Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Stammzell-abgeleitete virale Ag-spezifische T-Lymphozyten unterdrücken HBV-Replikation bei Mäusen

doi: 10.3791/60043 Published: September 25, 2019

Summary

Hier wird ein Protokoll zur wirksamen Unterdrückung der Hepatitis-B-Virus -Replikation (HBV) bei Mäusen unter Verwendung des Adoptivzelltransfers (ACT) von Stammzell-abgeleitetem viralem Antigen (Ag)-spezifischen T-Lymphozyten vorgestellt. Dieses Verfahren kann für eine mögliche ACT-basierte Immuntherapie der HBV-Infektion angepasst werden.

Abstract

Hepatitis-B-Virus (HBV) Infektion ist ein globales Gesundheitsproblem. Mit über 350 Millionen Menschen weltweit ist die HBV-Infektion nach wie vor die Hauptursache für Leberkrebs. Dies ist ein großes Anliegen, insbesondere in den Entwicklungsländern. Das Versagen des Immunsystems, eine wirksame Reaktion gegen HBV zu montieren, führt zu einer chronischen Infektion. Obwohl HBV-Impfstoff vorhanden ist und neue antivirale Medikamente entwickelt werden, bleibt die Tilgung von Virusreservoirzellen ein großes Gesundheitsthema. Hier wird eine Methode zur Generierung von viralem Antigen (Ag) -spezifische CD8+ zytotoxische T-Lymphozyten (CTLs) beschrieben, die aus induzierten pluripotenten Stammzellen (iPSCs) (d. h. iPSC-CTLs) abgeleitet werden, die die Fähigkeit haben, die HBV-Replikation zu unterdrücken. Die HBV-Replikation wird bei Mäusen effizient durch hydrodynamische Injektion eines HBV-Expressionsplasmids pAAV/HBV1.2 in die Leber induziert. Dann werden HBV-Oberflächen-Ag-spezifische Maus-iPSC-CTLs adoptiv übertragen, was die HBV-Replikation in Leber und Blut stark unterdrückt und die HBV-Oberflächen-Ag-Expression in Hepatozyten verhindert. Diese Methode demonstriert die HBV-Replikation bei Mäusen nach hydrodynamischer Injektion und dass von Stammzellen abgeleitete virale Ag-spezifische CTLs die HBV-Replikation unterdrücken können. Dieses Protokoll bietet eine nützliche Methode für die HBV-Immuntherapie.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nach einer akuten Infektion kontrolliert das adaptive Immunsystem (d.h. die humorale und zelluläre Immunität) den Großteil der akuten HBV-bedingten Hepatitis. Dennoch können eine Reihe von Menschen in den HBV-endemischen Regionen die Viren nicht eliminieren und sich anschließend als chronische Individuen bekehren. Mehr als 25% der chronischen Patienten (>250 Millionen Menschen) weltweit entwickeln progressive Lebererkrankungen, die zu Leberzirrhose und/oder hepatozellulärem Karzinom (HCC)1führen. Infolgedessen bleibt die Tilgung von hartnäckig infizierten Zellen ein allgemeines Gesundheitsproblem, obwohl es einen verfügbaren Impfstoff2 gibt und zahlreiche antivirale Medikamente in der Entwicklung sind. Die Standardbehandlung bei HBV-Infektionen umfasst IFN-, Nukleosid- und Nukleotidanaloga. Diese Wirkstoffe haben direkte antivirale Aktivität und immunmodulatorische Kapazitäten. Dennoch tritt die Serokonversion von HBe-Antigen (Ag)+ Träger mit Anti-HBe-Antikörper (Ab) und Verlust von Serum HBV-Desoxyribonukleinsäure (DNA) bei etwa 20% der behandelten Patienten einzeln auf, und die gesamte immunologische Kontrolle des Virus durch den Entzug der HBsAg bestätigt wird, beträgt nicht mehr als 5%3. Darüber hinaus ist die Reaktion auf die Behandlung oft nicht haltbar. Die prophylaktische Impfung mit rekombinanten HBs Ag ist sehr wirksam bei der Vorbeugung von Infektionen, aber die therapeutische HBs Ag-Impfung ist nicht wirksam. Offensichtlich spielen T-Zell-vermittelte Immunantworten eine entscheidende Rolle bei der Kontrolle von HBV-Infektionen und Leberfunktionsstörungen; Bei chronischen Hepatitis-Patienten werden HBV-reaktive T-Zellen jedoch oft gelöscht, dysfunktional oder umwandlungsbehalts4,5,6umgewandelt. Folglich haben bei Personen mit anhaltender HBV-Infektion keine Versuche zur Wiedereinführung der HBV-spezifischen Immunität (d. h. t-zellbasierte Immunität) mittels antiviraler Mittel, immunmodulatorischer Zytokine oder kurativer Immunisierung Erfolg.

Der Adoptivzelltransfer (ACT) von HBV Ag-spezifischen T-Zellen ist eine effiziente Behandlung, die darauf abzielt, die verbleibenden Hepatozyten mit HBV7,8auszurotten. ES hat sich gezeigt, dass ACT von HBV-spezifischen CTLs bei HBV-infizierten Mäusen vorübergehende, milde Hepatitis und einen dramatischen Rückgang der HBV-Ribonukleinsäure-Transkripte (RNA) in Hepatozyten verursacht. In diesen Studien hemmten CTLs nicht die Transkription von HBV-Genen, sondern verbesserten den Abbau von HBV-Transkripten9. HBV-spezifische CTLs sind wichtig, um eine Virusinfektion zu verhindern und die Clearance von HBV10,11zu vermitteln. Für ACT-basierte Heilmittel wurde vorgeschlagen, eine ideale Methode12,13,14; Dennoch sind die derzeitigen Ansätze hinsichtlich ihrer Fähigkeit, geeignete Mengen und Qualitäten von HBV-spezifischen T-Zellen von Patienten für die potenziellen Therapien zu erzeugen, zu trennen und zu züchten, eingeschränkt.

Obwohl klinische Studien Sicherheit, Praktikabilität und prospektive therapeutische Aktivität zellbasierter Behandlungen durch technisch entwickelte T-Zellen darstellen, die spezifisch für HBV-virusinfizierte Hepatozyten sind, gibt es Bedenken über die ungünstigen Auswirkungen durch Autoimmunreaktionen aufgrund von Kreuzreaktivität durch Fehlkopplung des T-Zellrezeptors (TCR)15,16, off-target Ag-Erkennung durch unspezifische TCR17 und On-Target-Off-Toxizität durch einen chimeric Ag-Rezeptor (CAR) 18 , 19 mit gesundem Gewebe. Derzeit sind die gentechnisch veränderten T-Zellen, die nur eine kurzfristige Persistenz in vivo haben, in der Regel mittlere oder spätere Effektor-T-Zellen. Bislang sind pluripotente Stammzellen (PSCs) die einzige verfügbare Quelle, um eine hohe Anzahl naiver Ag-spezifischer Ag-spezifischer T-Zellen20,21,22,23zu erzeugen. Induzierte PSCs (iPSCs) werden einfach aus den somatischen Zellen eines Patienten durch die Verwendung der Gentransduktion mehrerer Transkriptionsfaktoren umgewandelt. Infolgedessen weisen die iPSCs ähnliche Eigenschaften auf wie embryonale Stammzellen (ESCs)24. Aufgrund der Flexibilität und Möglichkeit der unendlichen Fähigkeit zur Selbsterneuerung können neben dem Gewebeersatz auch iPSC-basierte Behandlungen in der regenerativen Medizin weit verbreitet sein. Darüber hinaus können die regiments zugrunde liegenden iPSCs aktuelle zellbasierte Therapien erheblich verbessern.

Das übergeordnete Ziel dieser Methode ist es, eine große Menge an HBV-spezifischen CTLs aus iPSCs (d. h. iPSC-CTLs) für die ACT-basierte Immuntherapie zu generieren. Die Vorteile gegenüber alternativen Techniken sind, dass HBV-spezifische iPSC-CTLs einen eintypigen TCR- und naiven Phänotyp haben, was zu mehr Speicher-T-Zellentwicklung nach der ACT führt. Es wird gezeigt, dass die ACT von HBV-spezifischen iPSC-CTLs die Migration von funktionellen CD8+ T-Zellen in der Leber erhöht und die HBV-Replikation sowohl in der Leber als auch im Blut von verabreichten Mäusen reduziert. Diese Methode zeigt eine mögliche Verwendung von viralen Ag-spezifischen iPSC-CTLs für die HBV-Immuntherapie und kann angepasst werden, um andere virale Ag-spezifische iPSC-T-Zellen für die virale Immuntherapie zu erzeugen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle Tierversuche sind vom Texas A&M University Animal Care Committee (IACUC; #2018-0006) zugelassen und werden in Übereinstimmung mit den Richtlinien der Association for the Assessment and Accreditation of Laboratory Animal Care durchgeführt. Mäuse werden im Alter von 6 bis 9 Wochen verwendet.

1. Erzeugung viraler Ag-spezifischer CD8+ T-Zellen aus iPSCs (iPSC-CD8+ T-Zellen)

  1. Erstellung der retroviralen Konstrukte
    HINWEIS: TCR- und -Gene sind mit einer 2A-Selbstverklassungssequenz verknüpft. Der retrovirale Vektor MSCV-IRES-DsRed (MiDR) ist DsRed+ 23.
    1. Subklon-HBs183-191 (FLLTRILTI)-spezifische A2-beschränkte Human-Murine-Hybrid-TCR-Gene (s183 TCR) in die MiDR, um das s183 MiDR-Konstrukt zu erstellen (Abbildung 1A)25.
  2. Retrovirale Transduktion
    HINWEIS: Die Platinum-E (Plat-E) Zellen werden zur Verpackung von Retroviren (mit s183 TCR-Genen) verwendet, die für die retrovirale Transduktion verwendet werden. Die Plat-E-Zellen sind eine effektive Retrovirus-Verpackungszellen, die den 293T-Zellen zugrunde liegen und die mit Hilfe einzigartiger Verpackungskonstrukte über den EF1-Promotor entwickelt wurden, um retrovirales Strukturprotein wie Knebel, Pol und ökotropen Env auszudrücken.
    1. Auf einer 100 mm Kulturschale 3 x 106 Plat-E-Zellen in 8 ml DMEM-Kulturmedium, das 10% fetales Kalbsserum (FCS) enthält, in einem Inkubator bei 37 °C mit 5%CO2, 1 Tag vor der Transfektion.
    2. Transfect das s183 MiDR-Konstrukt am 0. Tag mit einem DNA-Transfektionsreagenz25in die Plat-E-Zellen.
    3. Am ersten Tag 1 x 106 iPSCs (GFP+) in eine gelatinevorbeschichtete Kulturplatte.
    4. Sammeln Sie an den Tagen 2–3 retrovirenhaltige Überstande aus der Plat-E-Zellkultur, um iPSCs mit dem s183 TCR in Gegenwart von 1,6-Dibromohexan-Lösung25zu transducen.
    5. Am 4. Tag versuchen Sie die s183 TCR gentransduzierten iPSCs, Zentrifuge bei 400 x g für 5 min und Samen 3 x 105 iPSCs in einer 100 mm Kulturschale vorbeschichtet mit 3 x 106 bestrahlten SNL76/7 (irSNL76/7) Feederzellen25.
    6. An Tag 5 oder 6 des Zusammenflusses, Trypsinisieren sie die Zellen, Zentrifuge bei 400 x g für 5 min und Prozess für die Zellsortierung. Gating auf lebenden Zellen, sortieren GFP und DsRED Doppel-positive Zellen (die s183 TCR Gen-transduced iPSCs) mit einem High-Speed-Zellsortierer. Ähnlich wie Schritt 1.2.5, ko-Kultur der sortierten Zellen auf irSNL76/7 Feeder-Zellen für die zukünftige Verwendung25.
  3. Differenzierung von HBV-spezifischen iPSC-CD8+ T-Zellen
    HINWEIS: Die OP9-DL1/DL4 Stromalzellen überexpressen sowohl Notch Liganden DL1 als auch DL4 und co-culturing iPSCs mit den iPSCs können Notch-signalvermittelte T-Zelldifferenzierung26fördern.
    1. Wachsen Sie s183 TCR-Gen-transduced iPSCs (s183/iPSCs) in der OP9-DL1-DL4-Zellmonolayer in meM-Mindestmedium (MEM) Medien, die 20% fetales Rinderserum (FBS)27enthalten. Fügen Sie murineflinen Flt3-Ligand (mFlt-3L; Endkonzentration = 5 ng/ml) in die Kultur ein.
    2. Am Tag 0, Samen 0,5–1,0 x 105 S183/iPSCs in einer 10 cm Kulturschale, die zuvor mit OP9-DL1-DL4-Zellen angebaut wurde. Überprüfen Sie, ob sich die OP9-DL1-DL4-Zellen in einem Zustand von 80 % bis 90 % Konfluenz befinden.
    3. Am 5. Tag die iPSCs mit 10 ml Phosphat-gepufferter Saline (PBS) abspülen, von der PBS absaugen, auf 4 ml 0,25% Trypsin auffügen und 10 min in einem 37 °C-Inkubator inkubieren. Danach fügen Sie zusätzliche 8 ml iPSC-Medien hinzu, um die Trypsin-Verdauung zu beenden. Akkumulieren Sie alle Verdauungslösungen, die die Zellen und zentrifugen bei 400 x g enthalten, für 5 min bei 15–30 °C.
    4. Aspirieren Sie den Überstand und setzen Sie Zellen in 10 ml iPSC-Medien wieder aus. Die Zellsuspension auf eine neue 10 cm Petriplatte übertragen und 30 min bei 37 °C in einem Inkubator brüten.
    5. Nach 30 min sammeln Sie die iPSC-Medien, die die schwimmenden Zellen enthalten. Passieren Sie die Zellsuspension durch ein 70-m-Zellsieb und berechnen Sie die Zellzahl.
    6. Samen 5 x 105 Zellen in der Kulturschale zuvor gezüchtet OP9-DL1-DL4-Zellen mit einem Zustand von 80%–90% Konfluent, wie in Schritt 1.3.1 beschrieben.
      HINWEIS: Für die T-Zelldifferenzierung müssen die iPSC-abgeleiteten Zellen alle 2 bis 3 Tage mit einer frischen Schicht der OP9-DL1-DL4-Zellen neu aussaat.
  4. schätzung
    1. Morphologische Veränderungen der Differenzierung von iPSCs
      1. Beobachten Sie Zellen unter dem Mikroskop an verschiedenen Tagen.
        HINWEIS: Am 5. Tag weisen Kolonien mesodermähnliche Eigenschaften auf, die eine klassische Spindelform-Morphologie aufweisen, die menschlichen dermalen Fibroblasten und nachhaltigem Wachstum in vitro ähnelt. Am 8. Tag beginnen kleine runde Zellhaufen zu erscheinen.
    2. Analyse der Differenzierung von iPSCs durch Durchflusszytometrie
      1. Analysieren Sie an verschiedenen Tagen der Kokultur iPSC-abgeleitete Zellen, wie zuvor beschrieben25 (Abbildung 1B,C).
    3. Funktionelle Analyse von differenzierenden iPSCs
      1. Am 28. Tag der Kokultur iPSC-CD8+ T-Zellen aus Kulturen durch Ernte der schwimmenden Zellen sammeln, die übrig gebliebenen Zellen mit 0,25% Trypsin versuchen, in 8 ml iPSC-Medien wieder aussetzen, Zentrifuge für 5 min bei 400 x g bei 15–30 °C entfernen, dann die Zellen in 10 ml Medien wieder aussetzen.
      2. Bewahren Sie die wieder aufgehängten Zellen 30 min in einer frischen 10 cm Schale in einem 37 °C-Inkubator auf und montieren Sie die schwimmenden Zellen. Dann spülen Sie die Zellen einmal mit einem kalten PBS.
      3. Inkubieren Sie 3 x 106 T zellerschöpfte Splenozyten (CD4-CD8-) aus Milz der H-2-Klasse I Knockout, HLA-A2.1-transgenen (HHD) Mäusen mit 5 'M183 Peptid (FLLTRILTI) in 200 l Medien bei 4 °C für 30 min.
      4. Produzieren Sie eine Mischung aus iPSC-CD8+ T-Zellen mit Splenozyten gepulst mit s183 Peptid (T-Zellen: Splenozyten = 1:4; verwenden 0,75 x 106 T-Zellen). Inkubieren Sie das Zellgemisch bei 37 °C in einemCO2-Inkubator für 40 h. Während der letzten 7 h 4 l verdünntes Brefeldin A in die Kultur (Endkonzentration von 1.000x, die in 1x Kulturmedien verdünnt wird) hinzufügen, um Transportprozesse während der Zellaktivierung zu blockieren.
      5. Stainieren Sie die Zellen und führen Sie die zytometrische Analyse des intrazellulären IFN-A durch, wie zuvor beschrieben (Abbildung 2).

2. Induktion der HBV-Replikation durch hydrodynamische Abgabe von HBV-Plasmid

HINWEIS: pAAV/HBV1.2-Konstrukt wurde wie zuvor beschrieben9erzeugt. Die hBV 1.2 vollständige DNA ist in den Vektor pAAV integriert.

  1. Hydrodynamische Lieferungen von HBV-Plasmid durch die Schwanzvene
    1. Erhitzen HHD-Mäuse mit einer Wärmelampe für 5 min im Käfig, um die Schwanzvene zu verdünnen.
    2. Halten Sie das Tier mit einem Restrainer fest und reinigen Sie Diepfänsweite mit 70% Ethanolspray.
    3. Lieferung von Plasmid in die Leber.
    4. Messen Sie das Körpergewicht der Maus mithilfe einer Messskala.
    5. Verdünnen Sie 10 g HBV-Plasmid im 8%-Äquivalent der Körpermasse PBS (z. B. 1,6 ml für eine 20 g Maus). Verdünntes Plasmid in eine 3 ml Spritze mit einer hypodermischen Nadel von 26 G x 1x2" (0,45 x 12 mm) laden.
    6. Suchen Sie eine der beiden seitlichen Schwanzvenen im mittleren Drittel des Schwanzes und positionieren Sie die Nadel in eine der beiden seitlichen Venen. Verabreichen Sie die Injektion, die HBV-Plasmid durch die Schwanzvene enthält, innerhalb von 3 - 5 s.
  2. Quantifizierung der Virämie aus dem Blutserum infizierter Mäuse
    HINWEIS: Die HBV-Replikation erfolgt vom 3. bis 35. Tag im Mausserum. Die DNA-Replikation erreicht ihren Höhepunkt an Tag 7 und reduziert sich schrittweise. Die HBV-DNA wird erst am 35. Tag aus dem Serum entfernt.
    1. Entnahme von Blutserum von infizierten Mäusen
      1. Sammeln Sie etwa 0,1 ml Blut in einem Mikrozentrifugenrohr von jeder Maus auf 3, 5, 7 und 10 Tage nach der Infektion durch retro-orbitale Blutung in einem 1,5 ml Mikrozentrifugenrohr, dann bei Raumtemperatur (RT) für 20 min inkubieren.
      2. Zentrifugieren Sie die Probe bei 6.000 x g für 15 min bei 4 °C und sammeln Sie den Serum-Überstand nach der Zentrifugation.
    2. Reinigen Sie die DNA aus dem Blutserum mit einem handelsüblichen DNA-Extraktionskit nach den Empfehlungen des Herstellers. Kurz gesagt, lysieren Sie die Zellen in einer Kieselsäure-basierten Spalte, führen Sie die Waschen durch und extrahieren Sie DNA, indem Sie der Elutionssäule 100% Ethanol hinzufügen und bei 6000 x g für 1 min zentrifugieren. Elute die DNA in 50 l RNase-freiem Wasser.
    3. Verwenden Sie 100 ng HBV-DNA aus der Elution für die Echtzeit-PCR-Analyse. Verwenden Sie die folgenden Primer und Sonden: vorwärts 5' TAGGAGGCTGTAGGCATAAATTGG 3'; Rückseite 5' GCACAGCTTGGAGGCTTGT 3'; Sonde 5' TCACCTCTGCCTAATC 3'.
      1. Verwenden Sie das Plasmaid (pAAV/HBV1.2) für die Standardkurve und führen Sie die Echtzeit-PCR in einem Gesamtvolumen von 10 l aus (Abbildung 3).
    4. Richten Sie die PCR-Reaktion in einem Gesamtvolumen von 10 l ein, wie in Tabelle 1dargestellt.
    5. Richten Sie das PCR-Programm im Thermocycler ein, wie in Tabelle 2dargestellt. Die programmierte Temperaturübergangsrate beträgt 20 °C/s für Denaturierung/Glühen und 5 °C/s für die Verlängerung. Messen Sie die Fluoreszenz am Ende der Glühphase für jeden Zyklus für die Echtzeit-PCR-Überwachung.

3. Reduktion der HBV-Replikation durch ACT viraler Ag-spezifischer iPSC-CD8+ T-Zellen

  1. Adoptivzellübertragung (ACT)
    1. Differenzieren Sie s183/iPSCs (1.3.7) auf den OP9-DL1-DL4 Stromalzellen in Gegenwart von mFlt-3L und mIL-7 für 8 Tage, wie in Abschnitt 1.3 beschrieben.
    2. Am 22. Tag iPSC-CD8+ T-Zellen von der 10 cm Platte mit Trypsin sammeln, dann jede 10 cm Platte in 10 ml Frischmedien waschen und wieder aufhängen. Fügen Sie die Zellen zu einer frischen 10 cm Platte hinzu und kehren Sie für 30 min in den Inkubator zurück, wie in Abschnitt 1.3 geschehen. Nach 30 min, schwimmende Zellen sammeln.
    3. Verwenden Sie ein 70 m Nylonsieb, um Zellen zu übergeben, um Zellcluster zu eliminieren und die Zellzahl zu zählen. Passen Sie die Zellen an eine Konzentration von 1,5 x 107 Zellen/ml in kalter PBS-Lösung an und verwenden Sie ein 70 m Nylon-Sieb, um Zellen zu passieren, um Zellcluster bei Bedarf wieder zu eliminieren. Halten Sie Zellen auf Eis, bis die ACT.
    4. Injizieren Sie 200 L Zellsuspension (3 x 106 Zellen) in 4-6 Wochen alte HHD-Mäuse durch die Schwanzvene.
  2. Induktion der HBV-Replikation
    1. Führen Sie am 14. Tag nach der Zellübertragung die hydrodynamische Abgabe von HBV-Plasmid durch die Schwanzvene durch, wie in Abschnitt 2.1 beschrieben.
  3. Virusprotein-Erkennung von infizierter Leber
    1. Opfern Sie Mäuse an den Tagen 3, 5, 7, 14 und 21 nach der Infektion. Für die Euthanasie verwenden Sie in jedem Käfig in der ersten Stufe 1–2 L Kohlendioxid (CO2). Wenn das Tier den Bewusstseinsverlust entwickelt, gewinnen Sie die CO2-Durchflussrate um 4–5 L/min. Führen Sie Maus-Euthanasie mitCO2-Inhalation durch.
    2. Trennen Sie die Leber, indem Sie die Oberflächenhaut des Peritoneums mit Schere und Zange schneiden und die Leber leicht zurückziehen, um die innere Haut zu entdecken, die die Peritonealhöhle auskundschaften. Sammeln und schneiden Sie Leberproben (Länge x Breite x Höhe = 0,5 cm x 0,5 cm X 0,3 cm) der infizierten Mäuse, um leicht in die Einbettkassette zu passen und in 10% neutralem Puffer formalin für 4–24 h zu blocken.
    3. Entkalkung der Leberproben mit 2,5 M Ameisensäure; In Xylol für 3 min abspülen, 2x in 100% Ethanol ausspülen, 2x in 95% Ethanol ausspülen, 2x in deionisiertem (DI) Wasser für 2 min ausspülen und dann die Leberproben in 1 mM Ethylendiamintetraessigsäure (EDTA) entsprechend entkalken. Bei einer Untersiedetemperatur (90 °C) 20 min verarbeiten.
    4. Kühlen Sie das feste Lebergewebe für 30 min. Spülen Sie das Gewebe mit 1x PBS für 4 min und betten Sie das Gewebe in Paraffin ein. Dehydrieren Sie das Gewebe in einer Reihe von zunehmenden Konzentrationen von Ethanol, um das Wasser zu ersetzen, und tauchen Sie dann in Xylol-Eintauchen ein. Einbetten der infiltrierten Gewebe in Wachsblöcke. Machen Sie gleichmäßig vertikale und horizontale Schnitte für die Färbung. Bereiten Sie 4 m Abschnitte mit einem gleitenden Mikrotom vor.
    5. Passieren Sie die Abschnitte durch die Deparaffinierung und Rehydratation mit Xylol und Ethanol, dann führen Sie immunfluoreszierende Färbung der Abschnitte durch.
    6. Beflecken Sie die Abschnitte mit 200 l HBV-Oberflächen-Ag-spezifischen Antikörpern (1:100 Verdünnung in der Blockierlösung). Inkubieren Sie die Abschnitte mit dem Antikörper für 2 h bei RT in einer 75%–100% befeuchteten Kammer und waschen Sie 5x in 1x PBS für 5 min.
    7. Verwenden Sie ein Anti-Fade-Reagenz, das 4',6-Diamidino-2-Phenylindole (DAPI) zur nuklearen Färbung enthält, um die Dias zu verfärben. Fügen Sie den Deckzettel mit ca. 300 l der verdünnten DAPI-Färbelösung (300 nM in 1x PBS) hinzu und validieren Sie den gesamten abgedeckten Deckschein. Halten Sie die Dias bei 4 °C bis zur Inspektion unter einem Fluoreszenzmikroskop im Dunkeln.
  4. Entzündliche Zellinfiltration bei infizierten Mäusen
    1. Opfermäuse, wie in Schritt 3.3.1 beschrieben. Sammeln Sie die Leber und machen Abschnitte, wie in Schritt 3.3.4 beschrieben.
    2. Färben Sie den Abschnitt mit Hämatoxylin und Eosin (H&E), um die Infiltration von Entzündungszellen in die Leber zu bewerten.
    3. Dias im Dunkeln bei 4 °C lagern, bis weitere Analysen unter einem Fluoreszenzmikroskop durchgeführt werden.
    4. Visualisieren Sie Dias unter einem Fluoreszenzmikroskop, um das Eindringen von Entzündungszellen in die Leber zu erkennen (Abbildung 4).
  5. HBV DNA-Nachweis infizierter Leber
    1. Isolierung der viralen DNA.
    2. Euthanisieren Sie Mäuse und sammeln Sie die Leberproben gemäß Abschnitt 3.3.
    3. Lyse die Lebergewebe in Nonindet P-40 (NP-40) Lyse Puffer (50 mM Tris-HCL, 1 mM EDTA, 1% NP-40) enthält einen Protease-Hemmer-Cocktail.
    4. Kurz Zentrifugieren bei 16.000 x g, um die Kerne und Zellablagerungen zu entfernen.
    5. Inkubieren Sie das zytoplasmatische Lysat mit mikrokokkaler Nuklease (Nuklease S7; 150 Einheiten/ml) und CaCl2 (5 mM) bei 37 °C für 90 min, um die Nukleinsäure außerhalb der Nukleocapsiden (NCs) zu abbauen.
    6. Inaktivieren Sie die Nuklease S7 durch Zugabe von 10 mM EDTA.
    7. Die Nukleocapsiden mit Polyethylenglykol (PEG) ausfälten, um 0,5% Natriumdodecylsulfat (SDS) stören und mit 0,6 mg/ml Proteinase K (PK) bei 37 °C für 1 h verdauen.
    8. Die viralen Nukleinsäuren durch Phenolchloraformextraktion und Ethanolfällung wiederherstellen.
    9. Lösen Sie die extrahierte virale DNA auf einem 1,2%igen Agaro-Gel und erkennen Sie durch Standard-Southern-Blot-Analyse mit einer32 P-markierten HBV-DNA-Sonde.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Wie hier gezeigt, werden HBV-virale Ag-spezifische iPSC-CD8+ T-Zellen durch ein In-vitro-Kultursystem erzeugt. Nach ACT dieser viralen Ag-spezifischen iPSC-CD8+ T-Zellen unterdrücken hBV-Replikation in einem murinen Modell (Supplemental File 1). Maus iPSC werden mit dem MIDR retroviralen Konstrukt transduziert, das ein Human-Maus-Hybrid-HBV-TCR-Gen kodiert (HBs183-191-spezifisch,s183), dann werden die gentransduzierten iPSCs mit OP9-DL1/DL4-Zellen kokulturiert, die Notchligaden (sowohl DL1 als auch DL4) exdrücken. Moleküle in Gegenwart von rFlt3L und rIL-7. Am 28. Tag der In-vitro-Co-Kultur exprimieren die iPSC-abgeleiteten Zellen im Wesentlichen CD3 und Ag-spezifische TCR (T-Zellmarker). Die zytometrische Analyse der CD3+CD8+ Population zeigt, dass die HBV-TCR-Transduktion die Erzeugung viraler s183-spezifischer CD8+ T-Zellen drastisch erhöht (Abbildung 1).

Am 28. Tag der In-vitro-Cokultur werden die CD4-CD8+ single-positive (SP) iPSC-CD8+ T-Zellen isoliert und durch T-depleted Splenocytes stimuliert, die mit s183 Peptid gepulst werden, und die Zytokinproduktion wird bewertet. Die iPSC-CTLs produzieren große Mengen an IL-2 und IFN-, wie sie durch intrazelluläre Färbung oder ELISA nachgewiesen werden (Abbildung 2). Die HBV-Infektion wird bei transgenen HLA-A2.1-Mäusen durch hydrodynamische Injektion von 10 g pAAV/HBV1.2 DNA-Plasmid durch die Schwanzvenen von Mäusen induziert. Die HBV-Replikation wird vom Tag 3 bis 21 im Serum von HHD-Mäusen nachgewiesen. Die DNA-Replikation erreicht am 6. Tag ihren Höhepunkt und reduziert sich schrittweise durch Die Verwendung einer Echtzeit-PCR-Analyse (Abbildung 3).

Zwei Wochen nach der ACT werden Mäuse mit einer hydrodynamischen Injektion von pAAV/HBV1.2 DNA-Plasmid herausgefordert. Der virale Titer wird durch Echtzeit-PCR aus Serum zu verschiedenen Zeitpunkten nach der Injektion gemessen. Die Ergebnisse zeigen, dass die Virusreplikation bei den Mäusen, die HBV-virale Ag-spezifische T-Zellen erhalten, zu allen Zeitpunkten signifikant reduziert wird, verglichen mit den Mäusen, die Kontrollzellen erhalten (Abbildung 4A). HBV-Oberflächenproteinexpression wird auch in der Leber in der oben genannten Einstellung der Behandlung untersucht. Mäuse werden an verschiedenen Tagen nach der HBV-Injektion eingeschläfert und die Leberproben zur histologischen Untersuchung isoliert. Die Proben werden für HBV-Oberflächenproteine gebeizt und unter einem Fluoreszenzmikroskop untersucht. HBV-Oberflächenprotein wird bei den Mäusen, die HBV-spezifische Ag-spezifische Vor-iPSC-CTLs erhalten, im Vergleich zu den Mäusen, die Kontrollzellen erhalten, erheblich verringert (Abbildung 4B). Dieses Experiment zeigt deutlich, dass virale Ag-spezifische iPSC-CD8+ T-Zellen in der Lage sind, die HBV-Replikation im murinen Modell zu reduzieren.

Figure 1
Abbildung 1: Erzeugung von HBV-viralen Ag-spezifischen iPSC-CD8+ T-Zellen.
Maus-iPSCs werden mit den folgenden retroviralen Konstrukten transduziert: HBs183-91 TCR (MiDR-s183 TCR) oder OVA257–264 TCR (MiDR-OVA TCR), und die transduced iPSCs werden mit OP9-DL1/DL4 Stromalzellen zur T-Liniendifferenzierung kokultiviert. (A) Schematische Darstellung des retroviralen Konstrukts MiDR-s183 TCR, das s183-spezifische TCR ausdrückt. • = Verpackungssignal; 2A = Picornavirus selbstklebende 2A-Sequenz; LTR = lange Klemmenwiederholungen. (B) Morphologie der T-Zelldifferenzierung an den Tagen 0, 7, 14 und 22. (C) Flusszytometrische Analyse für die iPSC-abgeleiteten Zellen am 28. Tag. CD3+CD8+ Zellen (links) werden wie angegeben abgegrenzt und für die Expression von CD8 und TCRV-28 (rechts) analysiert. Die gezeigten Daten sind repräsentativ für drei Einzelexperimente. Die Werte stellen den Mittelwert sD (**p < 0,01; gepaarte t-Tests) dar. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: Funktionelle Analyse der HBV-viralen Ag-spezifischen iPSC-CD8+ T-Zellen.
Am 28. Tag der In-vitro-Kokultur werden die SP CD8+s183 TCR Pentamer+ iPSC-T Zellen sortiert. Die mit MiDR-s183 TCR transduzierten iPSC-T-Zellen und CD8+ T-Zellen werden durch T-depleted Splenocytes (APCs) von HHD-Mäusen stimuliert und mit s183-Peptid (FLLTRILTI) gepulst. (A) Intrazelluläre Färbung von IFN-A nach 7 h (auf CD8+ Zellen gezerstäubt) (T/APCs = 1:4). (B) ELISA von IFN--A nach 40 h. Die gezeigten Daten sind repräsentativ für drei Einzelexperimente. Die Werte stellen den Mittelwert sD (n.s., p > 0,05; gepaarte t-Tests) dar. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3: Induktion der HBV-Replikation bei HHD-Mäusen durch hydrodynamische Injektion.
HHD-Mäuse werden i.v. mit HBV-Plasmid mittels hydrodynamischer Schwanzveneninjektion verwaltet. 10 g des Plasmids werden mit 8% der gesamten Körpermasse PBS injiziert. Bei angegebenen Zeitpunkten nach der Injektion wird das Serum aus dem Blut isoliert und DIE DNA für die Echtzeit-PCR extrahiert. Die gezeigten Daten sind repräsentativ für drei Einzelexperimente. Die Werte stellen den Mittelwert sD dar. Die Daten sind repräsentativ für fünf Mäuse pro Gruppe von drei unabhängigenExperimenten. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4: Reduktion der HBV-Replikation durch ACT viraler Ag-spezifischer iPSC-CD8+ T-Zellen.
HHD-Mäuse werden i.v. mit viralen Ag-spezifischen iPSC-CD8+ T-Zellvorläufern (am 22. Tag der In-vitro-Kultur) übertragen und in Woche 2 nach dem Zelltransfer mit HBV-Plasmid verwaltet. (A) Serum HBV-Kopien. An den angegebenen Zeitpunkten nach der Injektion wird Serum aus Blut isoliert und DNA für die Echtzeit-PCR-Analyse extrahiert. Die gezeigten Daten sind repräsentativ für drei Einzelexperimente. Die Werte stehen für den Mittelwert sD. (B) Lebergewebe-Histologie. Mäuse werden am Tag 8 nach der HBV-Infektion eingeschläfert. Leberproben werden isoliert und für die histologische Untersuchung gefärbt. Das obere Panel zeigt die HBsAg-Proteinexpression bei infizierten Mäusen (IHC-Färbung) und das untere Panel zeigt die entzündliche Zellinfiltration (HE-Färbung). Die Daten sind repräsentativ für fünf Mäuse pro Gruppe von drei unabhängigen Experimenten. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

DNA-Vorlage 2 ml
DNA-Master-Hybridisierungsgemisch ((Taq-DNA-Polymerase, PCR-Reaktionspuffer, 10 mM MgCl2 und dNTP-Gemisch) 1 ml
25 mM MgCl2 0,8 ml
0,3 m die Sonde 3 ml
5 m pro Primer 3,2 ml
gesamt 10 ml

Tabelle 1: PCR-Reaktionsvolumen

temperatur zeit
Denaturierung 95 °C 5 s
Glühen 53 °C 10 s
anbau 72 °C 20 s
5 °C

Tabelle 2: PCR-Programm

Ergänzende Datei 1: Bitte klicken Sie hier, um diese Datei herunterzuladen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dieses Protokoll stellt eine Methode zum Generieren der viralen Ag-spezifischen iPSC-CTLs zur Verwendung als ACT zur Unterdrückung der HBV-Replikation in einem murinen Modell dar. Bei chronischer HBV-Infektion bildet das virale Genom ein stabiles Mini-Chromosom, die kovalent geschlossene kreisförmige DNA (cccDNA), die über die gesamte Lebensdauer des Hepatozyten bestehen kann. Die gezielte Clearance des viralen Mini-Chromosoms kann zu einer Heilung der chronischen HBV-Infektion führen. Die aktuelle antivirale Therapie zielt auf die Virus-Reverse-Transkriptase ab, etabliert aber selten eine immunologische Kontrolle über die HBV-Replikation, die von cccDNA angetrieben wird. HBV-spezifische CD8+ CTLs können die Tötung der infizierten Hepatozyten vermitteln und die Clearance von cccDNA beschleunigen. Dennoch werden die HBV-spezifischen CTLs bei Patienten mit chronischer HBV-Infektion gelöscht, dysfunktional oder erschöpfunger. ACT mit den HBV-spezifischen CTLs ist eine günstige Behandlung für chronische HBV-Infektionen28,29. Naives oder zentrales Gedächtnis T-Zell-abgeleitete T-Lymphozyten (d. h. hochreaktive Immunzellen) sind aufgrund ihrer großen Proliferation, einer geringeren Todesneigung im Vergleich zu endlos differenzierten Zellen und exzellenten Fähigkeit, auf panostatische Zytokine zu reagieren. Eine solche ACT war jedoch oft nicht durchführbar, da es schwierig war, eine ausreichende Anzahl von CTL von Patienten zu erhalten. Es wurde bereits gezeigt, dass die Umprogrammierung von Ag-spezifischen CTLs oderT-Regs von iPSCs für zellbasierte Therapien20,23,27,30verwendet werden kann. Dieser Bericht zeigt eine Methode zur Generierung viraler Ag-spezifischer iPSC-CTLs und zur Verwendung dieser Zellen für die ACT-basierte Immuntherapie in einem murinen Modell der HBV-Replikation.

Obwohl es transgene Mausmodelle der HBV-Replikation gibt, sind diese Modelle eine Herausforderung, da die zentrale Toleranz, die durch die transgenen Genprodukte induziert wird, dazu führt, dass Mäuse immuntolerant gegenüber HBV Ags sind. Darüber hinaus sind transgene Mäuse nicht für die Überwachung der viralen Clearance geeignet, da das integrierte HBV-Genom in jeder Mauszelle31,32fortbesteht. Trotz dieser erfolgreichen Impfstoffe zur Vorbeugung der Infektion wurde die Behandlung oder Immuntherapie nach HBV-Infektion nicht entwickelt. Darüber hinaus wurden die experimentellen Ansätze zur HBV-Pathogenese behindert, da der Wirtsbereich der HBV-Infektion auf Männer und Schimpansen beschränkt ist und das In-vitro-Kultursystem zur Ausbreitung von HBV nicht ausreicht. CD8+ T-Zellen sind vielversprechende Effektorzellen gegen verschiedene Arten von Virusinfektionen; Jedoch, T-Zell-Antwort gegen HBV ist nicht reichlich vorhanden. Spezifität, Funktion und Mangel an ausreichenden Zahlen, um eine Immunantwort zu montieren, können die Ursache sein. Dieser Bericht zeigt die Methode der hydrodynamischen Injektion, die effizient hBV-Replikation bei Mäusen induziert. Die Methode ermöglicht die Abgabe einer großen Menge von HBV-Plasmid direkt in die Leber. Das Modell zeigt kontinuierliche Virämie für mehr als 8 Wochen mit Nachweis von HBV mRNA, Protein, und DNA an verschiedenen Tagen nach der Injektion. Diese Methode zur HBV-Replikation bei Mäusen ist für die HBV-Immuntherapie nützlich.

Zusammenfassend wurde die HBV-Replikation bei Mäusen erfolgreich durch hydrodynamische Injektionsverfahren induziert, und virale Ag-spezifische iPSC-CTLs wurden als Immuntherapie für die HBV-Replikation eingesetzt. Es gibt jedoch zwei Einschränkungen der Methode: (1) mehr als drei Wochen In-vitro-T-Zell-Differenzierung können die translationalen Anwendungen der erzeugten T-Zellen für ACT reduzieren; und (2) HBV hydrodynamische Injektion kann effizient HBV-Replikation in der Leber induzieren; Es bildet jedoch nicht die cccDNA, was der Hauptgrund für die anhaltende HBV-Infektion ist. Dennoch bietet die Methode einen alternativen Ansatz für die HBV-Replikation und -Behandlung. Ein Kombinationsschema mit Anti-HBV-Medikamenten und der ACT von viralen Ag-spezifischen iPSC-CTLs ist wahrscheinlich, um HIV-Reservoirs zu reduzieren, was zu einer Therapie für chronische HIV-Infektionen führt.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu verraten.

Acknowledgments

Die Autoren danken Dr. Adam J Gehring vom Toronto General Hospital Research Institute für die Bereitstellung von cDNA für HBs183-91 (s183) (FLLTRILTI)- spezifische A2-beschränkte human-murine Hybrid-TCR-Gene, und Dr. Pei-Jer Chen von der National Taiwan University für die Bereitstellung pAAV/HBV 1.2 Konstrukt. Diese Arbeit wird vom National Institute of Health Grant R01AI121180, R01CA221867 und R21AI109239 an J. S. unterstützt.

Materials

Name Company Catalog Number Comments
HHD mice Institut Pasteur, Paris, France H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice
iPS-MEF-Ng-20D-17 RIKEN Cell Bank APS0001
SNL76/7 ATCC SCRC-1049
OP9 ATCC CRL-2749
pAAV/HBV1.2 plasmid Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan) HBV DNA construct
HBs183-91(s183) (FLLTRILTI)-specific TCR genes Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada) FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (Vα34 and Vβ28)
OVA257–264-specific TCR genes Dr. Dario A. Vignali (University of Pittsburgh, PA) SIINFEKL-specific H-2Kb-restricted TCR genes
Anti-CD3 (17A2) antibody Biolegend 100236
Anti-CD44 (IM7) antibody BD Pharmingen 103012
Anti-CD4 (GK1.5) antibody Biolegend 100408
Anti-CD8 (53-6.7) antibody Biolegend 100732
Anti-IFN-γ (XMG1.2) antibody Biolegend 505810
Anti-TNF-a (MP6-XT22) antibody Biolegend 506306
α-MEM Invitrogen A10490-01
Anti-HBs antibody Thermo Fisher MA5-13059
ACK Lysis buffer Lonza 10-548E
Brefeldin A Sigma B7651
DMEM Invitrogen ABCD1234
FBS Hyclone SH3007.01
FACSAria Fusion cell sorter BD 656700
Gelatin MilliporeSigma G9391
GeneJammer Agilent 204130
HLA-A201-HBs183-91-PE pentamer Proimmune F027-4A - 27
HRP Anti-Mouse Secondary Antibody Invitrogen A27025
mFlt-3L Peprotech 250-31L
mIL-7 Peprotech 217-17
Nuclease S7 Roche 10107921001
Paraformaldehyde MilliporeSigma P6148-500G Caution: Allergenic, Carcenogenic, Toxic
Permeabilization buffer Biolegend 421002
Polybrene MilliporeSigma 107689
ProLong™ Gold Antifade Mountant with DAPI Invitrogen P36931
QIAamp MinElute Virus Spin Kit Qiagen 57704

DOWNLOAD MATERIALS LIST

References

  1. Scaglione, S. J., Lok, A. S. Effectiveness of hepatitis B treatment in clinical practice. Gastroenterology. 142, (6), 1360-1368 (2012).
  2. Osiowy, C. From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity. Human Vaccines & Immunotherapeutics. 14, (8), 2093-2097 (2018).
  3. Gish, R. G., et al. Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B. Journal of Viral Hepatitis. 17, (1), 16-22 (2010).
  4. Kurktschiev, P. D., et al. Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction. Journal of Experimental Medicine. 211, (10), 2047-2059 (2014).
  5. Fisicaro, P., et al. Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B. Gastroenterology. 138, (2), 682-693 (2010).
  6. Schurich, A., et al. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathogens. 9, (3), 1003208 (2013).
  7. Gehring, A. J., et al. Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines. Journal of Hepatology. 55, (1), 103-110 (2011).
  8. Xia, Y., et al. Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis. Gastroenterology. 150, (1), 194-205 (2016).
  9. Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection. Proceedings of the National Academy of Sciences U.S.A. 103, (47), 17862-17867 (2006).
  10. Wong, P., Pamer, E. G. CD8 T cell responses to infectious pathogens. Annual Review of Immunology. 21, 29-70 (2003).
  11. Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. Dynamics of hepatitis B virus clearance in chimpanzees. Proceedings of the National Academy of Sciences USA. 102, (49), 17780-17785 (2005).
  12. Hinrichs, C. S., et al. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proceedings of the National Academy of Sciences U.S.A. 106, (41), 17469-17474 (2009).
  13. Hinrichs, C. S., et al. Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy. Blood. 117, (3), 808-814 (2011).
  14. Kerkar, S. P., et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. Journal of Immunotherapy. 34, (4), 343-352 (2011).
  15. Kuball, J., et al. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood. 109, (6), 2331-2338 (2007).
  16. van Loenen, M. M., et al. Mixed T cell receptor dimers harbor potentially harmful neoreactivity. Proceedings of the National Academy of Sciences USA. 107, (24), 10972-10977 (2010).
  17. Cameron, B. J., et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Science Translational Medicine. 5, (197), (2013).
  18. Fedorov, V. D., Themeli, M., Sadelain, M. PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses. Science Translational Medicine. 5, (215), (2013).
  19. Maus, M. V., et al. T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunolology Research. 1, (1), 26-31 (2013).
  20. Haque, R., et al. Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity. Journal of Immunology. 189, (3), 1228-1236 (2012).
  21. Vizcardo, R., et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 12, (1), 31-36 (2013).
  22. Nishimura, T., et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 12, (1), 114-126 (2013).
  23. Lei, F., et al. In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance. Cancer Research. 71, (14), 4742-4747 (2011).
  24. Kim, J. B., et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 136, (3), 411-419 (2009).
  25. Lei, F., Haque, R., Xiong, X., Song, J. Directed differentiation of induced pluripotent stem cells towards T lymphocytes. Journal of Visualized Experiments. (63), e3986 (2012).
  26. Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells. OncoImmunology. 6, (2017).
  27. Haque, M., et al. Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells. Cell Transplantation. 25, (5), 811-827 (2016).
  28. Tan, A. T., et al. Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology. (2019).
  29. Wu, L. L., et al. Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice. Hepatology. (2019).
  30. Haque, M., et al. Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes. Journal of Clinical Investigation Insights. (2019).
  31. Chisari, F. V., et al. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proceedings of the National Academy of Sciences USA. 84, (19), 6909-6913 (1987).
  32. Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. Journal of Immunology. 154, (5), 2504-2515 (1995).
Stammzell-abgeleitete virale Ag-spezifische T-Lymphozyten unterdrücken HBV-Replikation bei Mäusen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).More

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter