Here, a protocol is presented to produce and rear CRISPR/Cas9 genome knockout electric fish. Outlined in detail are the required molecular biology, breeding, and husbandry requirements for both a gymnotiform and a mormyrid, and injection techniques to produce Cas9-induced indel F0 larvae.
Electroreception and electrogenesis have changed in the evolutionary history of vertebrates. There is a striking degree of convergence in these independently derived phenotypes, which share a common genetic architecture. This is perhaps best exemplified by the numerous convergent features of gymnotiforms and mormyrids, two species-rich teleost clades that produce and detect weak electric fields and are called weakly electric fish. In the 50 years since the discovery that weakly electric fish use electricity to sense their surroundings and communicate, a growing community of scientists has gained tremendous insights into evolution of development, systems and circuits neuroscience, cellular physiology, ecology, evolutionary biology, and behavior. More recently, there has been a proliferation of genomic resources for electric fish. Use of these resources has already facilitated important insights with regards to the connection between genotype and phenotype in these species. A major obstacle to integrating genomics data with phenotypic data of weakly electric fish is a present lack of functional genomics tools. We report here a full protocol for performing CRISPR/Cas9 mutagenesis that utilizes endogenous DNA repair mechanisms in weakly electric fish. We demonstrate that this protocol is equally effective in both the mormyrid species Brienomyrus brachyistius and the gymnotiform Brachyhypopomus gauderio by using CRISPR/Cas9 to target indels and point mutations in the first exon of the sodium channel gene scn4aa. Using this protocol, embryos from both species were obtained and genotyped to confirm that the predicted mutations in the first exon of the sodium channel scn4aa were present. The knock-out success phenotype was confirmed with recordings showing reduced electric organ discharge amplitudes when compared to uninjected size-matched controls.
Electroreception and electrogenesis have changed in the evolutionary history of vertebrates. Two lineages of teleost fish, osteoglossiformes and siluriformes, evolved electroreception in parallel, and five lineages of teleosts (gymnotiformes, mormyrids, and the genera Astroscopus, Malapterurus, and Synodontis) evolved electrogenesis in parallel. There is a striking degree of convergence in these independently derived phenotypes, which share a common genetic architecture1,2,3.
This is perhaps best exemplified by the numerous convergent features of gymnotiforms and mormyrids, two species-rich teleost clades, which produce and detect weak electric fields and are called weakly electric fish. In the 50 years since the discovery that weakly electric fish use electricity to sense their surroundings and communicate4, a growing community of scientists has gained tremendous insights into evolution of development1,5,6, systems and circuits neuroscience7,8,9,10, cellular physiology11,12, ecology and energetics13,14,15,16,17, behavior18,19, and macroevolution3,20,21.
More recently, there has been a proliferation of genomic, transcriptomic, and proteomic resources for electric fish1,22,23,24,25,26,27,28. Use of these resources has already produced important insights regarding the connection between genotype and phenotype in these species1,2,3,28,29,30. A major obstacle to integrating genomics data with phenotypic data of weakly electric fish is a present lack of functional genomics tools31.
One such tool is the recently developed Clustered Regularly Interspaced Short Palindromic Repeats paired with Cas9 endonuclease (CRISPR/Cas9, CRISPR) technique. CRISPR/Cas9 is a genome editing tool that has entered widespread use in both model32,33,34 and non-model organisms35,36,37 alike. CRISPR/Cas9 technology has progressed to a point where a laboratory capable of basic molecular biology can easily generate gene-specific probes called short guide RNAs (sgRNAs), at a low cost using a non-cloning method38. CRISPR has advantages over other knockout/knockdown strategies, such as morpholinos39,40, transcription activator-like effector nucleases (TALENs), and zinc finger nucleases (ZFNs), which are costly and time-consuming to generate for every target gene.
The CRISPR/Cas9 system functions to create gene knockouts by targeting a specific region of the genome, directed by the sgRNA sequence, and causing a double-stranded break. The double-stranded break is detected by the cell and triggers endogenous DNA repair mechanisms preferentially using the non-homologous end joining (NHEJ) pathway. This pathway is highly error-prone: during the repair process, the DNA molecule will often incorporate insertions or deletions (indels) at the double-stranded break site. These indels can result in a loss of function due to either (1) shifts in the open reading frame, (2) insertion of a premature stop codon, or (3) shifts in the critical primary structure of the gene product. In this protocol, we utilize CRISPR/Cas9 editing to target point mutations in target genes using the NHEJ in weakly electric fish species. While simpler and more efficient than other techniques, this method of mutagenesis is expected to result in a range of phenotypic severities in F0, which is attributed to genetic mosaicism41,42,43,44.
Selection of Organisms
For the purposes of facilitating future studies on the comparative genomics of weakly electric fish, a representative species for both gymnotiforms and mormyrids for protocol development needed to be selected. Following discussions during the 2016 Electric Fish meeting in Montevideo, Uruguay, there was community consensus to utilize species that already could be bred in the laboratory and that had genomic resources available. The gymnotiform Brachyhypopomus gauderio and the mormyrid Brienomyrus brachyistius were selected as species that fit these criteria. In both species, natural cues to induce and maintain breeding conditions are easy to mimic in captivity. B. gauderio, a gymnotiform species from South America, has the advantage of low husbandry requirements: fish can be kept at relatively high density in relatively small (4 L) tanks. B. gauderio also has fast generational turnover under captive conditions. Under laboratory conditions, B. gauderio can develop from egg to adult in about 4 months.
B. brachyistius, a species of mormyrid fish from West-Central Africa, breeds readily in captivity. B. brachyistius is readily available through the aquarium trade, has been widely used in many studies, and now has a number of genomic resources available. Their life cycle spans 1−3 years, depending on laboratory conditions. Husbandry requirements are somewhat more intensive for this species, requiring moderately sized tanks (50−100 L) due to their aggression during breeding.
Laboratories studying other species of electric fish should be able to easily adapt this protocol as long as the species can be bred, and single cell embryos can be collected and reared into adulthood. Housing, larval husbandry, and in vitro fertilization (IVF) rates will likely change with other species; however, this protocol can be used as a starting point for breeding attempts in other weakly electric fish.
An Ideal Gene Target for Proof of Concept: scn4aa
Weakly electric mormyrid and gymnotiform fish generate electric fields (electrogenesis) by discharging a specialized organ, called the electric organ. Electric organ discharges (EODs) result from the simultaneous production of action potentials in the electric organ cells called electrocytes. EODs are detected by an array of electroreceptors in the skin to create high-resolution electrical images of the fish’s surroundings45. Weakly electric fish are also capable of detecting features of their conspecifics’ EOD waveforms18 as well as their discharge rates46, allowing EODs to function additionally as a social communication signal analogous to birdsong or frog vocalizations47.
A main component of action potential generation in the electrocytes of both mormyrid and gymnotiform weakly electric fish is the voltage-gated sodium channel NaV1.42. Non-electric teleosts express two paralogous gene copies, scn4aa and scn4ab, coding for the voltage-gated sodium channel NaV1.430. In both gymnotiform and mormyrid weakly electric fish lineages, scn4aa has evolved rapidly and undergone numerous amino acid substitutions that affect its kinetic properties48. Most importantly, scn4aa has become compartmentalized in both lineages to the electric organ2,3. The relatively restricted expression of scn4aa to the electric organ, as well as its key role in the generation of EODs, makes it an ideal target for CRISPR/Cas9 knockout experiments, as it has minimal deleterious pleiotropic effects. Because weakly electric fish begin discharging their larval electric organs 6−8 days post fertilization (DPF), targeting of scn4aa is ideally suited for rapid phenotyping following embryo microinjection.
All methods described here have been approved by the Institutional Animal Care and Use Committee (IACUC) of Michigan State University.
1. Selecting sgRNA Targets
NOTE: A protocol is provided for manual design of sgRNAs in step 1.1. This was utilized for scn4aa target selection. An additional protocol is provided to facilitate this process (step 1.2) using the EFISHGENOMICS web portal. It is advised that users select protocol 1.2, which features several automated ‘checks’ to ensure success in designing sgRNAs for custom targets.
2. Generate sgRNA
3. Validate Cutting Efficiency In Vitro
4. Obtaining Embryos
NOTE: Obtaining embryos of weakly electric fish can be challenging. Careful monitoring of water quality, adequate time for fish care, and regular feeding are key to a successful breeding program. Fish must first be conditioned for several weeks for reproduction52 as described in protocol step 4.1. Following this, a protocol augmenting natural gametogenesis (4.2) for use in natural spawning behavior (4.3), an alternative recently developed in vitro technique for obtaining precisely timed embryos (4.4) are presented. Protocol 4.3 is equally effective for B. brachyistius and B. gauderio, and protocol 4.4 is superior in B. gauderio.
5. Single Cell Microinjection
6. Animal Husbandry
7. Adult Husbandry
The sgRNA target sites were identified within exon 1 of scn4aa in both B. gauderio and B. brachyistius as described in Section 1. The sgRNAs were generated as described in Section 2. Following successful sgRNA selection and synthesis (Figure 1), in vitro cleavage was tested (Figure 2). The sgRNAs demonstrating in vitro cutting were then selected for single cell microinjections.
Adult fish were conditioned for reproduction (Section 4.1), then injected with a spawning agent (Section 4.2) and subsequently squeezed (B. gauderio) for IVF as described in Section 4.4 or allowed to spawn naturally (B. brachyistius) as described in Section 4.3. These efforts yielded single cell embryos for microinjection in both species. As described in Section 5, 1.5−2.0 nL of the scn4aa sgRNA/Cas9/phenol red complex (65-190 ng/uL sgRNA, 450 ng/uL Cas9, 1%−10% phenol red, final concentrations) was injected at the one-cell stage. Eggs from the same clutch were used as uninjected controls. All embryos were cared for as described in Section 6. Following IVF, 40%–90% of eggs were fertilized, and 70%–90% of embryos survived to hatching following injection.
About 75% of fish survived to 6−11 DPF and were then phenotyped. Larval fish were placed into a 35 mm Petri dish embedded in a larger dish with Sylgard immobilized Ag/Cl recording electrodes (Figure 7A). Embryo movement was restricted using 3% agarose molds made with system water and cut to fit the embryo (Figure 7B). The same recording chamber was used for both species and the same agarose mold was used among species comparisons. Embryos were recorded for 60 s, which is sufficient to capture hundreds of EODs. Age and size-matched uninjected controls were selected for comparison. At this time point, 10%–30% of surviving embryos show a reduced amplitude EOD. Embryos displaying a reduction in EOD amplitude with no obvious morphological defects and control uninjected whole embryos were digested for DNA extraction and subsequent PCR of the scn4aa target site. There was often a range of penetrance of the phenotype, with some individuals having a stronger reduction in EOD amplitude than others.
After PCR clean up and cloning, 30+ clones from each embryo were selected for Sanger sequencing. CRISPR/Cas9 induced mutations were identified in B. gauderio (Figure 8A,B) and B. brachyistius (Figure 9A,B) individuals with strong EOD amplitude reduction (Figure 8C and Figure 9C, respectively), where uninjected controls had only reference genotypes. Visualization of EOD amplitude between confirmed mutants (“CRISPR”) and age/size matched uninjected controls demonstrated that both scn4aa mutant B. brachyistius (Figure 10A) and B. gauderio (Figure 10B) embryos had significantly lower EOD amplitude than controls (p < 2.2 x 10-16, Welch two-sample t-test). CRISPR/Cas9 targeting of scn4aa was successful in both B. brachyistius and B. gauderio and implicate scn4aa in the larval/early electrocyte discharge in both species.
Figure 1: sgRNA template synthesis and transcription. (A) Gel image of sgRNA template synthesis. Labels correspond to different sgRNAs for myod (MYO2, MYO1) and three sgRNAs for scn4aa (S1−S3). After annealing the oligomers, a ~120 bp template is produced. (B) Gel image of sgRNA transcription for three sgRNAs for B. gauderio (bg2017) and two for B. brachyistius (bb2016, 2017). The sgRNA will appear as two bands due to secondary structure and will be between 50−150 bp when using a dsDNA ladder. Please click here to view a larger version of this figure.
Figure 2: Representative gel image of successful (sg1) and unsuccessful (sg2) in vitro CRISPR assays. An equivalent amount of template without CRISPR components is shown in the scn4aa lane. Note the duplicate bands in sg1 that show that cutting has occurred. Please click here to view a larger version of this figure.
Figure 3: Breeding tank setups for weakly electric fish. (A) Schematic of the typical setup for wireless video monitoring of spawning behavior. Three commercially available CCTV cameras (Swann, Inc.) capable of producing infrared light are aimed at the top of the water and connected to a digital video recorder (DVR). Video is monitored in real time for spawning behavior in an adjacent room from a network connected computer (PC). (B) Spawning behavior captured with such a setup in B. brachyistius. (C) A typical breeding setup for B. gauderio with PVC hiding tubes and yarn mops. Please click here to view a larger version of this figure.
Figure 4: Breeding males and females. (A) B. brachyistius and (B) B. gauderio. Both species are sexually dimorphic and easily distinguished visually when sexually mature. Both females are gravid in these photos, exhibiting characteristically swollen bellies that are full of ripe eggs. Please click here to view a larger version of this figure.
Figure 5: Microinjection. (A) Glass capillary needle tips must be broken to deliver an appropriate microinjection volume. The tip on the left is unbroken. The middle and right tips are broken with a slightly angled bevel to pierce the egg chorion. (B) Eggs are lined against a glass slide (1%–10% phenol red is included as a tracer to visualize the delivery of the injection) and injected with glass capillary needles. Please click here to view a larger version of this figure.
Figure 6: Developmental stages. (A) B. gauderio and (B) B. brachyistius. All eggs are assumed fertilized and development is monitored to 24 HPF. Between 12−24 HPF embryos are visible in viable eggs, otherwise eggs exhibit degradation. Several divisions appear to take place on egg activation, regardless of fertilization. Unfertilized eggs exhibit unusual patterns of cleavage that are much more symmetrical in fertilized eggs. Please click here to view a larger version of this figure.
Figure 7: Photograph of larval recording chamber used in this study. (A) The electrodes are embedded within Sylguard but extend into the 35mm dish containing an embryo restricted via a 3% agarose mold. (B) Higher magnification image highlighting the restricted movement of the embryo due to agarose. Note the pieces of agarose that can be removed as the embryo changes size. B. gauderio embryo is facing the positive electrode. Please click here to view a larger version of this figure.
Figure 8: CRISPR/Cas9 induced mutations in B. gauderio. (A) Thirty-two clone sequences from genomic DNA of Cas9-induced mutations in a single scn4aa targeted F0 B. gauderio embryo (11 DPF). The reference sequence is underlined with the sgRNA target site highlighted in gray, the protospacer-adjacent motif (PAM) sequence highlighted in red, and the Cas9 cut site marked with "|". The change from the expected wild type sequence is given and the number of clones for each sequence is given in parenthesis. (Abbreviations: + = insertion, – = deletion, ± = indel) Any non-CRISPR associated sequence dissimilarities are bolded. Figure modeled after Jao et al.60. (B) Amino acid sequence predicted from sequenced clones of scn4aa knockdown B. gauderio from (A). Cas9-induced changes from the wild type sequence are highlighted in red and the nucleotide-induced change number is given. (C) Twenty-second electrical recordings from five size-matched larvae, all recorded 6 DPF in the same recording chamber. Gain settings are identical for all traces. Traces in red are from B. gauderio larvae with confirmed mutations (one individual shown in Figure 8A, B above), traces in black are from uninjected B. gauderio larvae. Overall, CRISPR/Cas9 editing of scn4aa showed a reduction in EOD amplitude, though the effect was heterogeneous. Please click here to view a larger version of this figure.
Figure 9: CRISPR/Cas9 induced mutations in B. brachyistius. (A) Forty-two clone sequences from genomic DNA of Cas9-induced mutations in a single scn4aa targeted F0 B. brachyistius embryo (11 DPF). The reference sequence is underlined with the sgRNA target site highlighted in gray, the protospacer-adjacent motif (PAM) sequence highlighted in red, and the Cas9 cut site marked with “|”. The change from the expected wild type sequence is given and the number of clones for each sequence is given in parenthesis. (Abbreviations: + = insertion, – = deletion, ± = indel) Any non-CRISPR associated sequence dissimilarities are bolded. Figure modeled after Jao et al.60. (B) Amino acid sequence predicted from sequenced clones from scn4aa knockdown B. brachyistius in (A). Cas9-induced changes from the wild type sequence are highlighted in red and the nucleotide induced change number is given. (C) Ten second electrical recordings from four size-matched larvae, all recorded 10 DPF in the same recording chamber. Gain settings are identical for all traces. Traces in red are from B. brachyistius larvae with confirmed mutations (one individual shown in A, B above), traces in black are from uninjected B. brachyistius larvae. Overall, CRISPR/Cas9 editing of scn4aa showed a reduction in EOD amplitude, though the effect was heterogeneous. Inverted EODs are from the fish changing orientation during the recording. No difference is discernible between experimental fish and controls despite this. Please click here to view a larger version of this figure.
Figure 10: Box plots of average EOD amplitude of CRISPR and uninjected size/age matched siblings. (A) EOD amplitude of B. brachyistius larvae at 10 DPF. Recorded with a gain of 100, CRISPR n = 56 EODs from two individuals, uninjected n = 114 EODs from three individuals. (B) EOD amplitude of B. gauderio larvae at 6 DPF. Recorded with a gain of 500, CRISPR n = 34 EODs from two individuals, uninjected n = 148 EODs from three individuals. Amplitude of CRISPR fish was significantly less than uninjected controls (p < 2.2 x 10-16, Welch two-sample t-test). All individuals were recorded with the recording chamber described in Figure 7. Please click here to view a larger version of this figure.
Description | Sequence | |
Constant oligomer | 5'-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGC TATTTCTAGCTCTAAAAC-3' | |
Target oligomer backbone (GG-N18, no PAM) | 5'-TAATACGACTCACTATAGG-N18-GTTTTAGAGCTAGAAATAGCAAG-3' | |
Target oligomer backbone (N20, no PAM) | 5'-TAATACGACTCACTATAG-N20-GTTTTAGAGCTAGAAATAGCAAG-3' | |
Brienomyrus brachyistius | ||
scn4aa Bb sgRNA target (N18, with PAM): | 5'-TCTTCCGCCCCTTCACCACGG-3' | |
Scn4aa Bb sgRNA oligomer (GG-N18): | 5'-TAATACGACTCACTATAGG TCTTCCGCCCCTTCACCA GTTTTAGAGCTAGAAATAGCAAG-3' | |
scn4aa Bb PCR primer (218 bp) | ||
Scn4aa_bb_exon1_F: | 5'-ATGGCCGGCCTTCTCAATAA-3' | |
Scn4aa_bb_exon1_R: | 5'-TCTTCCAGGGGAATATTCATAAACT-3' | |
Brachyhypopomus gauderio | ||
Scn4aa Bg sgRNA target (N17, with PAM): | 5’- CAAGAAGGATGTAGTGGAGG-3’ | |
Scn4aa Bg sgRNA oligomer (GG-N17): | 5'-TAATACGACTCACTATAGG CAAGAAGGATGTAGTGG GTTTTAGAGCTAGAAATAGCAAG-3' | |
Scn4aa Bg PCR primer pair (204 bp) | ||
scn4aa_bg_exon1_F: | 5'-CGCCTTGTCCCTCCTTCAG-3' | |
scn4aa_bg_exon1_R: | 5'-ATCTTCAGGTGGCTCTCCAT-3' |
Table 1: Oligonucleotides necessary for the protocol.
The phenotypic richness of weakly electric fish, together with a recent proliferation of genomics resources, motivates a strong need for functional genomic tools in the weakly electric fish model. This system is particularly attractive because of the convergent evolution of numerous phenotypic traits in parallel lineages of fish, which are easily kept in the laboratory.
The protocol described here demonstrates the efficacy of the CRISPR/Cas9 technique in lineages of weakly electric fish that evolved electrogenesis and electroreception in parallel, and therefore represents a major step for this model’s promise addressing future work in comparative genomics of phenotypic evolution.
This simple methodological approach requires only basic molecular biology skills and training, following a basic adoption of the Gagnon protocol38, widely used for zebrafish. It is worth noting that as technology progresses, there are more commercial kits for sgRNA production as well as companies that can synthesize guide RNAs, making this protocol more accessible to laboratories that lack molecular biology experience and equipment. We note first that the high mutagenesis efficiency allows direct phenotyping of injected larvae. However, there appears to be a substantial degree of phenotypic mosaicism, which is not uncommon and is consistent with the literature41,42,43,44. For example, in this scn4aa study, some individuals carrying mutations exhibited much larger amplitude EODs than others that were comparatively silent (Figure 7, Figure 8). It is presently unclear how many of these mutations are carried into the germline. Immediate future efforts will be directed at creating stable mutant lines.
Utilizing the NHEJ pathway for knockouts is only one of the several potential applications of CRISPR/Cas9 gene editing: the methods outlined here are a stepping stone for more advanced applications55,56. Future efforts should be aimed at designing co-injected DNA donor templates with the sgRNA/Cas9 complex. This simple modification would leverage endogenous template-based repair mechanisms (i.e., homology directed repair, or HDR) and allow precise knock-ins. Although HDR occurs at a lower efficiency than NHEJ approaches, progress has been made to increase its efficacy57,58. This lower efficiency will require efforts to optimize the design of the DNA donor template/CRISPR/Cas9 construct, make the endogenous repair mechanisms more efficient, and increase embryo production (see below). If this issue of efficiency can be solved, knockins could be utilized to add fluorescent tags, express a mutated form of the gene product, or change promoter or enhancer sequences.
While the molecular biology behind this technique is fairly straightforward, the husbandry requirements are substantial, but not insurmountable. B. gauderio are widely available and breed rapidly enough for any research program to have a colony in under a year. In contrast, B. brachyistius develop slowly, and anatomical peculiarities have proven attempts at IVF thus far unsuccessful. Other, larger species, such as Campylomormyrus59 may be more conducive to this approach. For B. brachyistius, all injected embryos were collected utilizing the natural spawning approach, which is significantly more labor intensive. Future efforts to increase efficiency in B. brachyistius IVF will allow for a higher yield of embryos for the efficiency issues described above.
The authors have nothing to disclose.
The authors acknowledge the heroic efforts of Monica Lucas, Katherine Shaw, Ryan Taylor, Jared Thompson, Nicole Robichaud, and Hope Healey for help with fish husbandry, data collection, and early protocol development. We would also like to thank the three reviewers for their suggestions to the manuscript. We believe the final product to be of better quality after addressing their comments. This work was funded by support from the National Science Foundation #1644965 and #1455405 to JRG, and the Natural Sciences and Engineering Research Council DG grant to VLS.
20 mg/mL RNA grade Glycogen | Thermo Scientific | R0551 | |
50 bp DNA ladder | NEB | N3236L | |
borosilicate glass capillary with filament | Sutter Instrument | BF100-58-10 | (O.D. 1.0mm, I.D. 0.58 mm, 10 cm length) |
Cas9 protein with NLS; 1 mg/mL | PNA Biology | CP01 | |
Dneasy Blood & Tissue Kit | Qiagen | 69506 | |
Eppendorf FemptoJet 4i Microinjector | Fisher Scientific | E5252000021 | |
Eppendorf Microloader Pipette Tips | Fisher Scientific | 10289651 | |
Hamilton syringe | Fisher Scientific | 14-824-654 | referred to as "precision glass syringe" in the protocol |
Kimwipe | Fisher Scientific | 06-666 | referred to as "delicate task wipe" in the protocol |
MEGAscript T7 Transcription Kit | Invitrogen | AM1334 | |
NEBuffer 3 | NEB | B7003S | used for in vitro cleavage assay |
OneTaq DNA kit | NEB | M0480L | |
Ovaprim | Syndel USA | https://www.syndel.com/ovaprim-ovammmlu010.html | referred to as "spawning agent" in the protocol |
Parafilm | Fisher Scientific | S37440 | referred to as "thermoplastic" in the protocol |
Pipette puller | WPI | SU-P97 | sutter brand |
QIAquick PCR Purification Kit | Qiagen | 28106 | |
Reusable needle- requires customization | Fisher Scientific | 7803-02 | Customize to 0.7 inches long; point style 4 and angle 25 |
T4 DNA polymerase | NEB | M0203L | Use with the 10X NEB buffer that is included |
Teflon coated tools | bonefolder.com | T-SPATULA4PIECE | referred to as "polytetrafluoroethene" in the protocol |