Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

सी. एलिगेंस में शारीरिक तनाव प्रतिक्रियाओं के माप

doi: 10.3791/61001 Published: May 21, 2020
* These authors contributed equally

Summary

यहां, हम फ्लोरोसेंट ट्रांसक्रिप्शनल रिपोर्टर्स की सक्रियता को मापने और शारीरिक तनाव के प्रति संवेदनशीलता को परसकर निमाटोड सी एलिगेंस में सेलुलर प्रोटेओटॉक्सिक तनाव प्रतिक्रियाओं की विशेषता है।

Abstract

जीवअक्सर उतार-चढ़ाव वाले वातावरण और इंट्राकोशियलर होमोस्टोसिस में परिवर्तन के संपर्क में आते हैं, जिससे उनके प्रोटेम और फिजियोलॉजी पर हानिकारक प्रभाव पड़ सकते हैं। इस प्रकार, जीवों ने क्षति की मरम्मत और होमोस्टोसिस को बनाए रखने के लिए समर्पित लक्षित और विशिष्ट तनाव प्रतिक्रियाएं विकसित की हैं। इन तंत्रों में एंडोप्लाज्मिक रेटिकुलम (यूपीआरईआर),माइटोकॉन्ड्रिया (यूपीआरएमटी),हीट शॉक रिस्पांस (एचएसआर), और ऑक्सीडेटिव स्ट्रेस रिस्पांस (ऑक्सएसआर) की सामने आई प्रोटीन प्रतिक्रिया शामिल है । यहां प्रस्तुत प्रोटोकॉल इन रास्तों की सक्रियता और सूत्रकृमि, सी एलिगेंस में उनके शारीरिक परिणामों का पता लगाने और विशेषता के तरीकों का वर्णन करते हैं। सबसे पहले, मार्ग-विशिष्ट फ्लोरोसेंट ट्रांसक्रिप्शनल रिपोर्टर्स का उपयोग तेजी से सेलुलर लक्षण वर्णन, दवा स्क्रीनिंग, या बड़े पैमाने पर आनुवंशिक स्क्रीनिंग (जैसे, आरएनएआई या उत्परिवर्ती पुस्तकालयों) के लिए वर्णित है। इसके अलावा, पूरक, मजबूत शारीरिक परखों का वर्णन किया गया है, जिसका उपयोग विशिष्ट तनावों के लिए जानवरों की संवेदनशीलता का सीधे आकलन करने के लिए किया जा सकता है, जो प्रतिलेखन संवाददाताओं के कार्यात्मक सत्यापन के रूप में कार्य करते हैं। एक साथ, ये विधियां आंतरिक और बाहरी प्रोटेओटॉक्सिक क्षोभ के सेलुलर और शारीरिक प्रभावों के तेजी से लक्षण वर्णन के लिए अनुमति देती हैं।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

अंतर और बाह्य वातावरण में परिवर्तन का जवाब देने के लिए एक जीव की क्षमता इसके अस्तित्व और अनुकूलन के लिए महत्वपूर्ण है। यह कई सुरक्षात्मक रास्तों के माध्यम से एक सेलुलर स्तर पर पूरा किया जाता है जो कोशिका की अखंडता सुनिश्चित करते हैं। जबकि कई सेलुलर घटक तनाव से जुड़े नुकसान के अधीन हैं, सेलुलर तनाव प्रतिक्रियाओं की एक प्रमुख भागीदारी सेलुलर प्रोटेम के होमोस्टोसिस की मरम्मत और रक्षा करना है। हालांकि, विशेष संरचनाओं में प्रोटीन का विभाजकीकरण, जिसे ऑर्गेनेल्स कहा जाता है, कोशिका के लिए एक चुनौती बन गया है, क्योंकि यह यह सुनिश्चित करने के लिए प्रोटीन गुणवत्ता नियंत्रण के एक केंद्रीकृत रूप पर भरोसा नहीं कर सकता कि कोशिका के भीतर सभी प्रोटीन ठीक से मुड़ा हुआ और कार्यात्मक हो । इसलिए, अपने प्रोटीन के लिए क्षोभ से निपटने के लिए, ऑर्गेनेल्स ने समर्पित गुणवत्ता नियंत्रण तंत्र विकसित किया है, जो गलत मुड़ा हुआ प्रोटीन समझ सकता है और उस डिब्बे के भीतर तनाव को कम करने के प्रयास में तनाव प्रतिक्रिया को सक्रिय कर सकता है। उदाहरण के लिए, साइटोसोल हीट शॉक रिस्पांस (एचएसआर) पर निर्भर करता है, जबकि एंडोप्लाज्मिक रेटिकुलम (ईआर) और माइटोकॉन्ड्रिया अपने डिब्बे-विशिष्ट सामने आए प्रोटीन प्रतिक्रियाओं (यूपीआर) पर भरोसा करते हैं। ऑक्सएसआर प्रतिक्रियाशील ऑक्सीजन प्रजातियों (आरओएस) के जहरीले प्रभावों को कम करने का कार्य करता है। प्रत्येक तनाव प्रतिक्रिया सेलुलर चुनौतियों और पर्यावरण अपमान की उपस्थिति में शुरू होता है और एक सिलवाया प्रतिलेखन प्रतिक्रिया लाती है । इन प्रतिक्रियाओं की पहचान में अणुओं का संश्लेषण शामिल है जो उचित ऑर्गेनेल को लक्षित गलत प्रोटीन (जैसे चैपरोन) को फिर से गुना करते हैं, या वैकल्पिक रूप से, प्रोटीन क्षरण द्वारा क्षतिग्रस्त प्रोटीन को हटा देते हैं। इन तनाव प्रतिक्रियाओं को सक्रिय करने में विफलता के परिणामस्वरूप क्षतिग्रस्त प्रोटीन का संचय होता है, ऊतकों की प्रणालीगत विफलता के लिए प्रचारित सेलुलर शिथिलता, और अंततः जीव की मृत्यु होती है। विभिन्न तनाव प्रतिक्रियाओं के कार्य और नियमन की कहीं और समीक्षा की जाती है1.

सेलुलर तनाव प्रतिक्रियाओं के विनियमन और गतिविधि के बारे में कई अंतर्दृष्टि नेमाटोड, Caenorhabditis elegans,आनुवंशिक अनुसंधान में एक बहुकोशिकीय मॉडल जीव के लिए जिंमेदार ठहराया गया है । सूत्रकृमि न केवल सेलुलर स्तर पर तनाव प्रतिक्रियाओं की सक्रियता का अध्ययन करने की अनुमति देते हैं, बल्कि संगठित स्तर पर भी; सूत्रकृमि का उपयोग आनुवंशिक क्षोभ या दवाओं और प्रदूषकों के संपर्क में आने वाले प्रभावों का अध्ययन करने के लिए किया गया है। प्रयोग के दौरान उनका त्वरित पीढ़ी का समय, आइसोजेनी, पारदर्शिता, आनुवंशिक ट्रैकेबिलिटी और उपयोग में आसानी उन्हें ऐसे अध्ययनों के लिए आदर्श बनाती है। इसके अतिरिक्त, तनाव के लिए अपेक्षाकृत त्वरित शारीरिक प्रतिक्रिया (घंटे और कुछ दिनों के बीच) और सेलुलर रास्तों के विकासवादी संरक्षण तनाव प्रतिरोध का अध्ययन करने में एक प्रमुख उपकरण सूत्रकृमि बनाते हैं।

सी. एलिगेंसविकसित करने के लिए खाद्य स्रोत के रूप में उपयोग किए जाने वाले दो आमतौर पर उपयोग किए जाने वाले ई कोलाई उपभेद हैं: मानक OP50, एक बी तनाव जिसमें सबसे अधिक प्रयोग ऐतिहासिक रूप से2 और HT115 किया गया है, एक K-12 तनाव जिसका उपयोग लगभग सभी आरएनएआई प्रयोगों3,,4के लिए किया जाता है। यह ध्यान रखना महत्वपूर्ण है कि OP50 और HT115 बैक्टीरियल आहार के बीच महत्वपूर्ण अंतर हैं। इन विभिन्न जीवाणु स्रोतों पर वृद्धि मेटाबोलिक प्रोफाइल, माइटोकॉन्ड्रियल डीएनए कॉपी संख्या, और उम्र5सहित कई प्रमुख फेनोटाइप में प्रमुख अंतर पैदा करने के लिए दिखाया गया है । इनमें से कुछ मतभेदों को OP50 बैक्टीरिया पर विकास से जुड़े विटामिन बी 12 की कमी के लिए जिम्मेदार ठहराया जाता है, जिसके परिणामस्वरूप माइटोकॉन्ड्रियल होमोस्टोसिस में दोष हो सकते हैं और रोगजनकों और तनावों के प्रति संवेदनशीलता बढ़ सकती है। इन सभी फेनोटाइप को HT115 बैक्टीरिया पर वृद्धि से समाप्त किया गया है, जिसमें विटामिन बी 126का उच्च स्तर है। इसलिए, यह सिफारिश की जाती है कि शारीरिक तनाव प्रतिक्रियाओं पर सभी प्रयोग ों को RNAI स्थितियों की आवश्यकता की परवाह किए बिना HT115 बैक्टीरिया पर किया जाए। हालांकि, OP50 पर जानवरों को बनाए रखने में आसानी के कारण, सभी मानक विकास (यानी, रखरखाव और जानवरों के प्रवर्धन) OP50 पर किया जा सकता है, के रूप में यहां वर्णित प्रयोगात्मक प्रतिमान में महत्वपूर्ण अंतर OP50 पर बनाए रखा कीड़े में पता नहीं चला जब तक वे HT115 पोस्ट सिंक्रोनाइजेशन (यानी, के साथ या L1 गिरफ्तार करने के बिना ब्लीचिंग के बाद से ले जाया गया) प्रयोग तक ।

यहां, दो कार्यात्मक तरीकों का उपयोग करके सेलुलर तनाव प्रतिक्रियाओं की गतिविधि का लक्षण वर्णन वर्णित है। यह ध्यान दिया जाना चाहिए कि प्रस्तुत प्रोटोकॉल मुख्य रूप से सेलुलर तनाव प्रतिक्रियाओं और प्रोटीन होमोस्टोसिस पर उनके प्रभाव पर केंद्रित हैं। सबसे पहले, फ्लोरोसेंट ट्रांसक्रिप्शनल रिपोर्टर्स का उपयोग किया जाता है, जिन्हें एंडोजेनस जीन प्रमोटरों द्वारा विनियमित किया जाता है जो विशेष रूप से विभिन्न सेलुलर तनावों के जवाब में सक्रिय होते हैं। ये फ्लोरोसेंट ट्रांसक्रिप्शनियल रिपोर्टर विशिष्ट जीन के प्रतिलेखन प्रेरण पर आधारित हैं जो मूल रूप से तनाव प्रतिक्रिया का हिस्सा हैं। उदाहरण के लिए, HSP-4, मानव chaperone HSPA5/BiP के लिए एक हीट शॉक प्रोटीन ऑर्थोलॉगस, ईआर-तनाव पर सक्रिय है और तनाव को कम करने के लिए ईआर को स्थानीयकरण करता है । ईआर तनाव (उदाहरण के लिए, ट्यूनिकामाइसिन के संपर्क में), एचएसपी-4 प्रमोटर के नियमन के तहत रखा गया एक हरे रंग का फ्लोरोसेंट प्रोटीन (जीएफपी) की स्थितियों में, उच्च स्तर में संश्लेषित किया जाता है जैसा कि फ्लोरोसेंट माइक्रोस्कोपी द्वारा मूल्यांकन किया जा सकता है या मात्रात्मक रूप से नेमाटोड7के बड़े कण प्रवाह साइटोमेट्री का उपयोग करके मापा जा सकता है। इसी तरह, एक माइटोकॉन्ड्रियल चैपरोन के प्रमोटर, एचएसपी-6 (ऑर्थोलॉगस टू स्तनधारी एचएसपीए9) का उपयोग यूपीआरएमटी8की सक्रियता की निगरानी के लिए किया जाता है, और साइटोसोलिक चैपरोन एचएस-16.2 (मानव क्रिस्टलिन अल्फा जीन के लिए ऑर्थोलोगस) के प्रमोटर का उपयोग एचएसआर9की गतिविधि का आकलन करने के लिए किया जाता है। ये रिपोर्टर विभिन्न क्षोभ के जवाब में सक्रिय रास्तों के तेजी से लक्षण वर्णन की अनुमति देते हैं ।

अक्सर, यहां प्रस्तुत संवाददाताओं माइक्रोस्कोपी का उपयोग कर छवि रहे हैं, जो तनाव प्रतिक्रियाओं की सक्रियता का गुणात्मक उत्पादन प्रदान करता है । हालांकि, जबकि इमेजिंग तकनीक ऊपर वर्णित संवाददाताओं की तीव्रता और ऊतक स्थान के बारे में दोनों जानकारी प्रदान करते हैं, इसकी मात्रा हमेशा सटीक या मजबूत नहीं है । हालांकि इमेजिंग विश्लेषण उपकरणों का उपयोग करके फ्लोरोसेंट सक्रियण की मात्रा निर्धारित करना संभव है, ये विधियां अपेक्षाकृत कम हैं और नमूना आकार कम है, छवि वाले जानवरों की अपेक्षाकृत कम संख्या के कारण। जानवरों की बड़ी मात्रा में प्राप्त करने की आसानी और क्षमता जल्दी सी एलिगेंस को एक बड़े कण प्रवाह साइटोमीटर के उपयोग के माध्यम से फ्लोरोसेंट तनाव संवाददाताओं की सक्रियता को परखने के लिए एक आदर्श मॉडल प्रणाली बनाती है। एक बड़े कण प्रवाह साइटोमीटर कई जीवित जानवरों से आकार और फ्लोरेसेंस के आधार पर रिकॉर्डिंग, विश्लेषण और छंटाई करने में सक्षम है। इस विधि का उपयोग करके, हजारों कीड़े के लिए फ्लोरोसेंट तीव्रता, आकार और स्थानिक (2डी) जानकारी प्राप्त करना संभव है। सिस्टम को फ्लोपायलट का उपयोग करके नियंत्रित किया जाता है, जो वास्तविक समय डेटा अधिग्रहण और मापा मापदंडों के विश्लेषण के लिए अनुमति देता है। यहां, एक बड़े कण प्रवाह साइटोमीटर का उपयोग करसूक्ष्म इमेजिंग और मात्रात्मक विश्लेषण दोनों के लिए तरीकों को तनाव प्रतिक्रियाओं की सक्रियता को मापने के तरीकों के रूप में पेश किया जाता है।

रिपोर्टर विश्लेषण से परे, संवेदनशीलता या तनाव के लिए जानवरों के प्रतिरोध शारीरिक तनाव परख का उपयोग कर मापा जा सकता है । यह जानवरों को तनावपूर्ण वातावरण में उजागर करके हासिल किया जाता है जो विशिष्ट सेलुलर तनाव मार्गों को सक्रिय करते हैं। यहां, विशिष्ट प्रकार के तनावों के लिए पूरे जानवरों की संवेदनशीलता को मापने के लिए कई तरीके प्रदान किए जाते हैं।

ईआर तनाव रासायनिक एजेंट, ट्यूनिकामाइसिन का उपयोग करके सी एलिगेंस पर लागू किया जाता है, जो एन-लिंक्ड ग्लाइकोसिलेशन को ब्लॉक करता है, जिससे ईआर10में गलत मुड़ा हुआ प्रोटीन का संचय होता है। सी एलिगेंसमें, ट्यूनिकामाइसिन के संपर्क में आने पर वृद्धि ईआर फ़ंक्शन में प्रमुख क्षोभ में होती है, औरउम्र 11में काफी कम हो जाती है। ट्यूनिकामाइसिन युक्त प्लेटों पर जानवरों के अस्तित्व को मापने से, जानवरों की ईआर तनाव संवेदनशीलता की मात्रा निर्धारित की जा सकती है। उदाहरण के लिए, एक्टोपिक यूपीआरईआर प्रेरण वाले जानवरऔर इस प्रकार ईआर में प्रोटीन गलत मोड़ तनाव के प्रतिरोध में वृद्धि से जंगली प्रकार के जानवरों की तुलना में ट्यूनिकामाइसिन एक्सपोजर पर अस्तित्व बढ़ गया है12।

ऑक्सीडेटिव और माइटोकॉन्ड्रियल स्ट्रेस को केमिकल एजेंट, पैराक्विट में जानवरों को उजागर करके सी एलिगेंस पर लगाया जाता है। पैराक्विट आमतौर पर इस्तेमाल किया जाने वाला शाकनाशी होता है, जो विशेष रूप से माइटोकॉन्ड्रिया13में सुपरऑक्साइड गठन का कारण बनता है। माइटोकॉन्ड्रिया-व्युत्पन्न प्रतिक्रियाशील ऑक्सीजन प्रजातियों (आरओएस) के विशिष्ट स्थानीयकरण के कारण, पैराक्विट परख ों का उपयोग अक्सर "माइटोकॉन्ड्रियल" तनाव परख के रूप में किया जाता है। हालांकि, सुपरऑक्साइड को माइटोकॉन्ड्रियल सुपरऑक्साइड डिमुटेस (एसओडी)14द्वारा तेजी से हाइड्रोजन पेरोक्साइड में परिवर्तित किया जाता है। हाइड्रोजन पेरोक्साइड बाद में माइटोकॉन्ड्रिया से बाहर निकल सकता है और कोशिका के अन्य डिब्बों में ऑक्सीडेटिव तनाव पैदा कर सकता है। इसलिए, हम माइटोकॉन्ड्रियल और ऑक्सीडेटिव तनाव (अन्य ऑक्सीडेटिव तनाव के सखोंको 15पाया जा सकता है) दोनों के प्रति संवेदनशीलता को मापने के रूप में पैराक्विट अस्तित्व के परखों का वर्णन करते हैं।

थर्मोटॉलरेंस परखों को ऊंचा तापमान में जानवरों को रखकर सी एलिगेंस में किया जाता है । नेमाटोड के लिए परिवेश का तापमान ~ 15-20 डिग्री सेल्सियस होता है और थर्मल तनाव 25 डिग्री सेल्सियस16,17से ऊपर के तापमान पर प्रेरित होता है। थर्मोटॉलरेंस परख आम तौर पर 30-37 डिग्री सेल्सियस से लेकर तापमान पर किया जाता है, क्योंकि जानवर इस तापमान पर प्रमुख सेलुलर दोषों का प्रदर्शन करते हैं, और जीवित रहने के परख24 घंटे16, 18,केभीतर पूरी हो जाते हैं। यहां थर्मोटॉलरेंस के प्रदर्शन के लिए दो वैकल्पिक तरीके बताए गए हैं- 34 डिग्री सेल्सियस पर विकास और 37 डिग्री सेल्सियस पर विकास। एक साथ, यहां प्रस्तुत प्रोटोकॉल बड़े पैमाने पर स्क्रीन प्रदर्शन जब मानक जीन दस्तक के साथ संयुक्त आरएनए हस्तक्षेप या रासायनिक दवा पुस्तकालयों का उपयोग कर नीचे का उपयोग किया जा सकता है ।

प्रोटोकॉल को 4 व्यापक प्रक्रियाओं में तोड़ा जा सकता है- सी एलिगन्स का विकास और इमेजिंग (सेक्शन 1 और 2) की तैयारी, फ्लोरोसेंट माइक्रोस्कोपी (सेक्शन 3-5) का उपयोग करके ट्रांसक्रिप्शनल रिपोर्टर्स की इमेजिंग, बड़े कण प्रवाह साइटोमीटर (धारा 6) का उपयोग करके संवाददाताओं का मात्रात्मक माप, और सी लेगन (सेक्शन 7) में तनाव संवेदनशीलता को मापने के लिए शारीरिक रूप।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. तापमान और OP50 बनाम HT115 की मानक वृद्धि की स्थिति

  1. मानक वृद्धि और विस्तार
    1. परिवेश के तापमान (~ 22-25 डिग्री सेल्सियस) पर 24-48 घंटे के लिए एलबी(टेबल 1)या पसंद के समकक्ष मीडिया में OP50 की संस्कृति बढ़ाएं। कमरे के तापमान पर बैक्टीरिया उगाएं क्योंकि OP50 एक यूसिल ऑक्सोट्रोफ है और 37 डिग्री सेल्सियस की दर से उगाए जाने पर वापस जाने वालों (जैसे, दमनक म्यूटेंट) की अधिक घटना होती है। OP50 संस्कृतियों के दीर्घकालिक भंडारण की सिफारिश नहीं की जाती है (अधिकतम 1 सप्ताह 4 डिग्री सेल्सियस पर)।
    2. एक 60 मिमी एनजीएम प्लेट(टेबल 1)पर संतृप्त OP50 संस्कृति के ~ 100-200 μL की मात्रा बीज प्रयोग के लिए जानवरों के विस्तार के लिए एक 100 मिमी प्लेट पर कीड़े के रखरखाव के लिए और संतृप्त OP50 संस्कृति के 1 mL।
    3. प्लेटों को बेंचटॉप पर रात भर सूखने दें।
      नोट: 100 मिमी प्लेटों को सूखने के लिए अधिक समय की आवश्यकता हो सकती है, खासकर यदि गैर-निकाल प्लेटों का उपयोग करना। सभी सी एलिगेंस प्लेट्स को 4 डिग्री सेल्सियस पर संग्रहित एयर-टाइट कंटेनरों में स्टोर करें। प्लेटों के विखंडन के रूप में पिछले 6 महीने पुरानी प्लेटों का उपयोग न करें, जो विभिन्न ऑस्मोटिक दबाव और प्लेटों की कठोरता के कारण प्लेटों पर पशु शरीर विज्ञान को बदल देगा।
    4. मानक रखरखाव के लिए, 60 मिमी प्लेट पर 10-15 युवा जानवरों (अंडे, एल1, या एल 2 चरणों) को स्थानांतरित करें, हालांकि कम फेकिटी वाले म्यूटेंट या ट्रांसजेनिक जानवरों से निपटने पर अधिक स्थानांतरित किया जा सकता है। विकासात्मक या fecundity दोषों के साथ जानवरों के लिए, स्टॉक के नुकसान को रोकने के लिए जानवरों के एक अधिक चर पूल का हिस्सा । यदि 15 डिग्री सेल्सियस पर रखा जाता है, तो हर हफ्ते जानवरों को स्थानांतरित करें; 20 डिग्री सेल्सियस के लिए, हर 3-4 दिनों में जानवरों को स्थानांतरित करें।
    5. हर 25-30 मार्ग जानवरों का एक ताजा गल प्रदर्शन करें (~ 6 महीने अगर जानवरों को सप्ताह में एक बार ले जाया जाता है और 15 डिग्री सेल्सियस पर रखा जाता है)।
    6. विस्तार के लिए, विस्तार के लिए 100 मिमी प्लेटों पर एक पूर्ण 60 मिमी प्लेट का हिस्सा। संदर्भ के एक फ्रेम के रूप में, जंगली प्रकार के फेक्युडिटी वाले जानवरों में 4ths-6ths में एक पूर्ण 60 मिमी प्लेट कट हो सकती है और भुखमरी तक पहुंचने के बिना पूर्ण 100 मिमी प्लेट बनाने के लिए 2 दिनों या 15 डिग्री सेल्सियस के लिए 20 डिग्री सेल्सियस पर एक बड़ी प्लेट पर हिस्सा दिया जा सकता है।

2. ब्लीचिंग का उपयोग कर केड़े का मंचन/सिंक्रोनाइजेशन

  1. कीड़े को सिंक्रोनाइज करने के लिए ब्लीचिंग प्रोटोकॉल
    1. M9(तालिका 1)का उपयोग करके आगर प्लेटों से ग्राविद कीड़े (अंडे से भरे वयस्क) धोएं। प्रयोगों के लिए ब्लीच करने के लिए कीड़े (यानी, चरण 1.1.6 से चंकी कीड़े) की गैर-सिंक्रोनाइज्ड आबादी से शुरू करें, क्योंकि ब्लीचिंग के माध्यम से सिंक्रोनाइजेशन के क्रमिक दौर पर महत्वपूर्ण आनुवंशिक बहाव हो सकता है।
    2. एक गिलास पिपेट का उपयोग कर एक 15 mL शंकुट्यूब में कीड़ा/M9 मिश्रण ले जाएँ; कीड़े की कई प्लेटों को एक 15 मिलील शंकुट्यूब में एकत्र किया जा सकता है।
    3. 1,000 x ग्रामपर 30 एस के लिए नीचे जानवरों स्पिन। एस्पिरेट M9 अलौकिक। अवशिष्ट बैक्टीरिया को धोना अनावश्यक है जब तक कि संदूषण या बैक्टीरिया के बड़े झुरमुटों की प्रबल मात्रा न हो। यदि यह मामला है, M9 के साथ कई वॉश प्रदर्शन करते हैं ।
    4. ब्लीचिंग सॉल्यूशन(टेबल 1)का नया स्टॉक तैयार करें । ब्लीचिंग सॉल्यूशन को 4 डिग्री सेल्सियस पर कई दिनों तक रखा जा सकता है, लेकिन हौसले से बने ब्लीचिंग सॉल्यूशन का इस्तेमाल करें क्योंकि अकुशल ब्लीचिंग के कारण असमान ब्लीचिंग हो सकती है, जिससे सभी कृमि शवों को खत्म करने से पहले अंडों को नुकसान होगा।
    5. जानवरों के लिए ब्लीचिंग समाधान के 2-10 mL जोड़ें (पशु गोली के हर ~ 0.1 mL के लिए ब्लीच समाधान के ~ 1 mL)। ~ 5 मिन के लिए ब्लीच और कृमि मिश्रण उलटा (10 min से अधिक नहीं है; ध्यान दें कि ब्लीचिंग समय भिन्न हो सकता है और प्रत्येक प्रयोगशाला के लिए विशेष रूप से टिटकिया जाना चाहिए)। तेजी से और अंडों के इष्टतम संरक्षण के लिए कृमि शवों को भंग करने में मदद करने के लिए तेजी से हिला। समय-समय पर एक विच्छेदन माइक्रोस्कोप के नीचे देखें या शंकुई ट्यूब को प्रकाश में रखें जब वयस्क कृमि शव पूरी तरह से भंग हो जाते हैं और केवल अंडे ट्यूब में रहते हैं।
    6. 30 एस के लिए 1,000 x ग्राम पर कताई द्वारा अंडे को गोली मारें और फिर सुपरनेटेंट को एस्पिरेट करें। अंडे अपनी अखंडता को बाधित किए बिना कीड़े की तुलना में तेजी से अपकेंद्रित्र किया जा सकता है, इसलिए यदि अपकेंद्रित्र गति के अनिश्चित, अंडे को उनके शरीर विज्ञान को प्रभावित किए बिना 2,500 x ग्राम तक नीचे घूमती जा सकती है।
    7. अंडे से ब्लीच को साफ करने के लिए 15 mL तक M9 जोड़ें और ट्यूब को उलटा दें।
    8. ब्लीच को हटाने के लिए 2-3 बार चरण ों को दोहराएं।
    9. पिपेट अंडा/M9 प्लेटों पर मिश्रण और प्रयोग के लिए 15-20 डिग्री सेल्सियस पर बढ़ते हैं । उपयोग करने के लिए कितने कीड़े का एक उपाय प्राप्त करने के लिए, एक आगर प्लेट या स्लाइड पर अंडे के मिश्रण के 5 μl पाइपिंग और मात्रा के प्रति 1 μL अंडे की संख्या निर्धारित करने के लिए अंडे की गिनती को 5 से विभाजित करके अनुमानित अंडे की गिनती करते हैं। 3 स्वतंत्र मामलों के औसत सटीकता में सुधार हो सकता है । भुखमरी से बचने के लिए, प्रति प्लेट अनुशंसित अंडे की गिनती की एक तालिका तालिका 2में उपलब्ध है।
    10. यदि आवश्यक हो, तो L1 24 घंटे तक के लिए 20 डिग्री सेल्सियस पर एक रोटेटर में अंडा/M9 मिश्रण रखकर सख्त लौकिक सिंक्रोनाइजेशन के लिए जानवरों को गिरफ्तार करते हैं । जंगली प्रकार के जानवरों के लिए, पशु शरीर विज्ञान में कोई दोष का पता चला जब L1 ४८ घंटे तक के लिए गिरफ्तार किया गया । हालांकि, म्यूटेंट जो भुखमरी के प्रति संवेदनशील हैं (उदाहरण के लिए, लाइसोसोम या ऑटोफैगी म्यूटेंट) एल 1 को गिरफ्तार करने के साथ बहुत खराब करते हैं, और इस प्रकार भुखमरी के प्रति संवेदनशील माने जाने वाले म्यूटेंट के लिए इस सिंक्रोनाइजेशन विधि को करने की सिफारिश नहीं की जाती है। यदि उन जानवरों के लिए सख्त सिंक्रोनाइजेशन की आवश्यकता है जिन्हें एल1 गिरफ्तार नहीं किया जा सकता है, तो धारा 2.2 में वर्णित अंडा-रखना विधि का उपयोग करें।
  2. कीड़े को सिंक्रोनाइज करने के लिए अंडा-वट प्रोटोकॉल
    नोट: ब्लीचिंग के लिए एक वैकल्पिक विधि के रूप में, एक अंडा रखना परख किया जा सकता है । अंडे-वट का उपयोग तब किया जाता है जब जानवरों की ब्लीचिंग पर्याप्त सिंक्रोनाइजेशन प्रदान नहीं करती है, क्योंकि वयस्क जानवरों के अंडे की थैली के भीतर अंडे 8-12 घंटे के अलावा अलग हो सकते हैं। प्रयोगात्मक प्रतिमान के लिए जहां यह जानवरों के लिए महत्वपूर्ण है के रूप में बारीकी से संभव के रूप में मंचन किया जाना है, लेकिन जहां L1 गिरफ्तार संभव नहीं है (जैसे, भुखमरी म्यूटेंट में), अंडे रखना परख की सिफारिश कर रहे हैं । हालांकि, यह ध्यान दिया जाना चाहिए कि अंडे-रखना प्रोटोकॉल में शामिल श्रम के कारण, उच्च पैमाने पर प्रयोग करना कम संभव है।
    1. 4-12 gravid वयस्कों प्लेस (चरण २.२.२ के बाद नोट देखें) एक मानक OP50 या HT115 वरीयता प्राप्त NGM प्लेट पर (बैक्टीरियल उपभेदों पर सिफारिशों के लिए ऊपर धारा 1 देखें) । प्रयोगों के पैमाने के आधार पर, कई प्लेटों का उपयोग किया जा सकता है। ध्यान से दस्तावेज़ कितने जानवरों के कदम २.२ के लिए प्रत्येक थाली पर है सुनिश्चित करें ।
    2. जानवरों को प्रयोगों के लिए वांछित तापमान पर रखें (15-20 डिग्री सेल्सियस) 4-8 घंटे के लिए।
      नोट: घंटे जानवरों की संख्या थाली पर छोड़ दिया जाता है निर्धारित करेगा कि कैसे बारीकी से पहले अंडे रखी और पिछले अंडे रखी होगी, तो समय की जरूरत के रूप में समायोजित किया जा सकता है । चूंकि इनक्यूबेशन समय कम होने का मतलब होगा कि प्रत्येक जानवर के पास अंडे डालने के लिए कम समय होता है, इसलिए पर्याप्त अंडे सुनिश्चित करने के लिए प्लेटों पर अधिक जानवरों को रखा जाना चाहिए। जबकि वास्तविक अंडा बिछाने की दर पूरी तरह से जानवरों की प्रवृत्ति के कारण सामान्यीकृत नहीं है अंडे बिछाने के छोटे फटने के बजाय अंडे बिछाने के बजाय अंडे की एक सामांयीकृत दर के माध्यम से जाना है, प्रति पशु रखे अंडे की औसत दर जंगली प्रकार fecundity19प्रदर्शन जानवरों के लिए ~5 अंडे/घंटे का अनुमान लगाया जा सकता है । जब 1 वयस्क चरण दिन के लिए जानवरों को विकसित करने की कोशिश कर रहा है, समय अंडे-थाली प्रति १०० अंडे के लिए भुखमरी से बचने के लिए और १०० अंडे है (प्लेट प्रति सिफारिश की जानवरों पर अधिक जानकारी के लिए तालिका 2 को देखें) ।
    3. प्लेटों से वयस्क जानवरों को हटा दें। सुनिश्चित करें कि सभी वयस्क जानवरों को प्लेटों से हटा दिया जाता है, क्योंकि जानवर अंडे डालते रहेंगे और इसके परिणामस्वरूप एक अतुल्यकालिक आबादी और/या थाली की भुखमरी होगी ।

3. प्रतिलेखन संवाददाताओं की इमेजिंग के लिए कीड़े की वृद्धि की स्थिति

  1. कीड़े का विकास
    1. HT115 की जीवाणु संस्कृति का टीका लगाने pL4440 RNAi प्लाज्मिड (EV) और/या एलबी मीडिया में वांछित लक्ष्य जीन (एस) के खिलाफ एक RNAi कैसेट ले १०० μg/mL कार्बेनिकलिन और 20 μg/mL tetracycline के साथ पूरक ।
    2. एक मिलाते हुए 37 डिग्री सेल्सियस इनक्यूबेटर में संतृप्ति के लिए रातोंरात (~ 16 घंटे) संस्कृति बढ़ो।
    3. सैचुरेटेड बैक्टीरियल कल्चर के 200 माइक्रोन के साथ स्पॉट 60 एमएम एनजीएम आरएनएआई प्लेट्स और 100 एमएम एनजीएम आरएनएआई प्लेट्स के साथ 1,000 माइक्रोन ऑफ सैचुरेटेड बैक्टीरियल कल्चर। अंधेरे में रात भर परिवेश के तापमान (~ 22 डिग्री सेल्सियस) पर सूखी चलो (एल्यूमीनियम पन्नी के साथ शिथिल कवर)।
    4. फ्लोरोसेंट रिपोर्टर्स (पूरी सूची के लिए टेबल 3 देखें) को पसंद के बैक्टीरिया के साथ वरीयता प्राप्त एनजीएम आरएनएआई प्लेटों पर ले जाने वाले ट्रांसजेनिक कीड़े की सिंक्रोनाइज्ड आबादी रखें।
    5. नीचे उल्लिखित विशिष्ट संवाददाताओं के लिए आवश्यक चरणों के लिए 15-20 डिग्री सेल्सियस की दर से बढ़ें।
  2. प्रयोगों के लिए कीड़े के मंचन के लिए विचार
    1. वयस्कता के दिन 1 पर प्रतिलेखन संवाददाताओं के लिए प्रयोग करें, परख के अपवाद के साथ कि L4 जानवरों की आवश्यकता है । वर्मएटलस के अनुसार, एल4 जानवरों को अंडे के चरण(www.wormatlas.org)से 20 डिग्री सेल्सियस पर विकास के लगभग 2.5 दिन (~ 56 एच) प्राप्त किए जाते हैं।
    2. "दिन 1 वयस्कों" के लिए, अंडे चढ़ाना के बाद 20 डिग्री सेल्सियस पर विकास के लगभग 3-4 दिनों (~ 65-96 एच) पर जानवरों का उपयोग करें।
      नोट: इस विस्तृत श्रृंखला को इस प्रकार समझाया गया है: ~ 65 एच 20 डिग्री सेल्सियस पर है जब जानवर "अंडा-बिछाने" तक पहुंचते हैं, जो कि सच्ची "वयस्कता" स्थिति है। ९६ एच है जब जानवरों में प्रवेश क्या WormAtlas "अंडे बिछाने अधिकतम," जो है जब वयस्क एक gravid वयस्क है और एक पूर्ण अंडा थैली है के रूप में वर्णन करता है । यह तब होता है जब जानवरों को 1 दिन से पुराना होने के रूप में वर्णित किया जाएगा और मतभेदों को प्रदर्शित करना शुरू कर सकते हैं, और इस प्रकार यहां वर्णित प्रोटोकॉल सभी को इस "दिन 1" चरण में शुरू करने की सिफारिश की जाती है जो 65 एच के रूप में शुरू होता है और 96 एच के रूप में देर से शुरू होता है। यहां वर्णित परखों के लिए, इस ~ 65-96 एच खिड़की में जानवरों का उपयोग करते समय प्रमुख मतभेद नहीं देखे गए थे।
    3. एक ही प्रयोग की प्रतिकृति के लिए, अधिक मजबूत प्रजनन क्षमता के लिए एक समान समय बिंदु का उपयोग करें (उदाहरण के लिए, अंडे चढ़ाना के बाद ~ 65 घंटे या ~ 96 घंटे पर सभी प्रयोग करते हैं)।
      नोट: कुछ ट्रांसजेनिक जानवरों और म्यूटेंट धीमी विकास दर प्रदर्शित करते हैं । इसके लिए दो सिफारिशें मौजूद हैं। 1) कंपित सिंक्रोनाइजेशन का उपयोग करें, जहां जानवरों को एक ही समय में किए जाने वाले प्रयोग के लिए अलग-अलग समय पर ब्लीच किया जा सकता है। यह सिफारिश तब की जाती है जब परख में तकनीकी परिवर्तनशीलता तकनीकी परिवर्तनशीलता से बड़ी हो सकती है जो सिंक्रोनाइजेशन परख (जैसे, अस्तित्व परखसे) से उत्पन्न हो सकती है, जो लंबी अवधि के लिए चलती है, अगर वे एक साथ प्रदर्शन नहीं कर रहे हैं तो उन्हें नुकसान हो सकता है)। 2) कंपित विश्लेषण का उपयोग करें, जहां जानवरों को एक ही समय में ब्लीच किया जा सकता है, लेकिन परख खुद अलग समय पर किया जाता है। यह बहुत सरल परखों के लिए अनुशंसित है जिसमें अंतर्निहित परिवर्तनशीलता नहीं है (उदाहरण के लिए, आरएनएआई-तनाव प्रतिक्रियाओं का शामिल होना)।

4. तनाव प्रतिक्रियाओं का शामिल

  1. HSP-4p का उपयोग करना:: यूपीआरईआर की सक्रियता के लिए एक readout के रूप में GFP
    1. आरएनएआई का उपयोग करईआर तनाव को प्रेरित करना
      1. धारा 3 में एनजीएम आरएनएआई प्लेटों(टेबल 1)पर ब्याज के जीन को लक्षित करते हुए आरएनएआई बैक्टीरिया के साथ देखी गई प्लेटें तैयार करें। बेसल यूपीआरईआर स्तर और टैग-335 के आरएनएआई नॉकडाउन के लिए नियंत्रण के रूप में ईवी का उपयोग करें (ईआर निवासी प्रोटीन के एन-लिंक्ड ग्लाइकोसिलेशन के लिए एंजाइम; आरएनएआई नॉकडाउन में ईआर तनाव के तहत यूपीआरईआर के सक्रियण के लिए सकारात्मक नियंत्रण के रूप में ट्यूनिकामाइसिन उपचार के समान प्रभाव होते हैं।
      2. सिंक्रोनाइज एचएसपी-4p:: जीएफपी रिपोर्टर जानवरधारा 2 में वर्णित तरीकों का उपयोग करते हैं।
      3. तालिका 2में अनुशंसित मानदंडों का उपयोग करके आरएनएआई प्लेटों पर प्लेट अंडे।
      4. वयस्कता के दिन 1 पर प्रयोग करने के लिए लगभग 3-4 दिनों (~ 65-96 एच) के लिए 20 डिग्री सेल्सियस पर अंडे इनक्यूबेट करें। UPRईआर प्रयोगों के लिए, एचएसपी-4 के बेसल फ्लोरेसेंस में अंतर हैं::: जीएफपी रिपोर्टर जब विभिन्न तापमान पर उगाया जाता है । इसलिए 20 डिग्री सेल्सियस पर सभी प्रयोग करें।
    2. एक रासायनिक एजेंट का उपयोग कर ईआर तनाव उत्प्रेरण
      1. Hsp-4p सिंक्रोनाइज:: GFP रिपोर्टर जानवरों धारा 2 में वर्णित तरीकों का उपयोग कर और 20 डिग्री सेल्सियस पर बढ़ने जब तक जानवरों L4 चरण तक पहुंचने । जानवरों को M9 की एक ट्यूब पर स्थानांतरित करें। कीड़े को व्यवस्थित करने की अनुमति दें (गुरुत्वाकर्षण द्वारा ~ 2-3 मिन या 1,000 x ग्रामपर 30 एस स्पिन), और फिर M9 को हटा दें।
      2. एम9 में 25 एनजी/mL (1 मिलीग्राम/mL स्टॉक से 1:40 कमजोर पड़ने) के लिए पतला टुनिकामाइसिन । एक नियंत्रण के रूप में, एम 9 में डीएमएसओ की समकक्ष मात्रा को भी पतला करें।
      3. 25 एनजी/mL ट्यूनिकामाइसिन/M9 जोड़ें या कीड़े के लिए DMSO/M9 समाधान नियंत्रण (एक 1.5 mL ट्यूब या एक 15 mL शंकुट्यूब के लिए 2 mL के लिए 400-500 mL का उपयोग करें) । 3-4 घंटे के लिए एक घूर्णन मंच पर 20 डिग्री सेल्सियस पर इनक्यूबेट।
        नोट: ट्यूनिकामाइसिन को सीधे वर्म/एम9 मिक्स में भी पतला किया जा सकता है ।
      4. कीड़े को व्यवस्थित करने, M9/TM समाधान को हटाने और M9 के 1 mL के साथ धोने की अनुमति दें ।
      5. एनजीएम प्लेटों या एनजीएम आरएनएआई प्लेटों में जानवरों को स्थानांतरित करें और रातोंरात (या ~ 15-20 घंटे) को ठीक करने और फ्लोरोसेंट माइक्रोस्कोपी (धारा 5) प्रदर्शन करने से पहले 20 डिग्री सेल्सियस पर वयस्कता के दिन 1 तक पहुंचने की अनुमति दें। एफएफपी के एक पता लगाने योग्य स्तर को जमा करने की अनुमति देने के लिए एक रात की वसूली की जाती है।
      6. वैकल्पिक रूप से, 16-24 घंटे के लिए 25 एनजी/μL ट्यूनिकामाइसिन युक्त आगर प्लेटों के लिए L4 जानवरों को ले जाकर hsp-4p: GFP प्रेरित करें । इसमें एचएसपी-4पी का अधिक मजबूत प्रेरण है:: तनाव की लंबी अवधि के कारण जीएफपी, और इस प्रकार गतिशील सीमा ऊपर वर्णित परख की तुलना में बहुत कम है।
  2. यूपीआरएमटी की सक्रियता के लिए एक readout के रूप में एचएसपी-6p का उपयोग करना: जीएफपी
    1. आरएनएआई का उपयोग करके माइटोकॉन्ड्रियल तनाव को प्रेरित करना
      1. सेक्शन 4.1.1 के रूप में एक ही प्रोटोकॉल के बाद यूपीआरएमटी को सक्रिय करें, इसमें माइटोकॉन्ड्रियल जीन के आरएनएआई नॉकडाउन का उपयोग करने के अलावा कॉक्स-5बी/सीको-1 (साइटोक्रोम सी ऑक्सीडेस सबयूनिट 5बी; नॉकडाउन इलेक्ट्रॉन ट्रांसपोर्ट चेन गतिविधि को रोकता है) । इलेक्ट्रॉन परिवहन श्रृंखला समारोह में क्षोभ के माध्यम से UPRमीट्रिक टन सक्रियण के लिए, आरएनएआई नॉकडाउन को प्रारंभिक विकास20के दौरान किए जाने की आवश्यकता है। इसलिए, इन प्रयोगों के लिए हैच से RNAI प्रदर्शन करें।
    2. रासायनिक एजेंट का उपयोग करके माइटोकॉन्ड्रियल तनाव को प्रेरित करना
      1. धारा 3 में ब्याज के जीन को लक्षित करने वाले आरएनएआई बैक्टीरिया के साथ देखी गई प्लेटें तैयार करें। आरएनएआई नॉकडाउन (सेक्शन 1 देखें) को शामिल नहीं करने वाले प्रयोगों में भी HT115 बैक्टीरिया का उपयोग करें। सुनिश्चित करें कि दोनों NGM RNAi प्लेटें (या NGM RNAI + DMSO0.2) और NGM RNAi + एंटीमाइसिन एक प्लेट्स(तालिका 1)दोनों चरण 4.2.2.5 के लिए तैयार हैं।
      2. Hsp-6p: GFP या hsp-60p:: GFP रिपोर्टर जानवरों धारा 2 में वर्णित तरीकों का उपयोग कर ।
      3. टेबल 2में अनुशंसित मानदंडों का उपयोग करके पसंद की वरीयता प्राप्त प्लेटों पर प्लेट अंडे। चूंकि डीएमएसओ में एंटीमाइसिन ए भंग हो जाता है, इसलिए हैच से एनजीएम आरएनएआई + डीएमएसओ0.2 प्लेटों पर जानवरों को उगाएं।
      4. एल4 चरण में 2 दिनों (~ 56 एच) के लिए 20 डिग्री सेल्सियस पर अंडे इनक्यूबेट करें। वैकल्पिक रूप से, जानवरों को 3 दिनों (~ 75 एच) के बजाय 15 डिग्री सेल्सियस पर उगाएं।
      5. एनजीएम आरएनएआई + डीएमएसओ0.2 प्लेटों से कीड़े को एनजीएम आरएनएआई + एंटीमाइसिन ए प्लेट्स या एनजीएम आरएनएआई + डीएमएसओ0.2 प्लेटों से नियंत्रण के रूप में ले जाएं। कीड़े को छोटे पैमाने पर प्रयोगों के लिए एक पिक के साथ मैन्युअल रूप से स्थानांतरित किया जा सकता है, लेकिन बड़े पैमाने पर प्रयोगों के लिए, हम M9 के साथ जानवरों को धोने की सलाह देते हैं, सेंट्रली के साथ बसने, M9 को एस्पिरेटिंग करते हैं, और फिर एनजीएम आरएनएआई + एंटीमाइसिन ए प्लेट्स को चढ़ाते हैं।
      6. एक अतिरिक्त ~ 20 एच और छवि के लिए एक अतिरिक्त ~ 20 एच और छवि के लिए इनक्यूबेट कीड़े दिन 1 वयस्क (धारा 5) ।
  3. जीएसटी-4p का उपयोग करना:: ऑक्सीडेटिव स्ट्रेस रिस्पांस के लिए रीडआउट के रूप में जीएफपी।
    1. आरएनएआई का उपयोग करके ऑक्सएसआर को प्रेरित करना
      1. वैकल्पिक रूप से, जीएसटी-4p को प्रेरित करें:: जीएफपी डब्ल्यूडीआर-23 के आरएनएआई-नॉकडाउन का उपयोग करके (यह एसकेएन-1के नकारात्मक नियामक को एन्कोड करता है; इस प्रकार, इसका नॉकडाउन ऑक्सएसआर को प्रेरित करता है) धारा 4.1.1 में वर्णित प्रोटोकॉल का उपयोग करता है।
    2. ऑक्सीडेंट टर्ट-ब्यूटिल हाइड्रोपेरोक्साइड (टीबीएचपी) के संपर्क का उपयोग करके ऑक्सएसआर को प्रेरित करना
      1. धारा 3 में ब्याज के जीन को लक्षित करने वाले आरएनएआई बैक्टीरिया के साथ देखी गई प्लेटें तैयार करें। आरएनएआई नॉकडाउन (सेक्शन 1 देखें) को शामिल नहीं करने वाले प्रयोगों में भी HT115 बैक्टीरिया का उपयोग करें।
      2. जीएसटी-4पी को सिंक्रोनाइज करें::जीएफपी रिपोर्टर जानवरों ने सेक्शन 2 में बताए गए तरीकों का इस्तेमाल किया।
      3. टेबल 2में अनुशंसित मानदंडों का उपयोग करके पसंद की वरीयता प्राप्त प्लेटों पर प्लेट अंडे। दवा उपचार प्रोटोकॉल के परिणामस्वरूप आवश्यक से अधिक प्लेटें तैयार करना सुनिश्चित करें जिसके परिणामस्वरूप जानवरों का 10-20% नुकसान होता है। इमेजिंग के लिए, 100 जानवरों से शुरू करें, और छंटाई के लिए, 1,000 जानवरों से शुरू करें।
      4. एल4 चरण में 2 दिनों (~ 56 एच) के लिए 20 डिग्री सेल्सियस में अंडे इनक्यूबेट करें। वैकल्पिक रूप से, जानवरों को 3 दिनों (~ 75 एच) के बजाय 15 डिग्री सेल्सियस पर उगाएं।
      5. प्लेटों से L4 जानवरों को धोएं और प्रति शर्त दो 15 15 mL शंकुट्यूब में विभाजित करें। एस्पिरेट वॉल्यूम कम से कम 1 mL तक नीचे और हौसले से बने 2 mM TBHP की बराबर मात्रा जोड़ें। कम से कम 2 mL करने के लिए कुल तरल मात्रा का उपयोग करें, क्योंकि कम मात्रा कताई करते समय कीड़े की महत्वपूर्ण मौत का कारण बन सकती है। दवा उपचार से पहले धोएं नहीं, क्योंकि प्लेटों से अवशिष्ट बैक्टीरिया इनक्यूबेशन के दौरान ओवरस्टारन नहीं करने के लिए कीड़े सुनिश्चित करने में मदद करेंगे।
      6. 20 डिग्री सेल्सियस पर 4 घंटे के लिए रोटेटर पर इनक्यूबेट कीड़े।
      7. 1,000 x ग्रामपर कताई द्वारा कीड़े धोएं, M9 + TBHP मिश्रण को एस्पिरेटिंग करें, और M9 के 15 मिलील के साथ बदलें। दूसरे धोने के लिए दोहराएं।
      8. ईवी RNAI पर प्लेट कीड़े 20 डिग्री सेल्सियस पर रात भर ठीक करने के लिए (~ 16-24 घंटे) । कीड़े पसंद के RNAi मिलान पर बरामद किया जा सकता है, लेकिन कोई महत्वपूर्ण अंतर जब EV RNAi पर बरामद देखा गया, तो यह प्रयोगात्मक सेट अप की आसानी के लिए किया जा सकता है । वसूली के बाद दिन 1 वयस्कों की छवियां ले लो।
        नोट: एक रात वसूली के लिए GFP के एक पता लगाने योग्य स्तर जमा करने के लिए अनुमति देने के लिए किया जाता है । इस वसूली के बिना, कोई पता लगाने योग्य जीएफपी सिग्नल नहीं है। यदि एक छोटी अवधि की वसूली वांछित है, तो धारा 4.3.3 में वर्णित परख का उपयोग करना संभव है।
    3. रासायनिक ऑक्सीडेंट पैराक्विट (PQ) के संपर्क का उपयोग करके ऑक्सएसआर को प्रेरित करना
      1. धारा 4.2.2 में सभी चरणदोहराएं L4 जीएसटी-4p के 2 बैच प्राप्त करने के लिए::जीएफपी जानवरों को प्रति स्थिति 15 मिलील शंकुट्यूब में प्राप्त करें।
      2. एस्पिरेट वॉल्यूम कम से कम 1 mL तक नीचे और हौसले से बने 100 माइक्रोएम पीक्यू की बराबर मात्रा जोड़ें। 4.3.2.5 के समान, 2 मिलीएल की न्यूनतम मात्रा की सिफारिश की जाती है।
      3. 20 डिग्री सेल्सियस पर 2 घंटे के लिए रोटेटर पर इनक्यूबेट कीड़े।
      4. 1,000 x ग्रामपर कताई द्वारा कीड़े धोएं, M9 + PQ मिश्रण को स्थगित करें, और M9 के 15 मिलील के साथ बदल ें। दूसरे धोने के लिए दोहराएं।
      5. ईवी RNAI पर प्लेट कीड़े 20 डिग्री सेल्सियस पर 2 घंटे के लिए ठीक करने के लिए, और फिर वसूली के तुरंत बाद छवियों को ले लो ।
        नोट: 2 घंटे की रिकवरी जीएफपी इंडक्शन की कल्पना करने के लिए आवश्यक न्यूनतम वसूली थी।
  4. एचएसआर सक्रियण के लिए एक readout के रूप में HSP-16.2 p::GFP और hsp-70p:: GFP का उपयोग करना।
    1. ऊंचा तापमान के लिए जोखिम का उपयोग कर एचएसआर प्रेरित
      1. धारा 3 में ब्याज के जीन को लक्षित करने वाले आरएनएआई बैक्टीरिया के साथ देखी गई प्लेटें तैयार करें। HT115 बैक्टीरिया का प्रयोग करें, यहां तक कि प्रयोगों में RNAi नॉकडाउन शामिल नहीं (परिचय देखें) ।
      2. Hsp-16.2 p:: GFP या hsp-70p:: GFP रिपोर्टर जानवरों धारा 2 में वर्णित तरीकों का उपयोग कर ।
      3. टेबल 2में अनुशंसित मानदंडों का उपयोग करके पसंद की वरीयता प्राप्त प्लेटों पर प्लेट अंडे। 2x तैयार करना सुनिश्चित करें क्योंकि आधे नमूने गर्मी-सदमे में शामिल होने के लिए ऊंचा तापमान के संपर्क में आ जाएंगे, और दूसरा आधा एक गैर-गर्मी-सदमे वाले नियंत्रण के रूप में काम करेगा।
      4. वयस्कता के दिन 1 पर प्रयोग करने के लिए लगभग 3-4 दिनों (~ 65-96 एच) के लिए 20 डिग्री सेल्सियस पर अंडे इनक्यूबेट करें। गर्मी-झटके प्रयोगों के लिए 15 डिग्री सेल्सियस पर कीड़े न उगाएं क्योंकि 15 डिग्री सेल्सियस बनाम 20 डिग्री सेल्सियस में से गर्मी-सदमे का अनुभव करने वाले जानवरों के बीच केवल मामूली अंतर है।
      5. प्लेटों में गर्मी का सबसे तेज और सबसे समान वितरण सुनिश्चित करने के लिए इनक्यूबेटर में 2 घंटे के लिए 34 डिग्री सेल्सियस इनक्यूबेटर के लिए जानवरों के प्रयोगात्मक समूहों को स्थानांतरित करें(यानी, प्लेटों का कोई स्टैकिंग नहीं) ।
      6. गर्मी से हैरान जानवरों को 2 घंटे के लिए ठीक करने के लिए 20 डिग्री सेल्सियस इनक्यूबेटर पर ले जाएं और फिर तुरंत छवि बनाएं (धारा 5 देखें)। उच्च GFP प्रेरण के लिए आवश्यक होने पर जानवरों को लंबे समय तक ठीक किया जा सकता है।
        नोट: 2 घंटे की रिकवरी जीएफपी इंडक्शन की कल्पना करने के लिए आवश्यक न्यूनतम वसूली थी।

5. स्टीरियो माइक्रोस्कोप या कम आवर्धन वाइड-फील्ड/कंपाउंड माइक्रोस्कोप का उपयोग करके इमेजिंग

  1. फ्लोरोसेंट माइक्रोस्कोपी के लिए कीड़े की तैयारी
    1. एक मानक एनजीएम प्लेट (यानी, कोई बैक्टीरिया) के शीर्ष पर 100 mM सोडियम एजाइड के पिपेट 5-10 माइक्रोन।
      नोट: सोडियम अजाइड एकाग्रता को 10 mM के रूप में कम के रूप में नीचे लाया जा सकता है, हालांकि सबसे मजबूत स्थिरीकरण फ्लोरोसेंट सिग्नल पर कोई पता लगाने योग्य प्रभाव के साथ १०० mM सोडियम अजाइड पर मनाया गया था ।
    2. एक विच्छेदन माइक्रोस्कोप के तहत, प्रायोगिक प्लेटों से 10-20 जानवरों को चुनें, और सोडियम अजाइड के स्थान पर स्थानांतरित करें। जानवरों को सोडियम अजाइड में उतरने के तुरंत बाद आंदोलन बंद कर देना चाहिए, और सोडियम अजाइड सेकंड के भीतर ही लुप्त हो जाएगा।
    3. एक बार सोडियम अजाइड सुखाया गया है, वांछित इमेजिंग सेटअप के लिए जानवरों को लाइन । सभी जानवरों के लिए एक ही अभिविन्यास में पूर्वकाल और पीछे पक्षों के साथ जानवरों के साथ-साथ ले जाएं। छवि जानवरों तुरंत।
      नोट: रिपोर्टर सिग्नल में कोई परिवर्तन सोडियम azide में पंगु बनाने के बाद 15 मिन तक के लिए तालिका 3 में प्रतिलेखन संवाददाताओं में से किसी के लिए नहीं देखा गया ।
  2. एक स्टीरियोमाइक्रोस्कोप का उपयोग कर छवि अधिग्रहण
    नोट: इस प्रोटोकॉल के लिए, एक Leica M205FA माइक्रोस्कोप एक Leica DFC3000G मोनोक्रोमेटिक सीसीडी कैमरा, मानक Leica GFP फिल्टर (पूर्व 395-455, EM 480 एलपी), और लास एक्स सॉफ्टवेयर से लैस इस्तेमाल किया गया था। एक्सपोजर समय के लिए अनुशंसित सेटिंग्स तालिका 4में पाई जा सकती हैं।
    1. लास एक्स कार्यक्रम लॉन्च।
    2. एक नई परियोजना शुरू करें: अधिग्रहण टैब खोलें, खुली परियोजनाओं पर क्लिक करें और एक नई परियोजना खोलने के लिए फ़ोल्डर पर क्लिक करें। इस परियोजना को फ़ोल्डर पर सही क्लिक करके नाम दिया जा सकता है और F2 का नाम बदलने या क्लिक करने के लिए नीचे स्क्रॉल किया जा सकता है। अधिग्रहण टैब में, एक्सपोजर समय को समायोजित करने और वांछित सेटिंग्स में ज़ूम करने के विकल्प भी हैं।
    3. माइक्रोस्कोप उद्देश्य के तहत कीड़ा नमूना स्थिति और फ्लोरोसेंट ब्लीचिंग को कम करने के लिए उज्ज्वल क्षेत्र सेटिंग का उपयोग कर कीड़े के सही केंद्र बिंदु का पता लगाने। नमूने का केंद्र वह जगह है जहां अंडे की रेखा स्पष्ट रूप से दिखाई देती है और फजी नहीं होती है। वांछित सेटिंग्स के लिए एक्सपोजर समय सेट करें, ज़ूम, फोकस और उज्ज्वल-फ़ील्ड कंडेनसर।
    4. कैप्चर इमेज बटन का उपयोग करके एक छवि प्राप्त करें।
    5. छवि को .lif (Leica Image File) प्रारूप में सहेजें क्योंकि यह सभी कच्चे छवियों और मेटाडेटा को बचाता है। एक झगड़ा भी सही छवि (या परियोजना) पर क्लिक करके निर्यात किया जा सकता है और विकल्प के रूप में सहेजें के तहत, TIFFक्लिक करें । यह किसी भी संशोधन के साथ सभी चैनलों (जैसे, उज्ज्वल क्षेत्र और GFP) को संग्रहीत करेगा (उदाहरण के लिए, यदि इसके विपरीत समायोजित किया गया था, तो इसे झगड़ा में सहेजा जाएगा)।
  3. फ्लोरोसेंट छवियों का मात्रात्मक विश्लेषण
    1. यदि मात्रात्मक विश्लेषण किया जाएगा, तो 3-डी छवियां लें। यह शीर्ष दाईं ओर "जेड" के साथ लेबल किए गए जेड-सेक्शन विकल्प पर क्लिक करके किया जाता है। यदि यह बॉक्स लाल है तो जेड-सेक्शन सक्रिय होंगे।
    2. समायोज्य विकल्पों के नीचे बाईं ओर रेंज और स्लाइस मोटाई का चयन करके जेड-अनुभागों का अनुकूलन करें। जब भी संभव हो, इष्टतम सेटिंग्स के लिए सिस्टम ऑप्टिमाइज़ बटन का उपयोग करें।
    3. छवि को कैप्चर करें और धारा 5.2 में वर्णित छवि को संग्रहीत करें। आसान माप के लिए उन दोनों के बीच रिक्त स्थान के साथ कीड़े को लाइन करें।
    4. पसंद के इमेजिंग सॉफ्टवेयर (जैसे, इमेजजे) में झगड़ा छवियों का आयात करें।
    5. इमेजजे के लिए, विश्लेषण मेनू से, सेट मापचुनें। निम्नलिखित की जांच करें: क्षेत्र, मतलब ग्रे मूल्य, एकीकृत घनत्व, प्रदर्शन लेबल।
    6. आरओआई (ब्याज का क्षेत्र) उपकरण का उपयोग करके, आरओआई आकर्षित करें। प्रत्येक कीड़ा को व्यक्तिगत रूप से मापें। विश्लेषण मेनू से, उपाय चुनें या एमदबाएं। पृष्ठभूमि में एक आरओआई ड्रा करें जहां कोई कीड़े नहीं हैं, और फिर पृष्ठभूमि को उसी तरीके से मापते हैं। परिणाम खिड़की में दिखाई देने वाले मापों को कॉपी या सहेजें।
    7. प्रत्येक मापा आरओआई के एकीकृत घनत्व से पृष्ठभूमि एकीकृत घनत्व घटाना। आरओआई के लिए पृष्ठभूमि तीव्रता को पृष्ठभूमि के उत्पाद के रूप में परिभाषित किया गया है जिसका अर्थ ग्रे मूल्य और आरओआई के क्षेत्र से तैयार किया गया है।
  4. एक यौगिक/वाइड-फील्ड माइक्रोस्कोप का उपयोग करके छवि अधिग्रहण
    नोट: एक यौगिक/वाइड-फील्ड माइक्रोस्कोप का उपयोग करके प्रतिलेखन संवाददाताओं की इमेजिंग के लिए, यह प्रोटोकॉल ओलंपस 4x प्लान फ्लोराइट एनए 0.13 ऑब्जेक्टिव लेंस, एक मानक ओलंपस फिटेक फिल्टर (पूर्व 470/40; em 525/50) से लैस एक घूमना इको R4 माइक्रोस्कोप का उपयोग करता है; डीएम 560), और कैमरे के लिए एक iPad प्रो और इको सॉफ्टवेयर ड्राइव करने के लिए। एक्सपोजर समय के लिए अनुशंसित सेटिंग्स तालिका 4में पाई जा सकती हैं।
    1. कंट्रोल प्रोग्राम लॉन्च करने के लिए टचपैड का इस्तेमाल करें। एक नया एल्बम बनाएं और नाम फाइल करें।
    2. ऑब्जेक्टिव लेंस के नीचे पोजीशन प्लेट। बेसलाइन (EV/control treatment) और सकारात्मक नियंत्रण का उपयोग करके एक्सपोजर समय और फ्लोरेसेंस तीव्रता निर्धारित करें, ताकि संकेत दिखाई दे लेकिन संतृप्त न हो ।
    3. एक उज्ज्वल क्षेत्र छवि और GFP/FITC छवि सहेजें ।

6. एक बड़े कण प्रवाह साइटोमीटर का उपयोग कर संवाददाताओं के मात्रात्मक माप

नोट: बड़े कण प्रवाह साइटोमीटर विश्लेषण के लिए कीड़े की वृद्धि और तैयारी फ्लोरोसेंट इमेजिंग के लिए कीड़े तैयार करने के लिए धाराओं 1-5 के रूप में एक ही प्रतिमान का पालन कर सकते हैं, अपवाद के साथ कि जानवरों की एक बड़ी संख्या की आवश्यकता है । प्रति स्थिति और gt;500 जानवरों का उपयोग करें, क्योंकि कुछ जानवर हेरफेर के दौरान खो जाते हैं, सभी जानवर क्वांटिफिकेशन के दौरान फ़िल्टरिंग मानदंड नहीं गुजरते हैं, और कुछ जानवरों को प्रवाह साइटोमीटर द्वारा ठीक से नहीं पढ़ा जाता है। प्रवाह साइटोमीटर पर बाद में छंटाई के लिए 15 मीटर शंकुट्यूब में M9 समाधान के 5-10 mL में प्लेटों को छांटने के लिए तैयार जानवरों को धोएं।

  1. एक बड़े कण प्रवाह साइटोमीटर का उपयोग कर छंटाई सेटअप
    1. प्रवाह साइटोमीटर चालू करने से पहले
      1. सुनिश्चित करें कि म्यान तरल बोतल खाली नहीं है। सॉर्टर का उपयोग करने से कम से कम कुछ घंटे पहले 250x स्टॉक से म्यान तरल तैयार करें, क्योंकि म्यान तरल पदार्थ में डिटर्जेंट की एक छोटी राशि है, जो बुलबुले का कारण बन सकती है जो अधिग्रहण के दौरान कलाकृतियों का कारण बन सकती है।
      2. सुनिश्चित करें कि सभी अपशिष्ट कंटेनर पूर्ण नहीं हैं।
    2. प्रवाह साइटोमीटर चालू करना
      1. एयर कंप्रेसर चालू करें। इसे ऑटोमें घुमाें। प्रेशर गेज की जांच करें - यह लगभग 30 साई होना चाहिए।
      2. यंत्र चालू करें। उपकरण के बाईं ओर पावर कॉर्ड के बगल में होने वाले पावर स्विच का उपयोग करें।
      3. लेजर चालू करें। एक 488 एनएम प्रकाश स्रोत आमतौर पर अधिकांश प्रयोगों के लिए पर्याप्त होता है, हालांकि लाल फ्लोरेसेंस के लिए उच्च उत्तेजना की आवश्यकता होने पर 561 एनएम प्रकाश स्रोत का उपयोग करने की आवश्यकता होती है।
      4. फ्लोपायलट सॉफ्टवेयर खोलें; उपकरण को विभिन्न वाल्वों पर स्विच करने वाले क्लिक ों की एक श्रृंखला बनानी चाहिए।
      5. स्टार्टपर क्लिक करके सॉफ्टवेयर विंडो में लेजर चालू करें। रनपर क्लिक करके आर्गन लेजर कंट्रोल पॉपअप विंडो में लेजर शुरू करें। यह लेजर चालू करने के लिए और 12 mW के आसपास तक पहुंचने के लिए कारण होना चाहिए । 488 लाइट सोर्स लेवल बढ़कर 12 के आसपास हो जाएगा।
      6. खिड़की बंद करने के लिए किया क्लिक करें ।
    3. प्रगति से पहले सॉफ्टवेयर पर जांच
      1. प्रेशर गेज की जांच करें - विंडो के नीचे प्रदर्शित 4 दबाव मूल्यों को देखें। मान मूल सेटअप (म्यान 5.5-5.7) के आसपास होना चाहिए; नमूना 5.7-6.0; सॉर्टर 3.1-3.3; साफ 8.5-8.7) । यदि यह समान दिखता है, तो प्रेशर ओकेके बगल में बॉक्स की जांच करें।
      2. तरल पदार्थों की जांच करें -यह सुनिश्चित करने के लिए कि प्रवाह कोशिका के माध्यम से म्यान/नमूने के प्रवाह को अवरुद्ध करने वाले कोई हवा के बुलबुले और मलबे नहीं हैं, कई बार साफ करें।
      3. म्यान प्रवाह दर की जांच करें - इसके लिए, 60 एस स्विच ऑफ सॉर्टके लिए म्यान इकट्ठा करें, फिर म्यान के प्रवाह को शुरू करने के लिए मैनुअल नियंत्रण में म्यान पर स्विच करें। 60 एस के लिए 15 mL ट्यूब में लीजिए; प्रवाह दर ~ 9-10 मीटर/मिन होनी चाहिए।
    4. प्रवाह साइटोमीटर के उपयोग से पहले सफाई
      1. संग्रह 'कप' में 10% ब्लीच समाधान के ~ 3-5 mL रखो और क्लिक करें अधिग्रहण। ~ 30 एस के लिए चलाने दें, गर्भपातपर क्लिक करें, और वैक्यूम के साथ अतिरिक्त हटा दें।
      2. संग्रह 'कप' को डिओनाइज्ड पानी के साथ कुल्ला करें और वैक्यूम के साथ हटा दें। 2x दोहराएं।
      3. संग्रह 'कप' में कोपास सफाई समाधान के ~ 3-5 mL रखो और अधिग्रहणपर क्लिक करें। ~ 30 एस के लिए चलाने दें, गर्भपातपर क्लिक करें, और वैक्यूम के साथ अतिरिक्त सफाई समाधान को हटा दें।
      4. संग्रह 'कप' को डिओनाइज्ड पानी के साथ कुल्ला करें और वैक्यूम के साथ हटा दें। 2x दोहराएं।
      5. संग्रह 'कप' में M9 समाधान के ~ 3-5 mL रखो और क्लिक करें अधिग्रहण। ~ 30 एस के लिए चलाने दें, स्टॉप पर क्लिक करें,और वैक्यूम के साथ अतिरिक्त M9 समाधान निकालें।
  2. सॉर्टर पर नमूने चल रहे हैं
    1. लेजर पीएमटी पावर और साइज गेटिंग को उस स्थिति के आधार पर एडजस्ट करें जो ब्याज के ट्रांसक्रिप्शनरिपोर्टर की प्रतिभाशाली सक्रियता का कारण बनता है । अनुशंसित सेटिंग्स तालिका 4में पाई जा सकती हैं।
    2. 'कप' में तैयार कीड़े जोड़ें। क्लिक करें अधिग्रहण. यह सुनिश्चित करने के लिए देखें कि सभी तरल मशीन में नहीं लिया जाता है; इससे फ्लो साइटोमीटर हवा में ले जाएगा और डिटेक्टर में बुलबुले पैदा होंगे।
    3. क्लिक करें गर्भपात जब नमूना कम है और/
    4. क्लिक करें सेटअप । डेटा स्टोरेज । केवल गेटेड। इससे साइज की दिक्कतों के आधार पर ही डाटा की बचत होगी। स्टोर गेटपर पर क्लिक करें और गेटेड डेटा बचाएं। क्लिक करें डेटा मिटाने के लिए मिटाएं.
    5. संग्रह 'कप' को डिओनाइज्ड पानी के साथ कुल्ला करें और वैक्यूम के साथ हटा दें। 2x दोहराएं।
    6. बाकी नमूनों के साथ चरण 6.2.1-6.2.5 दोहराएं।
  3. अंशांकन/गुणवत्ता नियंत्रण - यदि आवश्यक हो
    नोट: यह नियंत्रण ४२ μM GYR फ्लोरोसेंट कणों प्रदान की, ४८८ लेजर जांचना चलाने की आवश्यकता है ।
    1. एयर ट्यूब को हटाने के लिए नमूना कप के शीर्ष पर धातु के होंठ दबाएं। टोपी को खोलें और नमूना कप से तरल को हटाने के लिए सिरिंज का उपयोग करें।
    2. उपयोग से पहले नियंत्रण कणों की बोतल को अच्छी तरह से मिलाएं और नमूना कप में कुछ मिलीलीटर जोड़ें। टोपी बंद करो और हवा पर वापस डाल जब तक यह जगह में क्लिक करता है पर दबाने से ।
    3. सॉफ्टवेयर में, टूल्स ऑप्शन पर जाएं और रन कंट्रोल पार्टिकल्सपर क्लिक करें ।
    4. नियंत्रण कणों के लिए, पीएमटी मूल्यों को रीसेट करें: ग्रीन - 325; पीला - 365; लाल - 575।
    5. क्लिक करें अधिग्रहण. म्यान नमूना के बाद चालू होना चाहिए। एक बार मोतियों के प्रवाह सेल के माध्यम से जाना शुरू करने के लिए, प्रवाह दर स्क्रीन के तल पर देखा जाएगा । इष्टतम, प्रवाह दर 5/s और 15/s के बीच होनी चाहिए । यदि प्रवाह दर बहुत कम या शून्य है, तो प्रवाह दर को बढ़ाने के लिए नमूना वाल्व को शारीरिक रूप से दक्षिणावर्त चालू करें। यदि प्रवाह दर बहुत अधिक है, तो प्रवाह दर को कम करने के लिए नमूना वाल्व को शारीरिक रूप से एंटी-क्लॉकवाइज करें।
      नोट: आम तौर पर, मनका सेवर मोड के तहत, स्विच ऑफ करने से पहले 500 मोतियों को पढ़ा जाता है। डेटा को मिटाया जा सकता है और मोती फिर से पढ़ा जा सकता है।
    6. एक बार पढ़ने के पूरा हो जाने के बाद, 5 मापदंडों के साथ-साथ सीवी मूल्यों के लिए स्वच्छ एकल चोटियों की जांच करें। विचरण (सीवी) का गुणांक और 15% होना चाहिए। इसके अलावा, सुनिश्चित करें कि तीन अलग-अलग फ्लोरोसेंट चैनलों के लिए सीवी मूल्य एक दूसरे के करीब हैं।
    7. क्यूसी चेक का रिकॉर्ड बनाएं: फाइल टैब के नीचे, स्क्रीन इमेज के रूप में सेवपर क्लिक करें।
  4. सफाई और शटडाउन
    1. नमूना कप से नमूने को हटाने और धारा 4.1.4 दोहराने के लिए एक वैक्यूम का उपयोग करें।
    2. संग्रह 'कप' में deionized पानी के ~ 3-5 mL रखो और क्लिक करें अधिग्रहण,~ 30 एस के लिए चलाने के लिए, और फिर गर्भपातक्लिक करें । नमूना कप में कुछ आसुत पानी को पीछे छोड़ दें।
    3. सैंपल रिकवरी कप और बेकार की बोतल खाली करें।
    4. सॉफ्टवेयर बंद करें। फाइल टैब के नीचे, एग्जिटपर क्लिक करें। पॉप-अप मेनू में, क्लिक करें बिना मिटाए बंद होजाएं।
    5. लेजर बंद करें, उपकरण बंद करें, और फिर एयर कंप्रेसर बंद कर दें। उपकरण को कवर करने के लिए हैच बंद करें।

7. सी एलिगेंस में तनाव संवेदनशीलता को मापने के लिए शारीरिक परख

  1. ट्यूनिकामाइसिन एक्सपोजर का उपयोग करईआर तनाव संवेदनशीलता का मापन
    1. धारा 3 में ब्याज के जीन को लक्षित करने वाले आरएनएआई बैक्टीरिया के साथ देखी गई एनजीएम आरएनएआई डीएमएसओ प्लेटें तैयार करें। आरएनएआई नॉकडाउन (सेक्शन 1 देखें) को शामिल नहीं करने वाले प्रयोगों में भी HT115 बैक्टीरिया का उपयोग करें। एनजीएम आरएनएआई टीएम प्लेटों को भी बीज देना याद रखें (तालिका 1देखें)। प्लेटों की एक पर्याप्त मात्रा बीज: एनजीएम आरएनएआई डीएमएसओ प्लेटों के ~ 5-7 सेट और एनजीएम आरएनएआई टीएम प्लेटों के ~ 2-3 सेट के लिए योजना।
    2. धारा 2 में वर्णित तरीकों का उपयोग करके पसंद के जानवरों को सिंक्रोनाइज करें।
    3. तालिका 2में अनुशंसित मानदंडों का उपयोग करके एनजीएम आरएनएआई डीएमएसओ वरीयता प्राप्त प्लेटों पर प्लेट अंडे। 2x तैयार करना सुनिश्चित करें आवश्यक प्लेटों की संख्या के रूप में नमूना के आधे NGM RNAI टीएम प्लेटों को हस्तांतरित किया जाएगा ।
    4. वयस्कता के दिन 1 में लगभग 3-4 दिनों (~ 65-96 एच) के लिए 20 डिग्री सेल्सियस पर अंडे इनक्यूबेट करें।
    5. 1 दिन में, जानवरों को अलग प्लेटों पर स्थानांतरित करके उम्र तैयार करें। प्लेटों के संरक्षण के लिए (जैसा कि टीएम लागत अधिक है), प्रति स्थिति 15 जानवरों की 8 प्लेटों का उपयोग करें, प्रति स्थिति कुल 120 जानवरों के लिए। यह स्कोरिंग के लिए प्रति प्लेट जानवरों की एक प्रबंधनीय संख्या की अनुमति देता है और सांख्यिकीय विश्लेषण के लिए जानवरों की एक पर्याप्त राशि की अनुमति देता है, यहां तक कि कुछ सेंसरशिप के साथ ।
    6. पहले 5-7 दिनों के लिए, वयस्क जानवरों को हर दिन संतान से दूर एक नई थाली पर ले जाएं जब तक कि संतान अब दिखाई नहीं दे। इस चरण के दौरान, उन जानवरों को सेंसर करें जो जीते जाते हैं, वल्वल प्रोट्रूशन/विस्फोट ों का प्रदर्शन करते हैं, या प्लेटों के किनारों को रेंगते हैं, क्योंकि ये ईआर तनाव संवेदनशीलता से जुड़ी मौतें नहीं हैं । ध्यान दें कि टीएम उपचार जानवरों में गिरफ्तारी का कारण बनता है, और इस प्रकार हर 2-3 दिनों में इन जानवरों की केवल 1-2 चालें टीएम युक्त प्लेटों के उत्पादन से जुड़ी लागतों को कम करने के लिए पर्याप्त हैं। जंगली प्रकार के जानवरों को DMSO पर ~ 15-17 दिनों और ट्यूनिकामैसिन पर 12-14 दिनों का औसत अस्तित्व होता है।
    7. जानवरों के बाद संतान का उत्पादन बंद कर दिया है, स्कोर जीवन हर 1-2 दिनों जब तक सभी जानवरों के रूप में मृत या सेंसर रन बनाए जाते हैं । टीएम-उच्च संकल्प के लिए वयस्कता के दिन 6-14 के दौरान हर दिन जानवरों का इलाज।
  2. पैराक्विट के संपर्क का उपयोग करके माइटोकॉन्ड्रियल और ऑक्सीडेटिव तनाव संवेदनशीलता का मापन
    1. धारा 3 में ब्याज के जीन को लक्षित करने वाले आरएनएआई बैक्टीरिया के साथ देखी गई प्लेटें तैयार करें। आरएनएआई नॉकडाउन (परिचय देखें) को शामिल नहीं करने वाले प्रयोगों में भी HT115 बैक्टीरिया का उपयोग करें।
    2. धारा 2 में वर्णित तरीकों का उपयोग करके पसंद के जानवरों को सिंक्रोनाइज करें।
    3. तालिका 1में अनुशंसित मानदंडों का उपयोग करके एनजीएम आरएनएआई वरीयता प्राप्त प्लेटों पर प्लेट अंडे। परख प्रति शर्त ~ 60-100 जानवरों के लिए कहते हैं, तो तदनुसार तैयार करते हैं ।
    4. वयस्कता के दिन 1 में लगभग 3-4 दिनों (~ 65-96 एच) के लिए 20 डिग्री सेल्सियस पर अंडे इनक्यूबेट करें।
    5. एम9 समाधान में 100 एमएम पैराक्विट की एक ताजा शीशी तैयार करें।
    6. एक फ्लैट नीचे ९६-अच्छी तरह से थाली के रूप में वांछित के रूप में कई कुओं में M9 + पैराक्वाट के 50-75 μL । आम तौर पर प्रति अच्छी तरह से ~ 8-10 जानवरों वाले प्रति स्थिति ~ 8-10 कुओं की सिफारिश की जाती है। यह प्रति तनाव ~ 80 जानवरों के साथ प्रति अच्छी तरह से जानवरों की एक आसानी से दिखाई संख्या के लिए अनुमति देता है।
    7. प्रति स्थिति 8-10 जानवरों को चुनें और उन्हें M9 + पैराquat युक्त प्रत्येक अच्छी तरह से स्थानांतरित करें। मात्रा में अंतर और पैराक्विट सांद्रता में अनपेक्षित परिवर्तन ों से बचने के लिए जानवरों को कुओं में स्थानांतरित करने के लिए एक पिक का उपयोग करें।
    8. हर 2 एच, प्रत्येक कुएं में जानवरों की मौत के लिए स्कोर। प्लेटों को धीरे से टैप करें, जिससे जीवित जानवरों की पिटाई या झुकना होगा। ध्यान दें कि यह संभव है कि जीवित जानवरों को कभी-कभी मृत के रूप में बनाए जाने के लिए काफी देर तक लकवा मार जाता है। इसलिए, यदि जीवित जानवरों की संख्या पिछले समय बिंदु से जीवित जानवरों की संख्या से अधिक है, तो यह संभावना है कि जानवर जीवित था और इसे अनस्कोरिंग किया जाना चाहिए (उदाहरण के लिए, यदि घंटे 4, 2/10 जानवरों को मृत के रूप में बनाए जाते हैं, और 6 घंटे में, केवल 1/10 जानवर मर चुके हैं, 4 घंटे को 1/10 जानवरों को मृत के रूप में फिर से रेखांकित किया जाना चाहिए)।
  3. ऊंचा तापमान के संपर्क का उपयोग कर गर्मी संवेदनशीलता का मापन
    1. धारा 3 में ब्याज के जीन को लक्षित करने वाले आरएनएआई बैक्टीरिया के साथ देखी गई प्लेटें तैयार करें। आरएनएआई नॉकडाउन (सेक्शन 1 देखें) को शामिल नहीं करने वाले प्रयोगों में भी HT115 बैक्टीरिया का उपयोग करें।
    2. धारा 2 में वर्णित तरीकों का उपयोग करके पसंद के जानवरों को सिंक्रोनाइज करें।
    3. टेबल 1में अनुशंसित मानदंडों का उपयोग करके पसंद की वरीयता प्राप्त प्लेटों पर प्लेट अंडे। थर्मोटॉलरेंस के लिए प्रति शर्त 60-100 जानवर हैं। थर्मोटॉलरेंस परख के लिए, सबसे अच्छा सिंक्रोनाइजेशन के लिए L1 गिरफ्तारी या अंडे रखना परख का उपयोग करें क्योंकि परख में जानवरों की उम्र के आधार पर प्रमुख परिवर्तनशीलता है।
    4. वयस्कता के दिन 1 पर प्रयोग करने के लिए लगभग 3-4 दिनों (~ 65-96 एच) के लिए 20 डिग्री सेल्सियस पर जानवरों को इनक्यूबेट करें। गर्मी-झटके प्रयोगों के लिए 15 डिग्री सेल्सियस पर कीड़े न उगाएं क्योंकि 15 डिग्री सेल्सियस बनाम 20 डिग्री सेल्सियस में से गर्मी-सदमे का अनुभव करने वाले जानवरों के बीच मामूली अंतर है।
    5. 1 दिन में, जानवरों को अलग प्लेटों पर स्थानांतरित करके तैयार करें। यह आम तौर पर 4-6 प्लेटों के साथ प्रति प्लेट ~ 10-15 जानवरों के लिए सिफारिश की है, कुल 60 जानवरों के लिए। यह स्कोरिंग के लिए प्रति प्लेट जानवरों की एक प्रबंधनीय संख्या की अनुमति देता है और जानवरों के लिए न्यूनतम समय के लिए ऊंचा तापमान से बाहर निकाला जा करने के लिए अनुमति देता है ।
    6. जानवरों को 37 डिग्री सेल्सियस इनक्यूबेटर में रखें और हर 2 घंटे स्कोर करें। 5 घंटे में 37 डिग्री सेल्सियस पर थर्मोटॉलरके लिए स्कोरिंग शुरू करें, क्योंकि 5 घंटे से पहले कोई मौत नहीं होती है। औसत थर्मोटॉलरी ~ 9 घंटे में पूरा किया जाता है, इसलिए घंटे 7, 9, और 11 महत्वपूर्ण टाइमपॉइंट हैं, हालांकि इनक्यूबेटर और लैब-टू-लैब परिवर्तनशीलता के कारण, इसे प्रति प्रयोगशाला की आवश्यकता हो सकती है। इसके अलावा, परिवर्तनशीलता को कम करने के लिए कोई भी तरीका मदद करेगा (उदाहरण के लिए, प्लेटों को स्टैकिंग नहीं करना, एक ही इनक्यूबेटर के भीतर एक ही क्षेत्र में प्लेटें रखना, इनक्यूबेटर खुलने या बंद होने में समय को कम करना, एक समय में इनक्यूबेटर से कुछ प्लेटों को कम करने के लिए समय को कम करने के लिए जानवरों को 37 डिग्री सेल्सियस के बाहर खर्च करते हैं, आदि। एक पूर्ण गाइड के लिए,21देखें) ।
    7. 7.3.6 कदम के विकल्प के रूप में, जानवरों को 37 डिग्री सेल्सियस के बजाय 34 डिग्री सेल्सियस पर रखें। 34 डिग्री सेल्सियस पर मीडियन थर्मोटॉलरेंस 14 घंटे से थोड़ा अधिक पर है, इसलिए समय अंक 12, 14 और 16 34 डिग्री सेल्सियस थर्मोटॉलरेंस परख के लिए महत्वपूर्ण हैं।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

तनाव प्रतिक्रियाओं की सक्रियता को मापने के लिए प्रतिलेखन संवाददाताओं का उपयोग करना
यहां, फ्लोरोसेंट ट्रांसक्रिप्शनिक रिपोर्टर्स का उपयोग किया जाता है, जो सी एलिगेंसमें अधिकांश तनाव प्रतिक्रियाओं की सक्रियता को मापने के लिए मजबूत उपकरण के रूप में काम करते हैं। GFP अभिव्यक्ति डिब्बे विशिष्ट तनाव का जवाब देने में शामिल मास्टर प्रतिलेखन नियामकों के विहित लक्ष्यों के प्रमोटर के तहत संचालित है । सामान्य रूप से उपयोग किए जाने वाले प्रतिलेखन रिपोर्टर्स की एक व्यापक सूची तालिका 3में उपलब्ध है ।

सामने आया या गलत मुड़ा प्रोटीन या लिपिड bilayer तनाव के माध्यम से एर homeostasis क्षोभ ईआर गुणवत्ता और समारोह को बहाल करने के लिए ईआर (UPRईआर)के सामने आया प्रोटीन प्रतिक्रिया की सक्रियता का कारण बनता है । यूपीआरईआर में ट्रांसमेम्ब्रेन सेंसर द्वारा परिभाषित 3 अलग-अलग शाखाएं होती हैं: इनोसिटोल-आवश्यक प्रोटीन 1 (IRE1), ट्रांसक्रिप्शन फैक्टर 6 (एटीएफ6) को सक्रिय करना, और प्रोटीन किनेज आरएनए (पीकेआर) - जैसे ईआर किनेज (पीके), जिनमें से सभी सी एलिगेंस7,22,,23में संरक्षित हैं।, सूत्रकृमि में यूपीआरईआर की सक्रियता की निगरानी के लिए सबसे आम उपकरण, एचएसपी-4 प्रमोटर(एचएसपी-4पी::जीएफपी)7के नियंत्रण में जीएफपी व्यक्त करने वाला ट्रांसक्रिप्शनल रिपोर्टर तनाव है। जीन hsp-4 स्तनधारी Hsp70, HSPA5 (या BiP/Grp78) के एक ऑर्थोलॉग एनकोड । ईआर तनाव के समय में जब UPRईआर सक्रिय है, hsp-4p:: GFP रिपोर्टर तनाव GFP व्यक्त करता है । इस रिपोर्टर तनाव के अभाव में ंयूनतम बेसल अभिव्यक्ति है, लेकिन मजबूत GFP अभिव्यक्ति प्रदर्शित करता है जब जानवरों ट्यूनिकामाइसिन(चित्रा 1ए)के संपर्क में हैं । इन मतभेदों को बड़े कण प्रवाह साइटोमीटर(चित्रा 1बी)का उपयोग करके भी निर्धारित किया जा सकता है। इसके अलावा, ईआर तनाव के तहत एचएसपी-4p का शामिल होना पूरी तरह से एक्सबीपी-1के आरएनएआई-नॉकडाउन द्वारा दबाया जा सकता है, क्योंकि इस ट्रांसक्रिप्शनियल रिपोर्टर की सक्रियता ट्रांसक्रिप्शन फैक्टर, एक्सबीपी-112पर निर्भर है ।

यूपीआरईआरके समान, माइटोकॉन्ड्रिया प्रोटेओटॉक्सिक तनाव के खिलाफ अपना सुरक्षात्मक तंत्र है। माइटोकॉन्ड्रियल यूपीआर (यूपीआरएमटी)24नाम के इस तंत्र को मुख्य रूप से ट्रांसक्रिप्शन फैक्टर, एटीएफएस-1 द्वारा विनियमित किया जाता है, जो आयात दक्षता में कमी के कारण तनाव में माइटोकॉन्ड्रिया में प्रवेश करने में विफल रहता है, जिसके परिणामस्वरूप एएफएल2-1 का प्रवेश नाभिक25में होता है । दिलचस्प बात यह है कि माइटोकॉन्ड्रियल प्रक्रियाओं के लिए विभिन्न क्षोभ इस प्रतिक्रिया को सक्रिय कर सकते हैं, जिसमें प्रोटीन एकत्रीकरण, इलेक्ट्रॉन परिवहन श्रृंखला (ईटीसी) परिसरों की दस्तक उपइकाइयां, माइटोकॉन्ड्रियल डीएनए प्रतिकृति तनाव, और माइटोकॉन्ड्रियल प्रोटीन अनुवाद8,,26शामिल हैं। यूपीआरएमटी की सक्रियता की निगरानी ट्रांसजेनिक निर्माण व्यक्त करते हुए कीड़े का उपयोग करके की गई है जिसमें जीएफपी को माइटोकॉन्ड्रियल चैपरोन जीन, एचएसपी-6 और एचएसपी-608के प्रमोटरों के नियमन के तहत रखा गया था। एचएसपी-4p के समान::GFP जानवरों, hsp-6p:: GFP जानवरों तनाव के अभाव में ंयूनतम बेसल संकेत प्रदर्शन । यूपीआरएमटी को प्रेरित करने का सबसे मजबूत तरीका निम्नलिखित माइटोकॉन्ड्रियल प्रोटीन के आरएनएआई-नॉकडाउन के माध्यम से है: कॉक्स-5बी,साइटोक्रोम सी ऑक्सीडेस सबयूनिट वीबी/कॉक्स4 (कॉम्प्लेक्स IV)20, nuo-4,NADH dehydrogenase प्रोटीन (जटिल I)27,या mrps-5,एक माइटोकॉन्ड्रियल राइबोसोमल प्रोटीन28, hsp-6p सक्रिय:: GFP रिपोर्टर । इस रिपोर्टर के माध्यम से GFP अभिव्यक्ति मजबूती से सक्रिय है और इन शर्तों के तहत आसानी से कल्पना और मात्रा निर्धारित किया जा सकता है(चित्रा 2ए-बी)। यूपीआरएमटी को इलेक्ट्रॉन ट्रांसपोर्ट चेन (ईटीसी) के रासायनिक अवरोध के माध्यम से भी ट्रिगर किया जा सकता है, जैसे एंटीमाइसिन ए के साथ, जो साइटोक्रोम सी रिक्टेवरेज (जटिल III) को रोकता है। ईटीसी घटकों के आरएनएआई-नॉकडाउन के समान, एंटीमाइसिन एक उपचार एचएसपी-6पी:: जीएफपी (चित्रा 2सी-डी)के मजबूत प्रेरण का कारण बनता है।

जीवों को ऑक्सीडेटिव तनाव की भावना और प्रतिक्रिया देने की क्षमता बैक्टीरिया से मनुष्यों में29तक मौजूद एक संरक्षित प्रक्रिया है । सी एलिगेंसमें, एनआरएफ2 होमोलॉग, एसकेएन-1, एक महत्वपूर्ण ट्रांसक्रिप्शन फैक्टर के रूप में कार्य करता है, जो पूरे प्रोटीन के दौरान प्रतिक्रियाशील साइस्टीन के कारण रेडऑक्स परिवर्तनों के प्रति संवेदनशील है। एसकेएन-1 एनआरएफ230से बंधे एंटीऑक्सीडेंट प्रतिक्रिया तत्वों के समान व्यापक आम सहमति अनुक्रम के लिए बाध्यकारी के माध्यम से ऑक्सएसआर के प्रतिलेखन सक्रियक में से एक के रूप में कार्य करता है। मनुष्यों में, एनआरएफ 2 को KEAP1 द्वारा नकारात्मक रूप से विनियमित किया जाता है, जिसे प्रोटीन31में प्रतिक्रियाशील साइस्टीन के कारण रेडऑक्स परिवर्तनों के प्रति संवेदनशील माना जाता है। जबकि कीड़े में KEAP1 का कोई प्रत्यक्ष ऑर्थोलॉग नहीं है, SKN-1 को WD-दोहराने वाले प्रोटीन, WDR-23 द्वारा नकारात्मक रूप से विनियमित किया जाता है, जो KEAP1/NRF2 अवरोध32से मशीनी रूप से अलग है। ऑक्टिव स्ट्रेस पर, जैसे टर्ट-ब्यूटिल हाइड्रोपरऑक्साइड (टीबीएचपी), एसकेएन-1 डिटॉक्सिफिकेशन और एंटीऑक्सीडेंट जीन जैसे जीएसटी-4,ग्लूटाथिएक एस-ट्रांसफरेस को सक्रिय करता है । ऑक्सीडेटिव स्ट्रेस को मापने के लिए जीएफपी एक्सप्रेशन को जीएसटी-4के प्रमोटर के तहत रखा गया है, जो ग्लूथेएक एस-ट्रांसफरेज33है। यहां प्रस्तुत अन्य ट्रांसक्रिप्शनल नियामकों के विपरीत, जीएसटी-4पी::जीएफपी में उच्च बेसल अभिव्यक्ति है। हालांकि, इस अभिव्यक्ति को अभी भी ऑक्सीडेटिव तनाव की स्थितियों के तहत मजबूती से सक्रिय किया जा सकता है, जिसे आनुवंशिक और रासायनिक दोनों रूप से किया जा सकता है। आनुवंशिक रूप से ऑक्सीडेटिव तनाव को प्रेरित करने के लिए, हम wdr-23को नॉकआउट करते हैं, जो एक प्रोटीन को एन्कोड करता है जो एसकेएन-134के प्रोटेसोमल क्षरण में भूमिका निभाता है। डब्ल्यूडीआर-23 नॉकडाउन के परिणामस्वरूप जीएसटी-4pकी मजबूत सक्रियता::GFP . इसके अलावा, रासायनिक ऑक्सीडेंट, टीबीएचपी के साथ कीड़े के उपचार के परिणामस्वरूप एक मामूली है, लेकिन अभी भी महत्वपूर्ण, जीएसटी-4p:: GFP (चित्रा 3)की सक्रियता । जीएसटी-4पी का रासायनिक और आनुवंशिक सक्रियण: जीएफपी को ऑक्सएसआर के मास्टर ट्रांसक्रिप्शनल रेगुलेटर को एन्कोडिंग करने वाले जीन एसकेएन-1के आरएनएआई नॉकडाउन से लगभग पूरी तरह से दबाया जा सकता है ।

अधिकांश सेलुलर प्रोटीन साइटोप्लाज्म में अनुवाद कर रहे हैं और वहाँ रहते हैं, भले ही केवल अस्थायी रूप से कहीं और लक्षित होने से पहले। इस प्रकार, साइटोप्लाज्म चैपरोन की एक विविध सरणी होस्ट करता है जो उचित प्रोटीन तह और कार्य को बढ़ावा देता है, साथ ही क्षतिग्रस्त, बेकार या अतिरिक्त प्रोटीन के लिए जिम्मेदार एंजाइम और प्रोटीन भी है। साइटोप्लाज्म के इस जटिल प्रोटीन परिदृश्य की रक्षा के लिए, सेल ने हीट-शॉक रिस्पांस (एचएसआर)35,,36सहित कई साइटोप्लाज्मिक तनाव प्रतिक्रिया रास्ते विकसित किए हैं। एचएसआर गर्मी तनाव की स्थितियों के तहत प्रोटीन होमोस्टोसिस को बढ़ावा देने के लिए समर्पित एक मार्ग है और मास्टर ट्रांसक्रिप्शनल रेगुलेटर, एचएसएफ-1३७द्वारा संग्राहक है । स्थिर राज्य की स्थितियों के तहत, एचएसएफ-1 साइटोप्लाज्मिक चैपरोन, एचएसपी90 और एचएसएसपी70/40 से बंधा हुआ है, जो इसे एकमोनोरिक, निष्क्रिय स्थिति में बंद रखता है । गर्मी या इसी तरह के तनाव की स्थितियों के तहत, गलत मुड़ा प्रोटीन में वृद्धि एचएसएफ-1 से दूर chaperones के titration में परिणाम है, यह ट्रिमिंग और नाभिक को स्थानांतरित करने के लिए एचएसआर३८,,३९सक्रिय करने की अनुमति । शायद एचएसआर सक्रियण के तहत एचएसएफ-1 के सबसे अधिक अध्ययन किए गए डाउनस्ट्रीम लक्ष्य हीट-शॉक प्रोटीन (एचएसपी) हैं, जैसे HSP70, HSP90, DNAJ, और HSP6017,,४०सी एलिगेंसमें, एचएसआर के लिए प्रतिलेखन रिपोर्टर्स को विहित एचएसपी, एचएसपी-16.2 और एचएसपी-709,,41के प्रमोटरों के तहत जीएफपी की अभिव्यक्ति को चलाकर संश्लेषित किया गया है। उनके UPRमीट्रिक टन और UPRईआर समकक्षों की तरह, hsp-16.2 p:: GFP और hsp-70p:: GFP तनाव के अभाव में ंयूनतम बेसल अभिव्यक्ति दिखाओ । हालांकि, दोनों संवाददाताओं को गर्मी तनाव की स्थितियों के तहत मजबूती से प्रेरित किया जाता है, जिसे एक बड़े कण प्रवाह साइटोमीटर(चित्रा 4)का उपयोग करके माइक्रोस्कोपी या मात्रानिर्धारित द्वारा आसानी से कल्पना की जा सकती है। दोनों संवाददाताओं की बड़ी गतिशील रेंज है, और प्रेरण पूरी तरह से एचएसएफ-1पर निर्भर है, क्योंकि एचएसएफ-1 के आरएनएआई-नॉकडाउन पूरी तरह से एचएसपी-16.2 पी:: जीएफपी और एचएसपी-70पी:: जीएफपीके शामिल होने को पूरी तरह से दबा देता है । हालांकि इन संवाददाताओं को ज्यादातर स्थितियों के लिए एक दूसरे के लिए इस्तेमाल किया जा सकता है, वहां अभिव्यक्ति के स्तर और ऊतकों में अभिव्यक्ति में मतभेद हो सकता है ।

सी एलिगेंस में तनाव संवेदनशीलता को मापने के लिए शारीरिक परख
सी एलिगेंस एक महान मॉडल जीव है जो आरएनएआई का उपयोग करके रखरखाव और प्रयोग में कम लागत और जीनोम संपादन या आनुवंशिक नॉकडाउन में आसानी के कारण तनाव संवेदनशीलता को मापने के लिए एक महान मॉडल जीव है, जो पूरे जीव में बड़े पैमाने पर प्रयोग करने की क्षमता प्रदान करता है। ईआर तनाव के लिए तनाव सहिष्णुता परख करने के लिए, हम रासायनिक एजेंट, ट्यूनिकामाइसिन के लिए सी एलिगेंस का पर्दाफाश करते हैं, जो एन-लिंक्ड ग्लाइकोसिलेशन10को अवरुद्ध करके ईआर में क्षतिग्रस्त प्रोटीन के संचय का कारण बनता है। पशुओं को विकास के बाद ट्यूनिकामाइसिन के संपर्क में रखा जाता है, क्योंकि दवा विकासात्मक दोषों का कारण बनती है। जब ट्यूनिकामाइसिन के संपर्क में आता है, तो वयस्क कीड़े उम्र में उल्लेखनीय गिरावट का प्रदर्शन करते हैं। इसके अलावा, जीन का नॉकडाउन, एक्सबीपी-1,जो यूपीआरईआर इंडक्शन में शामिल प्राथमिक प्रतिलेखन कारकों में से एक को एन्कोड करता है, जिसके परिणामस्वरूप ट्यूनिकामाइसिन(चित्रा 5ए)12के प्रति संवेदनशीलता में उल्लेखनीय वृद्धि होती है। इस प्रकार, यह वयस्क कीड़े में ईआर तनाव संवेदनशीलता को मापने के लिए एक मजबूत परख के रूप में कार्य करता है।

ऑक्सीडेटिव तनाव और माइटोकॉन्ड्रियल तनाव को मापने के लिए, हम जानवरों को रासायनिक एजेंट, पैराक्विट के लिए बेनकाब करते हैं। पैराक्विट माइटोकॉन्ड्रियल मैट्रिक्स के भीतर आरओएस के संश्लेषण द्वारा माइटोकॉन्ड्रियल तनाव का कारण बनता है, जिसे तब हाइड्रोजन पेरोक्साइड में परिवर्तित किया जा सकता है और माइटोकॉन्ड्रिया से बाहर निकलना पूरे सेल ऑक्सीडेटिव क्षति13का कारण बनता है। ईआर तनाव परख के समान, हम वयस्कता पर पैराक्विट करने के लिए जानवरों का पर्दाफाश करते हैं । हालांकि, हम लागत और शारीरिक श्रम को कम करने के लिए तरल में पैराक्विट परख प्रदर्शन करते हैं और आगर प्लेट आधारित परख अधिकांश प्रयोगशालाओं के लिए मुश्किल होगा। यहां, हम बताते हैं कि तरल में पैराक्विट के संपर्क में आने वाले जानवर लगभग 5 घंटे(चित्र 5बी)के औसत अस्तित्व को दिखाते हैं। इसके अलावा, इंसुलिन रिसेप्टर, डीएएफ-2के नॉकडाउन के परिणामस्वरूप डीएएफ-16/फॉक्सओ की सक्रियता के रूप में पैराक्विट के प्रतिरोध में वृद्धि होती है, जिसके परिणामस्वरूप एसओडी-3४२,,४३जैसे आरओएस की मंजूरी में शामिल होने की अभिव्यक्ति में वृद्धि होती है । पैराक्विट अस्तित्व के परख कम हैं, 14 घंटे तक चलने वाले हैं, और इस प्रकार माइटोकॉन्ड्रियल और ऑक्सीडेटिव तनाव प्रतिक्रियाओं से पूछताछ करने के लिए एक कुशल विधि के रूप में काम करते हैं।

अंत में, ऊंचा तापमान पर अस्तित्व गर्मी तनाव के लिए शारीरिक प्रतिक्रिया पूछताछ करने के लिए प्रयोग किया जाता है। ये परख तरल या ठोस आगर दोनों में किए जा सकते हैं, और21को उल्लिखित कई अलग-अलग प्रोटोकॉल मौजूद हैं। परिवर्तनशीलता को कम करने के लिए प्रयोगशाला में एक परख को मानकीकृत करने की सिफारिश की जाती है, जो इस परख में असाधारण रूप से उच्च है। थर्मोटॉलरेंस को दिन में किया जाना चाहिए मानक आगर प्लेटों पर 1 वयस्क जानवर, या तो 34 डिग्री सेल्सियस या 37 डिग्री सेल्सियस पर। 37 डिग्री सेल्सियस पर, अधिकांश मृत्यु 7-11 घंटे के बीच होती है, जिससे यह एक साधारण एकल दिन परख हो जाता है, जबकि 34 डिग्री सेल्सियस पर 12-16 घंटे के प्रयोग सबसे आसानी से रातभर किए जाते हैं(चित्रा 5सी-ई)। जीन में उत्परिवर्तन, टीटीएक्स-3,थर्मोसेंसरी तंत्रिका सर्किट के लिए जिम्मेदार एआईवाई इंटरन्यूरॉन्स के विनिर्देश की विफलता के परिणामस्वरूप, और थर्मोसेंसिटिविटी44में उल्लेखनीय वृद्धि का कारण बनता है। जबकि थर्मोटॉलरी डेटा को अस्तित्व वक्र(चित्रा 5सी)के रूप में प्लॉट किया जा सकता है, इन परखों को कम से कम 4-6 बार किया जाना चाहिए और सभी प्रतिकृतियों को एक दूसरे के खिलाफ साजिश रची जानी चाहिए(चित्रा 5डी-ई),क्योंकि थर्मोमेंसी अन्य तनाव परख की तुलना में अविश्वसनीय रूप से उच्च परिवर्तनशीलता दिखाता है। यह इन प्रयोगों की स्थापना में मौजूद कई चेतावनीों के कारण है, जिनमें रुचि के उपभेदों में परिवर्तनशीलता, इनक्यूबेटर में हवा की असमान साइकिलिंग, असमान आगर प्लेटें आदिशामिलहैं । 34 डिग्री सेल्सियस पर, औसत अस्तित्व लगभग 14 घंटे में होता है, और 37 डिग्री सेल्सियस के समान, टीटीएक्स-3 म्यूटेंट प्रदर्शनी 34 डिग्री सेल्सियस(चित्रा 5ई)पर अस्तित्व में कमी आई।

Figure 1
चित्रा 1: UPRER प्रेरण के लिए एक रिपोर्टर के रूप में hsp-4p का उपयोग:: GFP (A) एचएसपी-4पी के प्रतिनिधि फ्लोरोसेंट माइक्रोग्राफ:: जीएफपी ने खाली वेक्टर (ईवी) या एक्सबीपी-1 आरएनएआई को नियंत्रित करने पर उगाए गए जानवरों को व्यक्त किया । जानवरों को हैच से 20 डिग्री सेल्सियस पर L4 तक RNAi पर उगाया गया था, तो 25 एनजी/μL ट्यूनिकामाइसिन या 1% DMSO के साथ इलाज किया गया, जो 4 घंटे के लिए 20 डिग्री सेल्सियस पर एम9 में तैर रहा है, और इमेजिंग से पहले 20 डिग्री सेल्सियस पर 16 घंटे के लिए एक OP50 प्लेट पर बरामद किया गया था । जानवरों को एक NGM आगर प्लेट पर १०० μM सोडियम azide में झोले के साथ और एक स्टीरियोमाइक्रोस्कोप का उपयोग कर छवि थे । (ख)एक बड़े कण बायोसॉर्टर का उपयोग करके(ए)का मात्रात्मक विश्लेषण। डेटा को पूरे जानवर में एकीकृत फ्लोरेसेंस तीव्रता के रूप में दर्शाया जाता है जहां प्रत्येक डॉट एक ही जानवर का प्रतिनिधित्व करता है; डीएमएसओ नियंत्रण ग्रे में है और ट्यूनिकामाइसिन का इलाज जानवरलाल में होते हैं। केंद्रीय रेखा औसत का प्रतिनिधित्व करती है, और मूंछ इंटरक्वार्टाइल रेंज का प्रतिनिधित्व करती है। n = प्रति तनाव 123-291 जानवर। p गैर-पैरामेट्रिक मान-व्हिटनी परीक्षण का उपयोग करपी एंड एलटी; 0.001। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 2
चित्रा 2: यूपीआरएमटी इंडक्शन के लिए रिपोर्टर के रूप में एचएसपी-6पी का उपयोग करना: जीएफपी। (A) एचएसपी-6पी के प्रतिनिधि फ्लोरोसेंट माइक्रोग्राफ:: जीएफपी व्यक्त करने वाले जानवर खाली वेक्टर (ईवी),सीसीओ-1, एमआरपीएस-5,या नू-4 आरएनएआई नियंत्रण पर उगाए जाते हैं । जानवरों को हैच से RNAi पर उगाया गया था और 20 डिग्री सेल्सियस पर वयस्कता के दिन 1 पर छवि । जानवरों को एक NGM आगर प्लेट पर १०० μM सोडियम azide में झोले के साथ और एक यौगिक माइक्रोस्कोप का उपयोग कर छवि थे । (ख)एक बड़े कण बायोसॉर्टर का उपयोग करके(ए)का मात्रात्मक विश्लेषण। डेटा को पूरे जानवर में एकीकृत फ्लोरेसेंस तीव्रता के रूप में दर्शाया जाता है जहां प्रत्येक डॉट एक ही जानवर का प्रतिनिधित्व करता है; EV नियंत्रण ग्रे RNAI में है इलाज जानवरों लाल रंग में हैं । केंद्रीय रेखा औसत का प्रतिनिधित्व करती है, और मूंछ इंटरक्वार्टाइल रेंज का प्रतिनिधित्व करती है। n = 303-384 जानवरप्रति तनाव। गैर-पैरामेट्रिक मान-व्हिटनी परीक्षण का उपयोग करईवी नियंत्रण की तुलना में पी एंड एलटी; 0.001। (ग) एचएसपी-6पी की प्रतिनिधि छवियां:: डीएमएसओ या एंटीमाइसिन ए जानवरों के साथ इलाज किए गए जीएफपी जानवरों को 0.2% DMSO प्लेटों पर हैच से उगाया गया था और घूमना इको R4 यौगिक माइक्रोस्कोप पर इमेजिंग से पहले 16 घंटे के लिए 0.2% DMSO या 3 mM एंटीमाइसिन ए वाली प्लेटों में स्थानांतरित कर दिया गया था। सभी विकास 20 डिग्री सेल्सियस पर किया गया। (ख)(बी)के समान एक बड़े कण बायोसॉर्टर का उपयोग करके मात्रात्मक विश्लेषण DMSO नियंत्रण महान में हैं, और एंटीमाइसिन ए-इलाज जानवरलाल हैं। n = डीएमएसओ के लिए 495 और एंटीमाइसिन ए के लिए 219 पीएंड एलटी; 0.001 गैर-पैरामेट्रिक मान-व्हिटनी परीक्षण का उपयोग करईई नियंत्रण की तुलना में। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 3
चित्रा 3: जीएसटी-4p का उपयोग करना:: ऑक्सएसआर के लिए एक रिपोर्टर के रूप में GFP। (A)जीएसटी-4पी के प्रतिनिधि फ्लोरोसेंट माइक्रोग्राफ::जीएफपी ने खाली वेक्टर (ईवी), स्केन-1या डब्ल्यूडीआर-23 आरएनएआई को नियंत्रित करने वाले जानवरों को व्यक्त किया। जानवरों को हैच से 20 डिग्री सेल्सियस पर L4 चरण तक RNAi पर उगाया गया था । जानवरों को 20 डिग्री सेल्सियस पर L4 तक हैच से RNAi पर उगाया गया था, फिर एम 9 में 2 mM TBHP या केवल M9 के साथ 4 घंटे के लिए 20 डिग्री सेल्सियस पर "अनुपचारित" नियंत्रण के लिए इलाज किया गया, और इमेजिंग से पहले 20 डिग्री सेल्सियस पर 16 घंटे के लिए एक EV प्लेट पर बरामद किया गया । जानवरों को एक NGM आगर प्लेट पर १०० μM सोडियम azide में झोले के साथ और एक यौगिक माइक्रोस्कोप का उपयोग कर छवि थे । (ख)एक बड़े कण बायोसॉर्टर का उपयोग करके(ए)का मात्रात्मक विश्लेषण। डेटा को पूरे जानवर में एकीकृत फ्लोरेसेंस तीव्रता के रूप में दर्शाया जाता है जहां प्रत्येक डॉट एक ही जानवर का प्रतिनिधित्व करता है; अनुपचारित नियंत्रण ग्रे में है और TBHP का इलाज जानवरों लाल रंग में हैं । केंद्रीय रेखा औसत का प्रतिनिधित्व करती है, और मूंछ इंटरक्वार्टाइल रेंज का प्रतिनिधित्व करती है। n = प्रति तनाव 101-204 जानवर। गैर-पैरामेट्रिक मान-व्हिटनी परीक्षण का उपयोग करके संबंधित ईवी नियंत्रण की तुलना में पी एंड एलटी; 0.001। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 4
चित्रा 4: hsp16.2 p का उपयोग:: GFP और hsp-70p:: गर्मी सदमे प्रतिक्रिया के लिए संवाददाताओं के रूप में GFP । (A) hsp16.2 p के प्रतिनिधि फ्लोरोसेंट माइक्रोग्राफ:: जीएफपी ने खाली वेक्टर (ईवी) या एचएसएफ-1 आरएनएआई को नियंत्रित करने पर उगाए गए जानवरों को व्यक्त किया । जानवरों को 1 दिन तक 20 डिग्री सेल्सियस पर हैच से RNAi पर उगाया गया था । दिन 1 जानवरों को या तो 20 डिग्री सेल्सियस (अनुपचारित) पर छोड़ दिया गया या 34 डिग्री सेल्सियस पर 2 घंटे गर्मी के तनाव के संपर्क में आया, फिर 20 डिग्री सेल्सियस पर 2 घंटे के लिए बरामद किया गया। जानवरों को एक NGM आगर प्लेट पर १०० μM सोडियम azide में झोले के साथ और एक स्टीरियोमाइक्रोस्कोप का उपयोग कर छवि थे । (ख)एक बड़े कण बायोसॉर्टर का उपयोग करके(ए)का मात्रात्मक विश्लेषण। डेटा को पूरे जानवर में एकीकृत फ्लोरेसेंस तीव्रता के रूप में दर्शाया जाता है जहां प्रत्येक डॉट एक ही जानवर का प्रतिनिधित्व करता है; अनुपचारित नियंत्रण ग्रे में है और गर्मी से हैरान जानवरलाल हैं । केंद्रीय रेखा औसत का प्रतिनिधित्व करती है, और मूंछ इंटरक्वार्टाइल रेंज का प्रतिनिधित्व करती है। n = प्रति स्ट्रेन 320-364 जानवर। p गैर-पैरामेट्रिक मान-व्हिटनी परीक्षण का उपयोग करपी एंड एलटी; 0.001। (ग) एचएसपी-70पी के प्रतिनिधि फ्लोरोसेंट माइक्रोग्राफ:: जीएफपी ने नियंत्रण EV और एचएसएफ-1 आरएनएआई पर उगाए गए जानवरों को व्यक्त किया और(ए)में वर्णित माना जाता है । (ख)के मात्रात्मक विश्लेषण के रूप में(बी)में वर्णित है ।B n = 773-941 जानवरप्रति तनाव। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 5
चित्रा 5: सी एलिगेंसमें तनाव के तहत शारीरिक अस्तित्व परख । (A)निमाटोड की उम्र 1% डीएमएसओ पर उगाई गई जिसमें 25 एनजी/माइक्रोन ट्यूनिकामाइसिन (टीएम) प्लेटें हैं । जानवरों को 1 दिन तक हैच से 1% DMSO प्लेटों पर उगाया गया था, और 1 दिन में संबंधित टीएम प्लेटों में स्थानांतरित कर दिया गया था। जानवरों को 20 डिग्री सेल्सियस पर परख के अंत तक हैच से खाली वेक्टर (ईवी) या एक्सबीपी-1 आरएनएआई को नियंत्रण में रखा गया था। वयस्क जानवरों को मैन्युअल रूप से हर दिन संतान से दूर ले जाया जाता है जब तक ~ दिन 7-8 जब संतान का अब पता नहीं चला, तो हर 2 दिनों में रन बनाए जब तक सभी जानवरों को मृत या सेंसर के रूप में दर्ज किया गया । बैगिंग, वल्वल फलाव/विस्फोट, या प्लेटों के किनारों को क्रॉल करने वाले जानवरों को सेंसर माना जाता था । (ख)एम9 समाधान में भंग 100 मीटर पैराक्विट (पीक्यू) में नेमाटोड का अस्तित्व वक्र। जानवरों को ईवी या daf-2 RNAi पर हैच से 20 डिग्री सेल्सियस पर वयस्कता के दिन 1 तक उगाया गया था । जानवरों को 20 डिग्री सेल्सियस पर 96 अच्छी प्लेट में M9 + PQ समाधान के 50 μL में रखा गया था और हर 2 घंटे में कल्पना की गई थी जब तक कि सभी जानवर स्थिर नहीं थे। (ग)निमाटोड का सर्वाइवल वक्र 37 डिग्री सेल्सियस पर। जंगली प्रकार (N2), ttx-3 (KS5),और सुर-5p:: एचएसएफ-1 जानवरों को 20 डिग्री सेल्सियस पर 1 दिन तक हैच से EV प्लेटों पर उगाया गया था । 1 दिन में, जानवरों को 37 डिग्री सेल्सियस तक ले जाया गया और हर 2 घंटे में रन बनाए जब तक कि सभी जानवरों को मृत या सेंसर के रूप में नहीं बनाए गए थे। (D)सभी थर्मोमेंसी परसों के डेटा को 37 डिग्री सेल्सियस पर किया गया। डेटा एक थर्मोसहिष्णुता परख के 9 घंटे में जीवित प्रतिशत के रूप में प्रतिनिधित्व कर रहे हैं, प्रत्येक लाइन के साथ एक मिलान प्रयोग का प्रतिनिधित्व एक ही दिन पर प्रदर्शन किया । }सभीथर्मोमेंसी पर34 डिग्री सेल्सियस पर प्रदर्शन किए गए थर्मोमेंसी के आंकड़ों को पूल किया गया। डेटा एक थर्मोसहिष्णुता परख के घंटे 14 में जीवित प्रतिशत के रूप में प्रतिनिधित्व कर रहे हैं, प्रत्येक लाइन के साथ एक मिलान एक ही दिन पर प्रदर्शन प्रयोग का प्रतिनिधित्व । ए-सी के लिए सभी आंकड़े लॉग-रैंक (Mantel-कॉक्स) परीक्षण का उपयोग कर प्रदर्शन किया गया और तालिका 5में पाया जा सकता है । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

अभिकर्मक नुस्खा
Lysogeny शोरबा (पौंड) इस प्रोटोकॉल में, वाणिज्यिक एलबी का उपयोग किया गया था (सामग्री देखें), लेकिन बैक्टो-ट्राइप्टोन, खमीर निकालने और नैल का उपयोग करके सभी मानक एलबी होम-निर्मित व्यंजन पर्याप्त हैं।
सूत्रकृमि विकास मीडिया (एनजीएम) 1 एमएम CaCl2, 5 μg/mL कोलेस्ट्रॉल, 25 mM KPO4 पीएच 6.0, 1 mM MgSO4, 2% (w/v) आगर, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl
ब्लीच समाधान 1.8% (v/v) सोडियम हाइपोक्लोराइट, 0.375 एम कोएच
M9 समाधान 22 एमएम KH2PO4 मोनोबेसिक, 42.3 mM Na2HPO4, 85.6 mM NaCl, 1 mM MgSO4
एनजीएम आरएनएआई प्लेट्स 1 एमएम CaCl2, 5 μg/mL कोलेस्ट्रॉल, 25 mM KPO4 पीएच 6.0, 1 mM MgSO4, 2% (w/v) आगर, 0.25% (w/v) बैक्टो-पेप्टोन, 51.3 m M NaCl, 1 m IPTG, 100 μg/mL कार्बेनिसिलिन/ampicillin। 3 महीने तक अंधेरे में 4 डिग्री सेल्सियस पर स्टोर करें
टेट्रासाइक्लिन 100% इथेनॉल में 10 मिलीग्राम/एमएल स्टॉक सॉल्यूशन (500x)। -20 डिग्री सेल्सियस पर स्टोर करें
कार्बेनिकलिन पानी में 100 मिलीग्राम/एमएल स्टॉक सॉल्यूशन (1000x)। लंबी अवधि के भंडारण के लिए 6 महीने या -20 डिग्री सेल्सियस तक 4 डिग्री सेल्सियस पर स्टोर करें
सोडियम अजाइड 1 एम स्टॉक (~ 6.5%) पानी में सोडियम अजाइड का स्टॉक समाधान। 4 डिग्री सेल्सियस पर अंधेरे में स्टोर करें। यह एक 10x समाधान है और सबसे इमेजिंग प्रयोगों के लिए एक 100 mM काम कर रहे शेयर करने के लिए पतला है
ट्यूनिकामाइसिन 100% डीएमएसओ में 2.5 मिलीग्राम/एमएल स्टॉक सॉल्यूशन। लंबी अवधि के भंडारण के लिए -80 डिग्री सेल्सियस पर स्टोर करें। यह एक 100x समाधान है (25 एनजी/
एंटीमाइसिन ए 15 एमएम एंटीमाइसिन 100% डीएमएसओ में एक स्टॉक सॉल्यूशन। -20 डिग्री सेल्सियस पर स्टोर करें। यह एक 5000x समाधान है (3 μM काम कर रहे स्टॉक)
पैराक्विट पानी में 50 माइक्रोन समाधान - ताजा तैयार किया जाना चाहिए
टर्ट-ब्यूटिल हाइड्रोपेरोक्साइड (टीबीएचपी) पानी में 7.7 एम समाधान। यह एक 3850x समाधान है (2 mM काम कर रहे स्टॉक)
एनजीएम आरएनएआई + डीएमएसओ0.2 1 एमएम CaCl2, 5 μg/mL कोलेस्ट्रॉल, 25 mM KPO4 पीएच 6.0, 1 mM MgSO4, 2% (w/v) आगर, 0.25% (w/v) बैक्टो-पेप्टोन, 51.3 mM NaCl, 1 m IPTG, 100 μg/mL कार्बेनिसिलिन/ampicillin, 0.2% डीएमएसओ
(एंटीमाइसिन ए के लिए नियंत्रण)
एनजीएम आरएनएआई + एंटीमाइसिन ए 1 एमएम CaCl2, 5 μg/mL कोलेस्ट्रॉल, 25 mM KPO4 पीएच 6.0, 1 एमएम MgSO4, 2% (w/v) आगर, ०.२५% (w/v) बैक्टो-पेप्टोन, ५१.३ mM NaCl, 1 mM IPTG, १०० μg/mL carbenicillin/ampicillin, ०.२% DMSO, 3 m am antim
एनजीएम आरएनएआई डीएमएसओ 1 एमएम CaCl2, 5 μg/mL कोलेस्ट्रॉल, 25 mM KPO4 पीएच 6.0, 1 mM MgSO4, 2% (w/v) आगर, 0.25% (w/v) बैक्टो-पेप्टोन, 51.3 m M NaCl, 1 m IPTG, 100 μg/mL कार्बेनिसिलिन/ampicillin; 1% डीएमएसओ
(ट्यूनिकामाइसिन के लिए नियंत्रण)
एनजीएम आरएनएआई टीएम 1 एमएम CaCl2, 5 μg/mL कोलेस्ट्रॉल, 25 mM KPO4 पीएच 6.0, 1 mM MgSO4, 2% (w/v) आगर, 0.25% (w/v) बैक्टो-पेप्टोन, 51.3 m M NaCl, 1 m IPTG, 100 μg/mL कार्बेनिसिलिन/ampicillin; 1% डीएमएसओ, 25 एनजी/माइक्रोन ट्यूनिकमाइसिन
आईपीटीजी पानी में 1 एम समाधान।

तालिका 1: उपयोग किए जाने वाले अभिकर्मकों के लिए अनुशंसित व्यंजन। इस प्रोटोकॉल में इस्तेमाल होने वाले रिएजेंट्स के सभी सटीक व्यंजनों को यहां रेखांकित किया गया है। विशिष्ट कंपनियां जहां अभिकर्मक खरीदे गए थे , सामग्री की तालिकामें भी उपलब्ध हैं । रसायनों के कई अलग-अलग स्रोतों का परीक्षण किया गया, और सामग्री की तालिका में सूचीबद्ध वे हैं जो सबसे मजबूत और प्रजनन योग्य परिणाम प्रदर्शित करते हैं।

प्लेट आकार बैक्टीरिया प्रकार जानवरों की # दिन 1 वयस्कता तक पहुंचने के लिए जानवरों की # L4 चरण तक पहुंचने के लिए
60 मिमी OP50 100-150 150-300
60 मिमी HT115 70-100 120-200
100 मिमी OP50 600 -1000 1500-2000
100 मिमी HT115 350-600 700-1300

तालिका 2: भुखमरी से बचने के लिए पोस्ट-सिंक्रोनाइजेशन को प्लेट करने के लिए जानवरों की अनुशंसित संख्या। भुखमरी से बचने के लिए, हम प्रति स्थिति जानवरों की एक विशिष्ट संख्या चढ़ाना की सलाह देते हैं। चूंकि OP50 HT115 की तुलना में सघन बढ़ता है, इसलिए अधिक जानवरों को चढ़ाया जा सकता है। यहां सूचीबद्ध सभी नंबर हमारी प्रयोगशाला में उपयोग किए जाने वाले दिशानिर्देश हैं, और प्रयोगशाला की स्थिति के बीच कई चर और मतभेदों के कारण संख्याएं थोड़ी अलग हो सकती हैं। इसलिए, या अनुशंसित संख्या बोल्ड फ़ॉन्ट में निचली तरफ हैं। अधिकतम संख्या है जो भुखमरी तक पहुंचने के बिना हमारी प्रयोगशाला में इष्टतम परिस्थितियों में चढ़ाया जा सकता है, लेकिन यह पहले अपनी शर्तों titrating बिना इन मूल्यों का उपयोग करने की सिफारिश नहीं है । सभी संख्याओं को इस धारणा के साथ निर्धारित किया जाता है कि बैक्टीरिया प्लेटों पर वरीयता प्राप्त होते हैं और प्लेटों पर ~ 24 घंटे तक बढ़ने की अनुमति देते हैं ( ~ 22 डिग्री सेल्सियस) प्लेटों पर कीड़े उन पर रखे जाने से पहले। हालांकि अंडे या L1s चढ़ाना जब भुखमरी दरों में कोई बड़ा अंतर नहीं है, हम अंडे चढ़ाना जब ~ 10% अधिक संख्या चढ़ाना की सलाह देते हैं, क्योंकि सभी अंडे बाद-ब्लीचिंग नहीं करेंगे।

तनाव का नाम ट्रांसजीन उद्देश्य तनाव के अनुशंसित आवेदन स्रोत
SJ4005 एचएसपी-4पी::जीएफपी यूपीआरईआर 25 μg/mL ट्यूनिकमाइसिन सीजीसी
एसजे4100 एचएसपी-6पी::जीएफपी यूपीआरमीट्रिक टन 3 μM एंटीमाइसिन ए; सीजीसी
ईटीसी या माइटोकॉन्ड्रियल राइबोसोम के खिलाफ आरएनएआई
SJ4058 एचएसपी-60p::GFP यूपीआरमीट्रिक टन 3 μM एंटीमाइसिन ए; सीजीसी
ईटीसी या माइटोकॉन्ड्रियल राइबोसोम के खिलाफ आरएनएआई
CL2070 एचएसपी-16.2 पी::GFP हीट-शॉक रिस्पांस 34 डिग्री सेल्सियस 2 घंटे सीजीसी
AM446 एचएसएसपी-70p::GFP हीट-शॉक रिस्पांस 34 डिग्री सेल्सियस 2 घंटे मोरिमोटो लैब
CL2166 जीएसटी-4पी::जीएफपी ऑक्सएसआर 50 एमएम पैराक्विट; सीजीसी
2 एमएम टेर्ट-ब्यूटिल हाइड्रोपेरोक्साइड
CF1553 सोड-3पी::जीएफपी ऑक्सएसआर और इंसुलिन सिग्नलिंग डीएएफ-2 (इंसुलिन रिसेप्टर) के खिलाफ आरएनएआई सीजीसी
AU78 T24B8.5 p::GFP जन्मजात प्रतिरक्षा प्रतिक्रिया रोगजनक एक्सपोजर (जैसे पी एरुगिनोसा) सीजीसी

तालिका 3: सेलुलर तनाव प्रतिक्रियाओं की सक्रियता का आकलन करने के लिए ट्रांसक्रिप्शनल रिपोर्टर। यहां सूचीबद्ध उपभेदों सभी CGC के माध्यम से या इस पांडुलिपि में वर्णित गुणात्मक और मात्रात्मक इमेजिंग विधियों में उपयोग के लिए प्रयोगशालाओं के लिए विशेष अनुरोधों के माध्यम से उपलब्ध हैं । ये उपभेद ब्रिस्टल N2 पृष्ठभूमि से प्राप्त होते हैं। संवाददाताओं को सक्रिय करने के लिए तनाव लागू करने के लिए अनुशंसित तरीके भी प्रदान किए जाते हैं। सभी संवाददाताओं, sod-3pके अपवाद के साथ: GFP४५ और T24B8.5 p:: GFP४६ पाठ में वर्णित हैं ।

ट्रांसजीन तनाव के अनुशंसित आवेदन एक Leica M2250FA स्टीरियो माइक्रोस्कोप का उपयोग कर एक्सपोजर समय एक घूमना इको माइक्रोस्कोप का उपयोग कर एक्सपोजर समय पीएमटी मूल्यों एक संघ बॉयोमीट्रिका COPAS बायोसॉर्टर का उपयोग कर
एचएसपी-4पी::जीएफपी 25 μg/mL ट्यूनिकामाइसिन (रात भर वसूली के साथ ~ 4 घंटे) 200 एमएस 275 एमएस 450
एचएसपी-6पी::जीएफपी 3 μM एंटीमाइसिन ए (~ 16 घंटे); 100ms 50 एमएस 350
ईटीसी या माइटोकॉन्ड्रियल राइबोसोम के खिलाफ आरएनएआई (हैच से)
एचएसपी-60p::GFP 3 μM एंटीमाइसिन ए (~ 16 घंटे); 200 एमएस 100 एमएस 450
ईटीसी या माइटोकॉन्ड्रियल राइबोसोम के खिलाफ आरएनएआई (हैच से)
एचएसपी-16.2 पी::GFP 34 डिग्री सेल्सियस 2 घंटे 400 एमएस 200 एमएस 500
एचएसएसपी-70p::GFP 34 डिग्री सेल्सियस 2 घंटे 400 एमएस 300 एमएस 500
जीएसटी-4पी::जीएफपी 50 एमएम पैराक्विट (~ 2 घंटे); 100 एमएस 50 एमएस 350
2 mM tert-butyl हाइड्रोपेरोक्साइड (रात भर वसूली के साथ ~ 4 घंटे)
सोड-3पी::जीएफपी डीएएफ-2 (इंसुलिन रिसेप्टर) के खिलाफ आरएनएआई 300 एमएस 300 एमएस 475
T24B8.5 p::GFP रोगजनक एक्सपोजर (जैसे पी एरुगिनोसा) 100 एमएस 50 एमएस 350

तालिका 4: फ्लोरोसेंट माइक्रोस्कोपी और एक बड़े कण बायोसॉर्टर का उपयोग करके क्वांटिफिकेशन के लिए अनुशंसित सेटिंग्स। यह तालिका बड़े कण बायोसॉर्टर के लिए फ्लोरोसेंट माइक्रोस्कोपी या पीएमटी मूल्यों के लिए अनुशंसित एक्सपोजर समय के लिए दिशानिर्देश के रूप में कार्य करती है। ये अच्छे शुरुआती बिंदुओं के रूप में काम करेंगे, लेकिन एक्सपोजर समय और पीएमटी मूल्य को हर प्रयोग के लिए समायोजित किया जाना चाहिए ताकि यह सुनिश्चित किया जा सके कि कोई संतृप्ति नहीं होती है और फ्लोरोसेंट मूल्य पृष्ठभूमि संकेत की पता लगाने की सीमा से अधिक हैं। यदि किसी प्रयोग के लिए प्रतिभाशाली संकेत के साथ नमूना ज्ञात है (उदाहरण के लिए, तनाव प्रेरण के लिए सकारात्मक नियंत्रण), उन नमूनों का उपयोग उच्चतम एक्सपोजर समय या पीएमटी निर्धारित करने के लिए किया जा सकता है जिसका उपयोग सिग्नल को संतृप्त किए बिना किया जा सकता है। यदि प्रतिभाशाली नमूनों की जानकारी नहीं है, तो नियंत्रण का उपयोग किया जा सकता है और आपके सिस्टम की गतिशील रेंज के केंद्र में एक्सपोजर समय या पीएमटी का उपयोग किया जा सकता है।

इसी चित्रा तनाव, उपचार औसत उम्र # मौतें/# कुल औसत उम्र में % परिवर्तन पी-वैल्यू (लॉग-रैंक; मैंटेल-कॉक्स)
5ए N2, वेक्टर आरएनएआई, 1% डीएमएसओ 22 दिन 95/120 -- --
N2, xbp-1 आरएनएआई, 1% डीएमएसओ 14 दिन 92/120 -36.4 < 0.001
N2, वेक्टर आरएनएआई, 25 एनजी/μL TM 14 दिन 97/120 -36.4 < 0.001
N2, xbp-1 RNAi, 25 एनजी/ 12 दिन 98/120 -45.4 < 0.001
5B N2, वेक्टर आरएनएआई, 100 एमएम पीक्यू 5 घंटे 73/73 -- --
N2, daf-2 RNAI, १०० mM PQ 6.5 घंटे 74/74 30 < 0.001
5C N2, वेक्टर आरएनएआई, 37 डिग्री सेल्सियस 8 घंटे 59/60 -- --
टीटीएक्स-3 (केएस5),वेक्टर आरएनएआई, 37 डिग्री सेल्सियस 7 घंटे 60/60 -12.5 0.002
सुर-5p::hsf-1,वेक्टर आरएनएआई, 37 डिग्री सेल्सियस 9 घंटे 59/60 12.5 0.012

तालिका 5: उम्र और तनाव अस्तित्व परख के लिए आंकड़े । चित्रा 5 के लिए सभी नमूना आकार, आंकड़े और सेंसरशिप दरें यहां उपलब्ध हैं।

तनाव प्रतिक्रिया लक्ष्य जीन फॉरवर्ड प्राइमर रिवर्स प्राइमर
यूपीआरईआर एचएसएसपी-3 टीसीसीजीसीटीजीजीजीजीजीजीटीजीटीसीजी GTTGCGTTCTCCGTCTTTTG
यूपीआरईआर एचएसएसपी-4 GAACAACCTACTCGTGCGTTGG GAACAACCTACTCGTGCGTTGG
यूपीआरईआर सेल-11 टीटीजीसीटीसीसीजीजीसीजी टीटीजीसीटीसीसीजीजीसीजी
यूपीआरईआर गुस्सा-1 TCCTCAACCGCTCCATCAACAT TCCTCAACCGCTCCATCAACAT
यूपीआरईआर एक्सबीपी-1 जीजीएसीटीटीसीटीसीजीसीटीजीजीएजीजीटी जीजीएसीटीटीसीटीसीजीसीटीजीजीएजीजीटी
यूपीआरईआर xbp-1 (कटा हुआ) GGTGGATGGAGGGAAGATT GGTGGATGGAGGGAAGATT
यूपीआरईआर सीआरटी-1 GAAGTCCGAGAAGC GAAGTCCGAGAAGC
यूपीआरईआर T14G8.3 CACCTCCATCAACAACAACAT CACCTCCATCAACAACAACAT
एचएसआर एचएसएसपी-17 TCGTTTTCCACCATTCTCCCCA TGTTTGATCGGCCCAGTATGTT
एचएसआर एचएसएसपी-70 TGTTTGATCGGCCCAGTATGTT टीटीसीजीसीएत्गागागागसीजीएक्ट
एचएसआर F44E5.4 टीटीसीजीसीएत्गागागागसीजीएक्ट CGTTGTGCTGCGTCTCTCTCTTT
एचएसआर एचएसपी-16.2 TCCATCTGAGTTTCTGATT
जीटीटीए
TGGTTTAAACTGTGAGACGTTGA
एचएसआर एचएसएफ-1 TTTGCATTTTCTCCTCTCTGTC टीसीटीटीसीकैगसीएसीसीजीटी
यूपीआरमीट्रिक टन एचएसएसपी-6 गगनेतग्गागागागागागागागागागा सीजीजीसीसीटीटीसीटीटीसीजीजीसीसीटीसीटीटी
यूपीआरमीट्रिक टन एचएसएसपी-60 सीजीजीसीसीटीटीसीटीटीसीजीजीसीसीटीसीटीटी सीजीटीसीजीटीजीसीजीजीएजीसीटीकैगएजी
यूपीआरमीट्रिक टन यमेल-1 CAAAACCTGATCTCTGGG TTCTCAATGTCGGCTCCAGT
यूपीआरमीट्रिक टन सीएलपीपी-1 TGATaaGTGCCCAGTGTCCA TGATTCTGGAGTTCGGGAGA
यूपीआरमीट्रिक टन लोएनपी-1 सीजीएगाग्गीजीसीटीजीटीजीजीजी CGCTTTGAAACATCAATTTTCAT
सीसीए
ऑक्सएसआर जीएसटी-4 गैटजीसीटीसीजीटीसीटीजी CCGAATTGTTCTCCATCGAC
ऑक्सएसआर जीएसटी-6 CCGAATTGTTCTCCATCGAC TTTGGCAGTTGTTGAG
ऑक्सएसआर जीएसटी-7 TTTGGCAGTTGTTGAG TGGGTAATCTGGACGGTTTTG
ऑक्सएसआर जीएसएस-1 TGGGTAATCTGGACGGTTTTG ATGTTTGCCTCGACAATGTT
ऑक्सएसआर स्केन-1 GGACAACAGAATCCCAAAAGG TCAGGACGTCAACAGCAGAC
ऑक्सएसआर सोड-3 GTAACGGGCGATAGCATGAG GCGAGAGCACATTGATGAC
ऑक्सएसआर पीटीपीएस-1 एसीसीजीएटीसीसीटीटीजीगासीसी CAATCTACTGCGCGCACTGCTT
CAAAGC
संदर्भ पीएमपी-3 TGGCCGGGGATGATGTGTCGC ACGAACAATGCCAAAGGCC
संदर्भ Y45F10.4 CGAGAACCCGAGAAATGTCGGA CGGTTGCGGGGAAAGATGAGGC
संदर्भ सैप-49 टीजीसीजीजीजीजीजीजीटीसीजीटीसीटीसीसी एसीजीएजीसीटीसीटीसीटीटीजीसीटीजीसीसीए
संदर्भ टीबीए-1 टीसीएसीसीटीजीसीकैटसीजीसीसीसीसी TCCAAGCGAGACCAGGCTTCAG

तालिका 6: तनाव प्रतिक्रिया जीन के प्रतिलेखन अपरेगुलेशन को मापने के लिए अनुशंसित जीन लक्ष्य और प्राइमर जोड़े।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

यहां, सी एलिगेंसमें सेलुलर तनाव प्रतिक्रियाओं से पूछताछ करने के तरीकों, फ्लोरोसेंट ट्रांसक्रिप्शनल रिपोर्टर्स और शारीरिक तनाव अस्तित्व परख ों का उपयोग करके वर्णित हैं। संवाददाताओं सभी GFP बढ़ते सेलुलर तनाव प्रतिक्रियाओं में शामिल प्रतिलेखन कारकों के एक डाउनस्ट्रीम प्रतिलेखन लक्ष्य के प्रमोटर के तहत संचालित अभिव्यक्ति का उपयोग करें । एचएसपी-4पी का उपयोग:: जीएफपी को एक्सबीपी-1एस-मध्यस्थतायूपीआर, एचएसपी-6पी द्वारा संग्राहक किया गया::एटीएफएस-1-मध्यस्थता UPRमीट्रिक टनद्वारा नियंत्रित जीएफपी, जीएसटी-4पी::एसकेएन-1-मध्यस्थता ऑक्सएसआर के तहत जीएफपी, और hsp16.2 p:: GFP और hsp-70p:: एचएसएफ के तहत GFP-1-मध्यस्थता गर्मी सदमे प्रतिक्रिया समझाया जाता है । अन्य मानकीकृत प्रतिलेखन रिपोर्टर्स तालिका 3में पाए जा सकते हैं । यहां प्रस्तुत सभी प्रतिलेखन ी रिपोर्टर्स में एक विस्तृत गतिशील रेंज है और इसे आनुवंशिक क्षोभ या तनाव-उत्प्रेरण रसायनों के संपर्क के माध्यम से तनाव लागू करके मजबूती से सक्रिय किया जा सकता है। इसके अलावा, इन संवाददाताओं को नियोजित प्रमोटरों के ऊपर प्रतिलेखन कारकों के नॉकडाउन से दबाया जा सकता है । अंत में, प्रत्येक प्रतिलेखन रिपोर्टर को एक विशिष्ट तनाव प्रतिक्रिया को सक्रिय करने या दमन करने के प्रभाव का शारीरिक रीडआउट प्रदान करने के लिए एक विशिष्ट शारीरिक तनाव अस्तित्व परख में जोड़ा जाता है।

ट्रांसक्रिप्शनल रिपोर्टर्स के इस्तेमाल को सफलतापूर्वक नियोजित करने के लिए, प्रत्येक रिपोर्टर की गतिशील सीमा निर्धारित करना आवश्यक है। मीडिया, आगर, परिवेश वातावरण आदि में मतभेदों के कारण प्रमुख प्रयोगशाला-से-प्रयोगशाला परिवर्तनशीलता के कारण, हमारी सिफारिशों को आधार रेखा के रूप में उपयोग करके प्रत्येक दवा या तनाव प्रेरण प्रतिमान को सांद्रता और समय के लिए टिट करने की सिफारिश की जाती है। इसके बाद, यह सुनिश्चित करना महत्वपूर्ण है कि जानवर स्वस्थ और ठीक से सिंक्रोनाइज्ड हों। जिन जानवरों ने किसी प्रकार के तनाव का अनुभव किया है (उदाहरण के लिए, भुखमरी, प्रकाश के दीर्घकालिक जोखिम, ऊंचा तापमान के संपर्क में आना, आदि) प्रयोग से पहले कई पीढ़ियों के लिए बरामद किया जाना चाहिए। धारा 2 में उल्लिखित तरीकों का उपयोग करके उचित सिंक्रोनाइजेशन प्राप्त किया जा सकता है, जो आवश्यक है क्योंकि कई तनाव प्रतिक्रियाओं में उम्र बढ़ने की प्रक्रिया के दौरान सक्रियण के विभिन्न स्तर होते हैं। अंत में, इमेजिंग प्रोटोकॉल मानकीकृत करने के लिए आवश्यक हैं, क्योंकि विभिन्न चीजें हैं जो छवि और डेटा की गुणवत्ता को प्रभावित कर सकती हैं। उदाहरण के लिए, सोडियम अजाइड में जानवरों की अवधि को कम किया जाना चाहिए, क्योंकि इससे जानवरों पर तनाव होता है और यह रिपोर्टर सिग्नल को प्रभावित कर सकता है। इसके अलावा, माइक्रोस्कोप और बायोसॉर्टर विनिर्देशों को संतृप्ति के कारण बिना सिग्नल-टू-शोर अनुपात और गतिशील रेंज को अधिकतम करने के लिए ठीक से सेट किया जाना चाहिए। संतृप्त पिक्सल नमूनों के मात्रात्मक विश्लेषण में प्रमुख मुद्दों का कारण बन सकता है, क्योंकि अधिकतम फ्लोरोसेंट सिग्नल को गंभीर रूप से कम करके आंका जा सकता है।

हालांकि यहां वर्णित प्रतिलेखन संवाददाताओं तनाव प्रतिक्रियाओं की सक्रियता को मापने के लिए एक मजबूत और कुशल साधन प्रदान करते हैं, यह समझने के लिए महत्वपूर्ण है कि यह एक ज्ञात प्रतिलेखन कारक का एक जीन लक्ष्य है । इसलिए, जबकि यह बड़े पैमाने पर स्क्रीन या ब्याज के उपभेदों के पहले पास परीक्षणों के लिए एक विश्वसनीय विधि के रूप में कार्य करता है, उचित सत्यापन किया जाना चाहिए। हम प्रत्येक तनाव प्रतिक्रिया को परायोजन किए जाने पर सक्रिय कई विहित लक्ष्य जीन को मापने के लिए क्यूपीसीआर प्रदर्शन करने की सलाह देते हैं। सुझाए गए जीन लक्ष्यों की एक सूची तालिका 6में पाई जा सकती है । इसके अलावा, आरएनए-सीक्यू के माध्यम से ट्रांसक्रिप्टोम प्रोफाइलिंग एक बार में कई प्रतिलेखन लक्ष्यों पर प्रभावों पर व्यापक रूप से देखने के लिए एक और विकल्प है। विशेष रूप से ध्यान दें, फ्लोरोसेंट रिपोर्टर्स की इमेजिंग उन ऊतकों के बारे में स्थानिक जानकारी प्रदान करती है जो क्षोभ से प्रभावित होते हैं। इस तरह की जानकारी क्यूआरटी-पीसीआर या आरएनए-सीक्यू से प्राप्त नहीं की जा सकती है, क्योंकि यह स्क्आरएनए-सीक्यू, मछली और ऊतक-विशिष्ट आरएनसेक्यू प्रोटोकॉल47को छोड़कर पूरे कृमि अर्क का उपयोग करता है। अंत में, इन तनाव संवाददाताओं आम तौर पर उनके तनाव प्रतिक्रिया मशीनरी के लिए विशिष्ट होने के रूप में विशेषता है । हालांकि, यह याद रखना महत्वपूर्ण है कि सभी तनाव प्रतिक्रिया प्रतिमान अद्वितीय और अलग नहीं हैं। उदाहरण के लिए, ईआर तनाव ऑक्सएसआर को सक्रिय कर सकता है और इसके विपरीत48,और गर्मी-सदमे प्रतिक्रिया और ईआर तनाव प्रतिक्रियाओं के बीच ओवरलैप आमतौर पर49पाए गए हैं। ये सिर्फ पार संचार और तनाव प्रतिक्रियाओं के बीच ओवरलैप के साहित्य में कई उदाहरणों में से कुछ हैं, और इस तरह यह समझना महत्वपूर्ण है कि सभी परख भी विशिष्टता के लिए परीक्षण किया जाना चाहिए अंतिम निष्कर्ष प्राप्त करने के लिए ।

वर्णित तरीकों की एक और सीमा यह है कि बायोसॉर्टर के माध्यम से इमेजिंग और क्वांटिफिकेशन में थ्रूपुट सीमित है। जबकि बायोसॉर्टर क्वांटिफिकेशन उच्च थ्रूपुट के लिए 96-अच्छी प्लेटों में किया जा सकता है, यह अभी भी समाधान में कीड़े स्थानांतरित करने की आवश्यकता से सीमित है, जबकि इमेजिंग अन्वेषक की कीड़े तैयार करने और माइक्रोस्कोपी करने की क्षमता से सीमित है। इसलिए, बड़े पैमाने पर स्क्रीन सबसे अधिक संभावना फ्लोरोसेंट रिपोर्टर संकेत की केवल एक दृश्य स्क्रीनिंग शामिल होगा, केवल हिट के साथ छवि और मात्रा निर्धारित किया जा रहा है ।

इन फ्लोरोसेंट संवाददाताओं का उपयोग करने के साथ एक महत्वपूर्ण चेतावनी यह है कि तनाव प्रतिक्रियाओं की सक्रियता या दमन हमेशा शारीरिक रूप से सार्थक फेनोटाइप में योगदान नहीं देता है, या अन्य वैश्विक प्रभावों को प्रतिबिंबित कर सकता है (उदाहरण के लिए, प्रोटीन संश्लेषण में कमी)। इसलिए, हर प्रतिलेखन रिपोर्टर तनाव अस्तित्व परख करने के लिए एक विधि के लिए जोड़ा जाता है । यह UPRईआरके लिए ट्यूनिकामाइसिन अस्तित्व परख प्रदर्शन करने की सिफारिश की है, UPRमीट्रिक टन और OxSR के लिए पैराक्विट अस्तित्व परख, और गर्मी सदमे प्रतिक्रिया के लिए ऊंचा तापमान में अस्तित्व । हालांकि ये आम तौर पर मजबूत, तेज और सरल परख होते हैं, उन्हें गहन शारीरिक श्रम की आवश्यकता होती है, और इस प्रकार स्केलेबिलिटी में गंभीर रूप से सीमित होते हैं। इसके अलावा, आज तक प्रकाशित लगभग सभी थर्मोटॉलरेंस के परखों में प्रमुख परिवर्तनशीलता होती है, जिससे बड़ी संख्या में प्रतिकृतियां लगभग आवश्यक21होती हैं। जबकि ट्यूनिकामाइसिन और पैराक्विट अस्तित्व परखप्रजनक्षमता की इस कमी से पीड़ित नहीं हैं, उनके पास अपनी चुनौतियां हैं, जिनमें व्यापक हाथ-श्रम और प्रोटोकॉल की अवधि शामिल है। के रूप में नई प्रौद्योगिकियों उम्र और अस्तित्व के परख स्वचालित में पैदा होते हैं, यह संभावना है कि इन तनाव अस्तित्व परख भी उच्च थ्रूपुट५०बन सकता है । हालांकि, जब तक इन स्वचालित परखमानक हो जाते हैं, अस्तित्व परख वर्तमान में तनाव प्रतिक्रिया गतिविधि की गतिशीलता में फेरबदल में शारीरिक परिणामों के सत्यापन तक ही सीमित हैं ।

यहां वर्णित तनाव से परे, जानवरों में शरीर विज्ञान को मापने के लिए कई अन्य तरीके हैं। उदाहरण के लिए, एक व्यावसायिक रूप से उपलब्ध सीहॉर्स एक्सएफपी एनालाइजर सेलुलर श्वसन की निगरानी की अनुमति दे सकता है, जो अतिरिक्त मशीनी अंतर्दृष्टि51प्रदान करता है। प्रतिलेखन संवाददाताओं के लिए एक और विकल्प फ्लोरोसेंटी लेबल प्रतिलेखन कारकों के परमाणु स्थानीयकरण का उपयोग है । इस तकनीक के कई वेरिएंट हैं, लेकिन यहां वर्णित तरीकों के लिए विशेष रुचि में शामिल हैं: एचएसएफ-1::: हीट-शॉक रिस्पांस52,डीवीई-1::: यूपीआरMT53के लिए जीएफपी, और डीएएफ-16::: GFP और SKN-1:: GFP OxSR54,,55के लिए। अंत में, ब्याज के विशिष्ट ऑर्गेनेल्स की आकृति विज्ञान से सीधे पूछताछ की जा सकती है। उदाहरण के लिए, माइटोकॉन्ड्रियल मॉर्फोलॉजी की कल्पना माइटोकॉन्ड्रियल-लोकलाइजेशन अनुक्रम56का उपयोग करके माइटोकॉन्ड्रियल मैट्रिक्स को लक्षित फ्लोरोफोर का उपयोग करके की जा सकती है। ईआर आकृति विज्ञान को एन-टर्मिनस और एचईएल के लिए फ्यूज किए गए सिग्नल-अनुक्रम के माध्यम से ईआर को लक्षित57 फ्लोरोफोर का उपयोग करके कल्पना की जा सकती है, जो ईआर झिल्ली प्रोटीन58से जुड़े हैं। अंत में, ऐक्टिन साइटोस्केलेटल अखंडता को एचएसएफ-1 के थर्मल तनाव संवेदनशीलता डाउनस्ट्रीम के लिए प्रॉक्सी के रूप में इस्तेमाल किया जा सकता है। ऐक्टिन साइटोस्केलेटन को एचएसएफ-1 के ट्रांसक्रिप्शनल लक्ष्यों द्वारा विनियमित किया जाता है, विशेष रूप से उम्र बढ़ने और गर्मी-तनाव के दौरान, और इस प्रकार ऐक्टिन संगठन को एचएसएफ-1 और गर्मी से संबंधित तनाव59,,60के कार्यात्मक रीडआउट का निर्धारण करने के लिए कल्पना की जा सकती है।

यहां वर्णित सभी तरीकों का उपयोग स्वतंत्र रूप से या एक दूसरे के संयोजन में जीन या ब्याज की दवाओं और तनाव प्रतिक्रिया पर उनके प्रभाव के व्यापक विश्लेषण के लिए किया जा सकता है। बड़े पैमाने पर स्क्रीन उच्च थ्रूपुट ट्रांसक्रिप्शनल रिपोर्टर परख का उपयोग कर प्रदर्शन किया जा सकता है, और माध्यमिक स्क्रीन इन संवाददाताओं के मात्रात्मक विश्लेषण का उपयोग कर प्रदर्शन किया जा सकता है । एक बार और अधिक प्रबंधनीय उम्मीदवार जीन/दवा सूचियों की पहचान कर रहे हैं, शारीरिक परख उन उंमीदवारों कि पूरे पशु शरीर विज्ञान पर सीधा प्रभाव पड़ता है की पहचान करने के लिए किया जा सकता है । ऊपर सुझाए गए अन्य तरीकों का उपयोग सत्यापन या आगे की जांच के रूप में भी किया जा सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

R.BZ। EMBO दीर्घकालिक फैलोशिप और लैरी एल हिलब्लोम फाउंडेशन द्वारा समर्थित है। आरएचएस को नेशनल इंस्टीट्यूट ऑफ एजिंग (एनआईए) और ग्लेन फाउंडेशन फॉर मेडिकल रिसर्च पोस्टडॉक्टोरल फेलोशिप के माध्यम से अनुदान 5F32AG032023-02 द्वारा समर्थित है । A.F. एनआईए के माध्यम से अनुदान F32AG051355 द्वारा समर्थित है । एच.के.जी. को नेशनल साइंस फाउंडेशन ग्रेजुएट रिसर्च फेलोशिप प्रोग्राम के माध्यम से अनुदान DGE1752814 द्वारा समर्थित किया जाता है। एम.जी.एम. एनआईए के माध्यम से 1F31AG060660-01 द्वारा समर्थित है। ईस्वी थॉमस और स्टेसी सिबेल फाउंडेशन, हावर्ड ह्यूजेस मेडिकल इंस्टीट्यूट, और 4R01AG042679-04 और 5R01AG055891-02 एनआईए से, और 5R01ES021667-09 NIEHS से समर्थित है । हम महत्वपूर्ण तकनीकी सहायता के लिए लैरी जो, मेलिसा सांचेज, नामे केलेट और एनेल एस्क्विवेल का शुक्रिया अदा करते हैं । हम उपभेदों के लिए मोरिमोटो लैब और सीजीसी (अनुसंधान बुनियादी ढांचे के कार्यक्रम P40 OD010440 के NIH कार्यालय द्वारा वित्त पोषित) का शुक्रिया अदा करते हैं।

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).
<em>सी. एलिगेंस</em> में शारीरिक तनाव प्रतिक्रियाओं के माप
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).More

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter