonindet P-40 (NP-40) lysis buffer (50 mM Tris-HCL, 1 mM EDTA, 1% NP-40) indeholdende en proteasehæmmer cocktail.
    4. Centrifugeres kortvarigt ved 16.000 x g for at fjerne kerner og cellerester.
    5. Inkuber cytoplasmisk lysat med micrococcal nuclease (nuclease S7; 150 enheder/mL) og CaCl2 (5 mm) ved 37 °c for 90 min at nedbryde nukleinsyre uden nukleocapsid'er (NCS).
    6. Inaktivere nuclease S7 ved tilsætning af 10 mM EDTA.
    7. Bundfældning af nukleocapsider med polyethylenglycol (PEG), forstyrre 0,5% natriumdodecyl sulfat (SDS), og fordøje med 0,6 mg/mL proteinase K (PK) ved 37 °C i 1 time.
    8. Genopret de virale nukleinsyrer ved phenolchloroform ekstraktion og ethanol nedbør.
    9. Løs det ekstraherede virale DNA på en 1,2% agopstået gel, og detektér ved standard Southern blot-analyse ved hjælp af en32 P-mærket HBV-DNA-sonde.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Som vist her genereres HBV viral AG-specifikke iPSC-CD8+ T-celler af et in vitro-kultur system. Efter handling af disse virale AG-specifikke iPSC-CD8+ T-celler undertrykker i væsentlig grad HBV-replikation i en murine-model (supplerende fil 1). Mus IPSC er transduceret med midr antiretroviral konstruere kodning af en human-mus hybrid HBV TCR gen (HBS183-191-specifikke, s183), så de gentransducerede ipscs er co-kultiveret med OP9-DL1/DL4 celler udtrykker notch ligander (både DL1 og DL4) molekyler i nærværelse af rFlt3L og rIL-7. På dag 28 i in vitro-Co-kulturen udtrykker de iPSC-afledte celler betydeligt CD3-og AG-specifikke TCR (T-celle markører). Flow cytometrisk analyse af CD3+CD8+ populationen viser, at HBV-TCR-transduktionen dramatisk øger genereringen af VIRALE s183-specifikke CD8+ T-celler (figur 1).

På dag 28 i in vitro-Co-kulturen isoleres CD4-CD8+ single-positive (SP) IPSC-CD8+ t-cellerne og stimuleres af t-depleterede splenocytter, der er pulseret med s183 peptid, og cytokinproduktionen vurderes. IPSC-CTL'erne producerer store mængder IL-2 og IFN-Υ som påvist ved intracellulær farvning eller ELISA (figur 2). HBV-infektion induceres i HLA-A 2.1 transgene (HHD) mus ved Hydrodynamisk injektion af 10 μg pAAV/HBV 1.2 DNA plasmid gennem hale vener af mus. HBV-replikation detekteres fra dag 3 – 21 i serum af HHD-mus. DNA-replikeringen toppe på dag 6 og reducerer gradvist ved hjælp af real-time PCR analyse (figur 3).

To uger efter handlingen udfordres mus med en Hydrodynamisk injektion af pAAV/HBV 1.2 DNA plasmid. Viral titer måles ved hjælp af real-time PCR fra serum på forskellige tidspunkter efter injektionen. Resultaterne viser, at viral replikation er signifikant reduceret på alle tidspunkter i de mus, der modtager HBV viral AG-specifikke T-celler sammenlignet med de mus, der modtager kontrol celler (figur 4A). HBV-overflade protein ekspression undersøges også i leveren i ovennævnte behandlingsindstilling. Mus er aflives på forskellige dage efter HBV injektion og lever prøverne er isoleret til histologisk undersøgelse. Prøverne farves for HBV-overflade protein og undersøges under et fluorescens mikroskop. HBV-overflade protein observeres som væsentligt nedsat i de mus, der modtager HBV viral AG-specifikke præ-iPSC-CTL'er, sammenlignet med de mus, der modtager kontrol celler (figur 4B). Dette eksperiment viser tydeligt, at viral AG-specifikke iPSC-CD8+ T-celler har evnen til at reducere HBV-replikation i murine-modellen.

Figure 1
Figur 1: generering af HBV viral AG-specifikke iPSC-CD8+ T-celler.
Mus iPSCs er transduceret med følgende retrovirale konstruktioner: HBs183-91 TCR (midr-S183 TCR) eller OVA257-264 TCR (MIDR-OVA TCR), og de transducerede ipscs er co-dyrket med OP9-DL1/DL4 stromale celler for T Lineage differentiering. A) skematisk gengivelse af den retrovirale konstruktion midr-S183 TCR, der udtrykker s183 specifik TCR. Om = emballerings signal; 2A = picornavirus selv-cleaving 2A sekvens; LTR = Long Terminal gentager. B) morfologi for T-Celledifferentiering på dag 0, 7, 14 og 22. C) flow cytometrisk analyse for IPSC-afledte celler på dag 28. CD3+CD8+ celler (venstre) er gated som angivet og analyseret for EKSPRESSION af CD8 og TCRVβ28 (højre). De viste data er repræsentative for tre individuelle eksperimenter. Værdierne repræsenterer middelværdien ± SD (* * p < 0,01; parrede t-tests). Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: funktionel analyse af HBV viral AG-specifikke iPSC-CD8+ T-celler.
På dag 28 i in vitro-Co-kultur sorteres SP CD8+s183 TCR pentamer kosmetisk+ IPSC-T-cellerne. IPSC-T-cellerne og CD8+ T-cellerne, der er Transduceret med midr-S183 TCR, stimuleres af T-depleterede splenocytter (Apc'er) fra HHD-mus og pulserende med s183 PEPTID (FLLTRILTI). A) intracellulær farvning af IFN-Υ efter 7 timer (GATED på CD8+ celler) (T/APCS = 1:4). B) Elisa af IFN-γ efter 40 h. de viste data er repræsentative for tre individuelle eksperimenter. Værdierne repræsenterer middelværdien ± SD (n.s., p > 0,05; parrede t-tests). Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: induktion af HBV-replikation i HHD-mus ved Hydrodynamisk injektion.
HHD-mus er i.v. ADMINISTRERET med HBV plasmid via Hydrodynamisk hale vene injektion. 10 μg plasmid injiceres med 8% af total Body Mass PBS. På indikerede tidspunkter efter injektionen isoleres serum fra blodet, og DNA ekstraheres for real-time PCR. De viste data er repræsentative for tre individuelle eksperimenter. Værdierne repræsenterer Mean ± SD. data er repræsentative for fem mus pr. gruppe af tre uafhængige eksperimenter. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: reduktion af HBV-replikation ved ACT af virale AG-specifikke iPSC-CD8+ T-celler.
HHD-mus er i.v. adoptivt overført med viral AG-specifikke iPSC-CD8+ T-celle progenitorer (på dag 22 i in vitro-kulturen) og ADMINISTRERET med HBV plasmid i uge 2 efter celle overførslen. A) serum-HBV-kopier. Ved de indikerede tidspunkter efter injektionen isoleres serum fra blod, og DNA udvindes til realtids PCR-analyse. De viste data er repræsentative for tre individuelle eksperimenter. Værdierne repræsenterer middelværdien ± SD. (B) histologi af levervævet. Mus er aflives på dag 8 post-HBV infektion. Leverprøver isoleres og farves til histologisk undersøgelse. Øvre panel viser HBsAg protein ekspression i inficerede mus (IHC farvning) og nederste panel viser den inflammatoriske celleinfiltration (HE-farvning). Data er repræsentative for fem mus pr. gruppe af tre uafhængige eksperimenter. Venligst klik her for at se en større version af dette tal.

DNA-skabelon 2 ml
DNA-Master hybridiserings blanding ((Taq-DNA-Polymerase, PCR-reaktionsbuffer, 10 mM MgCl2 og dNTP-blanding) 1 ml
25 mM MgCl2 0,8 ml
0,3 μM sonde 3 ml
5 μM af hver primer 3,2 ml
Samlede 10 ml

Tabel 1: PCR-reaktions volumen

Temperatur Tid
Denaturering 95 °C 5 s
Udglødning 53 °C 10 s
Udvidelse 72 °C 20 s
5 °C

Tabel 2: PCR-program

Supplerende fil 1: Venligst klik her for at downloade denne fil.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Denne protokol præsenterer en metode til at generere de virale AG-specifikke iPSC-CTLs til brug som ACT til at undertrykke HBV-replikation i en murine model. Ved kronisk HBV-infektion danner det virale genom et stabilt mini-kromosom, det kovalent lukkede cirkulære DNA (cccDNA), der kan vare ved hele levetiden for hepatocyt. Målretning clearance af viral mini kromosom kan resultere i en kur af kronisk HBV-infektion. Aktuel antiviral behandling er rettet mod virus reverse transkriptase, men sjældent etablerer immunologisk kontrol over HBV-replikation drevet af cccDNA. HBV-specifikke CD8+ CTLS kan mægle drab på de inficerede hepatocytter og fremskynde clearance af cccdna. Ikke desto mindre er de HBV-specifikke CTL'er slettet, dysfunktionelle, eller bukke under for udmattelse hos patienter med kronisk HBV-infektion. Act med HBV-specifikke CTLS er en gunstig behandling for kronisk HBV-infektion28,29. Naive eller central hukommelse T celle-afledte T-lymfocytter (dvs., meget reaktive immunceller) er ideelle effektorer til ACT-baserede behandlinger på grund af deres store spredning, lavere tendens til døden i forhold til terminalt differentierede celler, og fremragende evne til at reagere på homeostatiske cytokiner. En sådan handling har imidlertid ofte ikke været mulig på grund af vanskeligheder med at opnå et tilstrækkeligt antal CTL'er fra patienter. Det er tidligere blevet påvist, at omprogrammering af AG-specifikke CTL'er eller Tregs fra ipscs kan anvendes til cellebaserede terapier20,23,27,30. Denne rapport viser en metode til at generere viral AG-specifikke iPSC-CTLs og bruge disse celler til ACT-baseret immunterapi i en murine model af HBV-replikation.

Selvom der er transgene musemodeller af HBV-replikation, er disse modeller udfordrende, fordi den centrale tolerance induceret af de transgene genprodukter forårsager, at mus er immun tolerante over for HBV-AGS. Desuden er Transgene mus ikke egnet til overvågning af viral clearance, da det integrerede HBV-genom fortsætter i hver muse celle31,32. Også, på trods af at vellykkede vacciner er blevet udviklet til at forhindre infektion, behandling eller immunterapi efter HBV infektion er ikke blevet udviklet. Desuden er de eksperimentelle tilgange til HBV-patogenesen blevet hæmmet, fordi værtsområdet for HBV-infektion er begrænset til mænd og chimpanser, og in vitro-kultur system til udbredelse af HBV ikke er tilstrækkeligt. CD8+ T- celler er lovende Effector celler mod forskellige typer af viral infektion; Men, T celle respons mod HBV er ikke rigelige. Specificitet, funktion, og mangel på tilstrækkeligt antal til at montere en immunrespons kan være årsagen. Denne rapport afslører metoden til Hydrodynamisk injektion, der effektivt inducerer HBV-replikation i mus. Metoden giver mulighed for levering af en stor mængde HBV plasmid direkte ind i leveren. Modellen udviser kontinuerlig observeres i mere end 8 uger med påvisning af HBV mRNA, protein og DNA på forskellige dage efter injektion. Denne metode til HBV-replikation i mus er nyttig til HBV-immunterapi.

Sammenfattende blev HBV-replikation induceret med succes i mus gennem Hydrodynamisk injektion procedure, og viral AG-specifikke iPSC-CTLs blev anvendt som immunterapi for HBV-replikation. Men, der er to begrænsninger af metoden: (1) mere end tre ugers in vitro-T Celledifferentiering kan reducere de translationelle anvendelser af de genererede T-celler for ACT; og (2) HBV Hydrodynamisk injektion effektivt kan inducere HBV-replikation i leveren; det udgør dog ikke cccDNA, som er hovedårsagen til den vedvarende HBV-infektion. Ikke desto mindre giver metoden en alternativ tilgang til HBV-replikation og behandling. En kombination regime ved hjælp af anti-HBV-medicin og den handling af viral AG-specifikke iPSC-CTLs er tilbøjelige til at reducere HIV-reservoirer, hvilket resulterer i en terapi for kronisk HIV-infektion.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Forfatterne takker Dr. Adam J Gehring fra Toronto General Hospital Research Institute for at levere cDNA til HBs183-91 (s183) (FLLTRILTI)-specifikke a2-Restricted Human-murine hybrid TCR gener, og Dr. Pei-jer Chen fra National Taiwan University for at give pAAV/HBV 1,2 konstruere. Dette arbejde støttes af National Institute of Health Grant R01AI121180, R01CA221867 og R21AI109239 til J. S.

Materials

Name Company Catalog Number Comments
HHD mice Institut Pasteur, Paris, France H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice
iPS-MEF-Ng-20D-17 RIKEN Cell Bank APS0001
SNL76/7 ATCC SCRC-1049
OP9 ATCC CRL-2749
pAAV/HBV1.2 plasmid Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan) HBV DNA construct
HBs183-91(s183) (FLLTRILTI)-specific TCR genes Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada) FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (Vα34 and Vβ28)
OVA257–264-specific TCR genes Dr. Dario A. Vignali (University of Pittsburgh, PA) SIINFEKL-specific H-2Kb-restricted TCR genes
Anti-CD3 (17A2) antibody Biolegend 100236
Anti-CD44 (IM7) antibody BD Pharmingen 103012
Anti-CD4 (GK1.5) antibody Biolegend 100408
Anti-CD8 (53-6.7) antibody Biolegend 100732
Anti-IFN-γ (XMG1.2) antibody Biolegend 505810
Anti-TNF-a (MP6-XT22) antibody Biolegend 506306
α-MEM Invitrogen A10490-01
Anti-HBs antibody Thermo Fisher MA5-13059
ACK Lysis buffer Lonza 10-548E
Brefeldin A Sigma B7651
DMEM Invitrogen ABCD1234
FBS Hyclone SH3007.01
FACSAria Fusion cell sorter BD 656700
Gelatin MilliporeSigma G9391
GeneJammer Agilent 204130
HLA-A201-HBs183-91-PE pentamer Proimmune F027-4A - 27
HRP Anti-Mouse Secondary Antibody Invitrogen A27025
mFlt-3L Peprotech 250-31L
mIL-7 Peprotech 217-17
Nuclease S7 Roche 10107921001
Paraformaldehyde MilliporeSigma P6148-500G Caution: Allergenic, Carcenogenic, Toxic
Permeabilization buffer Biolegend 421002
Polybrene MilliporeSigma 107689
ProLong™ Gold Antifade Mountant with DAPI Invitrogen P36931
QIAamp MinElute Virus Spin Kit Qiagen 57704

DOWNLOAD MATERIALS LIST

References

  1. Scaglione, S. J., Lok, A. S. Effectiveness of hepatitis B treatment in clinical practice. Gastroenterology. 142, (6), 1360-1368 (2012).
  2. Osiowy, C. From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity. Human Vaccines & Immunotherapeutics. 14, (8), 2093-2097 (2018).
  3. Gish, R. G., et al. Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B. Journal of Viral Hepatitis. 17, (1), 16-22 (2010).
  4. Kurktschiev, P. D., et al. Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction. Journal of Experimental Medicine. 211, (10), 2047-2059 (2014).
  5. Fisicaro, P., et al. Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B. Gastroenterology. 138, (2), 682-693 (2010).
  6. Schurich, A., et al. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathogens. 9, (3), 1003208 (2013).
  7. Gehring, A. J., et al. Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines. Journal of Hepatology. 55, (1), 103-110 (2011).
  8. Xia, Y., et al. Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis. Gastroenterology. 150, (1), 194-205 (2016).
  9. Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection. Proceedings of the National Academy of Sciences U.S.A. 103, (47), 17862-17867 (2006).
  10. Wong, P., Pamer, E. G. CD8 T cell responses to infectious pathogens. Annual Review of Immunology. 21, 29-70 (2003).
  11. Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. Dynamics of hepatitis B virus clearance in chimpanzees. Proceedings of the National Academy of Sciences USA. 102, (49), 17780-17785 (2005).
  12. Hinrichs, C. S., et al. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proceedings of the National Academy of Sciences U.S.A. 106, (41), 17469-17474 (2009).
  13. Hinrichs, C. S., et al. Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy. Blood. 117, (3), 808-814 (2011).
  14. Kerkar, S. P., et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. Journal of Immunotherapy. 34, (4), 343-352 (2011).
  15. Kuball, J., et al. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood. 109, (6), 2331-2338 (2007).
  16. van Loenen, M. M., et al. Mixed T cell receptor dimers harbor potentially harmful neoreactivity. Proceedings of the National Academy of Sciences USA. 107, (24), 10972-10977 (2010).
  17. Cameron, B. J., et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Science Translational Medicine. 5, (197), (2013).
  18. Fedorov, V. D., Themeli, M., Sadelain, M. PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses. Science Translational Medicine. 5, (215), (2013).
  19. Maus, M. V., et al. T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunolology Research. 1, (1), 26-31 (2013).
  20. Haque, R., et al. Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity. Journal of Immunology. 189, (3), 1228-1236 (2012).
  21. Vizcardo, R., et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 12, (1), 31-36 (2013).
  22. Nishimura, T., et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 12, (1), 114-126 (2013).
  23. Lei, F., et al. In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance. Cancer Research. 71, (14), 4742-4747 (2011).
  24. Kim, J. B., et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 136, (3), 411-419 (2009).
  25. Lei, F., Haque, R., Xiong, X., Song, J. Directed differentiation of induced pluripotent stem cells towards T lymphocytes. Journal of Visualized Experiments. (63), e3986 (2012).
  26. Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells. OncoImmunology. 6, (2017).
  27. Haque, M., et al. Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells. Cell Transplantation. 25, (5), 811-827 (2016).
  28. Tan, A. T., et al. Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology. (2019).
  29. Wu, L. L., et al. Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice. Hepatology. (2019).
  30. Haque, M., et al. Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes. Journal of Clinical Investigation Insights. (2019).
  31. Chisari, F. V., et al. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proceedings of the National Academy of Sciences USA. 84, (19), 6909-6913 (1987).
  32. Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. Journal of Immunology. 154, (5), 2504-2515 (1995).
Stamcelle afledte virale AG-specifikke T-lymfocytter undertrykker HBV-replikation i mus
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).More

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter