Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Measurements of Physiological Stress Responses in C. Elegans

doi: 10.3791/61001 Published: May 21, 2020
* These authors contributed equally

Summary

Here, we characterize cellular proteotoxic stress responses in the nematode C. elegans by measuring the activation of fluorescent transcriptional reporters and assaying sensitivity to physiological stress.

Abstract

Organisms are often exposed to fluctuating environments and changes in intracellular homeostasis, which can have detrimental effects on their proteome and physiology. Thus, organisms have evolved targeted and specific stress responses dedicated to repair damage and maintain homeostasis. These mechanisms include the unfolded protein response of the endoplasmic reticulum (UPRER), the unfolded protein response of the mitochondria (UPRMT), the heat shock response (HSR), and the oxidative stress response (OxSR). The protocols presented here describe methods to detect and characterize the activation of these pathways and their physiological consequences in the nematode, C. elegans. First, the use of pathway-specific fluorescent transcriptional reporters is described for rapid cellular characterization, drug screening, or large-scale genetic screening (e.g., RNAi or mutant libraries). In addition, complementary, robust physiological assays are described, which can be used to directly assess sensitivity of animals to specific stressors, serving as functional validation of the transcriptional reporters. Together, these methods allow for rapid characterization of the cellular and physiological effects of internal and external proteotoxic perturbations.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

The ability of an organism to respond to changes in the intra- and extracellular environment is crucial for its survival and adaptation. This is accomplished on a cellular level through numerous protective pathways that ensure the integrity of the cell. While numerous cellular components are subject to stress-associated damage, one major involvement of cellular stress responses is to repair and protect the homeostasis of the cellular proteome. However, the compartmentalization of proteins into special structures, called organelles, poses a challenge for the cell, as it cannot rely on one centralized form of protein quality control to ensure that all the proteins within the cell are properly folded and functional. Therefore, to deal with perturbations to their proteins, organelles have evolved dedicated quality control mechanisms, which can sense misfolded proteins and activate a stress response in an attempt to alleviate the stress within that compartment. For example, the cytosol relies on the heat shock response (HSR), while the endoplasmic reticulum (ER) and mitochondria rely on their compartment-specific unfolded protein responses (UPR). The OxSR serves to alleviate the toxic effects of reactive oxygen species (ROS). Each stress response is triggered in the presence of cellular challenges and environmental insults and induces a tailored transcriptional response. The hallmarks of these responses include synthesizing molecules that re-fold misfolded proteins (such as chaperones) targeted to the proper organelle, or alternatively, remove damaged proteins by protein degradation. Failure to activate these stress responses results in accumulation of damaged proteins, cellular dysfunction propagated to systemic failure of tissues, and eventually death of the organism. The function and regulation of the different stress responses are reviewed elsewhere1.

Many insights regarding the regulation and activity of cellular stress responses have been attributed to the nematode, Caenorhabditis elegans, a multicellular model organism in genetic research. Nematodes not only allow studying the activation of stress responses on the cellular level, but also on the organismal level; nematodes have been used to study the effects of genetic perturbations or exposure to drugs and pollutants on their growth and survival. Their quick generation time, isogeny, transparency, genetic tractability, and ease of use during experimentation make them ideal for such studies. Additionally, the relatively quick physiological response to stress (between hours and a few days) and the evolutionary conservation of cellular pathways make nematodes a prominent tool in studying stress resistance.

There are two commonly used E. coli strains used as a food source to grow C. elegans: standard OP50, a B strain in which most experimentation has been historically performed2 and HT115, a K-12 strain that is used for almost all RNAi experiments3,4. It is important to note that there are significant differences between OP50 and HT115 bacterial diets. Growth on these different bacterial sources has been shown to cause major differences in metabolic profile, mitochondrial DNA copy number, and several major phenotypes, including lifespan5. Some of these differences are attributed to Vitamin B12 deficiency associated with growth on OP50 bacteria, which can result in defects in mitochondrial homeostasis and increased sensitivity to pathogens and stresses. All of these phenotypes have been shown to be alleviated by growth on HT115 bacteria, which have higher levels of Vitamin B126. Therefore, it is recommended that all experiments on physiological stress responses be performed on HT115 bacteria, regardless of the necessity of RNAi conditions. However, due to the ease of maintaining animals on OP50, all standard growth (i.e., maintenance and amplification of animals) can be performed on OP50, as significant differences in the experimental paradigms described here were not detected in worms maintained on OP50 as long as they were moved to HT115 post synchronization (i.e., from hatch post-bleaching with or without L1 arresting) until experimentation.

Here, the characterization of the activity of cellular stress responses using two functional methods is described. It should be noted that the protocols presented are primarily focused on cellular stress responses and their impact on protein homeostasis. First, fluorescent transcriptional reporters are utilized, which are regulated by endogenous gene promoters that are specifically activated in response to different cellular stresses. These fluorescent transcriptional reporters are based on the transcriptional induction of specific genes that are natively part of the stress response. For example, HSP-4, a heat shock protein orthologous to the human chaperone HSPA5/BiP, is activated upon ER-stress and localizes to the ER to alleviate the stress. In conditions of ER stress (e.g., exposure to tunicamycin), a green fluorescent protein (GFP), placed under the regulation of the hsp-4 promoter, is synthesized in high levels as can be assessed by fluorescent microscopy or quantitatively measured using large-particle flow cytometry of nematodes7. Similarly, the promoter of a mitochondrial chaperone, hsp-6 (orthologous to mammalian HSPA9), is utilized to monitor the activation of the UPRMT8, and the promoter of the cytosolic chaperone hsp-16.2 (orthologous to the human crystallin alpha genes) is used for assessing the activity of the HSR9. These reporters allow a rapid characterization of the pathways activated in response to various perturbations.

Often, the reporters presented here are imaged using microscopy, which provides a qualitative output of the activation of stress responses. However, while imaging techniques provide both information on intensity and tissue location of the reporters described above, its quantification is not always accurate or robust. While it is possible to quantify fluorescent activation using imaging analysis tools, these methods are relatively low throughput and sample size is small, due to the relatively low number of animals imaged. The ease and ability to obtain large quantities of animals quickly make C. elegans an ideal model system to assay the activation of fluorescent stress reporters through the use of a large particle flow cytometer. A large-particle flow cytometer is capable of recording, analyzing, and sorting based on size and fluorescence from many live animals. Using this method, it is possible to get the fluorescent intensity, size, and also spatial (2D) information for thousands of worms. The system is controlled using FlowPilot, which allows for real-time data acquisition and analysis of the measured parameters. Here, methods for both microscopic imaging and quantitative analysis using a large-particle flow cytometer are offered as methods to measure the activation of stress responses.

Beyond reporter analysis, the sensitivity or resistance of animals to stress can be measured using physiological stress assays. This is achieved by exposing animals to stressful environments that activate specific cellular stress pathways. Here, several methods are provided to measure sensitivity of whole animals to specific types of stressors.

ER stress is applied to C. elegans by using the chemical agent, tunicamycin, which blocks N-linked glycosylation, causing accumulation of misfolded proteins in the ER10. In C. elegans, growth upon exposure to tunicamycin results in major perturbations in ER function, and a significantly decreased lifespan11. By measuring the survival of animals on tunicamycin-containing plates, ER stress sensitivity of animals can be quantified. For example, animals with ectopic UPRER induction and thus increased resistance to protein misfolding stress in the ER have an increased survival upon tunicamycin exposure compared to wild-type animals12.

Oxidative and mitochondrial stress is applied to C. elegans by exposing animals to the chemical agent, paraquat. Paraquat is a commonly used herbicide, which causes superoxide formation specifically in the mitochondria13. Due to the specific localization of mitochondria-derived reactive oxygen species (ROS), paraquat assays are often used as a "mitochondrial" stress assay. However, superoxide is rapidly converted into hydrogen peroxide by mitochondrial superoxide dismutases (SODs)14. Hydrogen peroxide can subsequently diffuse out of the mitochondria and cause oxidative stress in other compartments of the cell. Therefore, we describe paraquat survival assays as measuring sensitivity to both mitochondrial and oxidative stress (other oxidative stress assays can be found15).

Thermotolerance assays are performed in C. elegans by placing animals in elevated temperatures. Ambient temperatures for nematodes are ~15-20 °C and thermal stress is induced at temperatures above 25 °C16,17. Thermotolerance assays are generally performed at temperatures ranging from 30-37 °C, as animals exhibit major cellular defects at this temperature, and survival assays are completed within 24 hours16,18. Here, two alternative methods are provided for performing thermotolerance assays: growth at 34 °C and growth at 37 °C. Together, the protocols presented here can be utilized to perform large-scale screens when combined with standard gene knock-down using RNA interference or chemical drug libraries.

The protocol can be broken into 4 broad procedures- growth of C. elegans and preparation for imaging (sections 1 and 2), imaging of transcriptional reporters using fluorescent microscopy (sections 3-5), quantitative measurements of reporters using a large-particle flow cytometer (section 6), and physiological assays to measure stress sensitivity in C. elegans (section 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Standard growth conditions of temperatures & OP50 vs HT115

  1. Standard growth and expansion
    1. Grow a culture of OP50 in LB (Table 1) or equivalent media of choice for 24-48 h at ambient temperature (~22-25 °C). Grow bacteria at room temperature as OP50 is an uracil auxotroph and there is a higher incidence of revertants (e.g., suppressor mutants) when grown at 37 °C. Long-term storage of OP50 cultures is not recommended (max 1 week at 4 °C).
    2. Seed a volume of ~100-200 µL of saturated OP50 culture onto a 60 mm NGM plate (Table 1) for maintenance of worms and 1 mL of saturated OP50 culture onto a 100 mm plate for expanding animals for experimentation.
    3. Let plates dry overnight on a benchtop.
      NOTE: 100 mm plates may need more time to dry, especially if using non-vented plates. Store all C. elegans plates in air-tight containers stored at 4 °C. Do not use plates past 6 months old as desiccation of plates will occur, which will change animal physiology on plates due to different osmotic pressure and stiffness of plates.
    4. For standard maintenance, move 10-15 young animals (eggs, L1, or L2 stages) onto a 60 mm plate, although more can be moved if dealing with mutants or transgenic animals with lower fecundity. For animals with developmental or fecundity defects, chunk a more variable pool of animals to prevent loss of the stock. If kept at 15 °C, move animals every week; for 20 °C, move animals every 3-4 days.
    5. Perform a fresh thaw of animals every 25-30 passages (~ 6 months if animals are moved once a week and kept at 15 °C).
    6. For expansion, chunk a full 60 mm plate onto 100 mm plates for expansion. As a frame of reference, animals with wild-type fecundity can have a full 60 mm plate cut into 4ths-6ths and be chunked onto a large plate at 20 °C for 2 days or 15 °C for 3 days to create a full 100 mm plate without reaching starvation.

2. Staging/synchronization of worms using bleaching

  1. Bleaching protocol to synchronize worms
    1. Wash gravid worms (adults full of eggs) off agar plates using M9 (Table 1). Start from a non-synchronized population of worms (i.e., chunked worms from step 1.1.6) to bleach for experiments, as significant genetic drift may occur upon successive rounds of synchronization via bleaching.
    2. Move worm/M9 mixture into a 15 mL conical tube using a glass pipette; several plates of worms can be collected into a single 15 mL conical tube.
    3. Spin animals down for 30 s at 1,000 x g. Aspirate M9 supernatant. It is unnecessary to wash off residual bacteria unless there is an egregious amount of contamination or large clumps of bacteria. If this is the case, perform several washes with M9.
    4. Prepare a fresh stock of bleaching solution (Table 1). Bleaching solution can be kept for several days at 4 °C, but use freshly made bleaching solution as inefficient bleaching can result in uneven bleaching, which will cause damage to eggs before eliminating all worm carcasses.
    5. Add 2-10 mL of bleaching solution to the animals (~1 mL of bleach solution for every ~0.1 mL of animal pellet). Invert the bleach and worm mixture for ~5 min (do not exceed 10 min; note that bleaching times may vary and should be titrated specifically for each lab). Vigorously shake to help dissolve worm carcasses faster and for optimal preservation of eggs. Periodically look under a dissection microscope or put the conical tube to a light to observe when the adult worm carcasses have fully dissolved and only eggs remain in the tube.
    6. Pellet the eggs by spinning at 1,000 x g for 30 s and then aspirate the supernatant. Eggs can be centrifuged faster than worms without disrupting their integrity, so if unsure of centrifuge speed, eggs can be spun down at up to 2,500 x g without affecting their physiology.
    7. Add M9 up to 15 mL and invert the tube to clear bleach off the eggs.
    8. Repeat steps 2.1.6-2.1.7 (wash/pellet process) 2-3 more times to remove bleach.
    9. Pipet egg/M9 mix onto plates and grow at 15-20 °C for experimentation. To get a measure of how many worms to use, perform approximate egg counts by pipetting 5 µL of egg mixture onto an agar plate or slide and dividing the egg count by 5 to determine the number of eggs per 1 µL of volume. Averaging of 3 independent counts may improve accuracy. To avoid starvation, a table of recommended egg counts per plate is available in Table 2.
    10. If needed, L1 arrest animals for tighter temporal synchronization by placing egg/M9 mix in a rotator at 20 °C for up to 24 h. For wild-type animals, no defects in animal physiology were detected when L1 arresting for up to 48 h. However, mutants that are sensitive to starvation (e.g., lysosome or autophagy mutants) do very poorly with L1 arresting, and thus it is not recommended to perform this synchronization method for mutants that are known to be sensitive to starvation. If tighter synchronization is required for animals that cannot be L1 arrested, use the egg-lay method described in section 2.2.
  2. Egg-lay protocol for synchronizing worms
    NOTE: As an alternative method to bleaching, an egg-lay assay can be performed. Egg-lay is used when bleaching of animals does not provide a close enough synchronization, as eggs within the egg sac of adult animals can be as different as 8-12 h apart. For experimental paradigms where it is critical for animals to be as closely staged as possible, but where L1 arresting is not possible (e.g., in starvation mutants), egg-lay assays are recommended. However, it should be noted that due to the labor involved in the egg-lay protocol, it is less feasible to perform high-scale experiments.
    1. Place 4-12 gravid adults (see Note after step 2.2.2) onto a standard OP50 or HT115-seeded NGM plate (see Section 1 above for recommendations on bacterial strains). Depending on the scale of experiments, multiple plates can be used. Be sure to carefully document how many animals are on each plate for step 2.2.
    2. Place animals at desired temperature for experiments (15-20 °C) for 4-8 h.
      NOTE: The number of hours animals are left on the plate will determine how closely synchronized the first egg laid and the last egg laid will be, so the timing can be adjusted as needed. Since shorter incubation times will mean each animal has less time to lay eggs, more animals should be placed onto plates to ensure enough eggs are laid. While the actual egg-laying rate is not fully normalized due to the tendency of animals to go through short bursts of egg-laying rather than a normalized rate of egg-lay, the average rate of eggs laid per animal can be estimated at ~5 eggs/hour for animals exhibiting wild-type fecundity19. When trying to grow animals to day 1 adult stage, time the egg-lay to have <100 eggs per plate to avoid starvation (refer to Table 2 for more details on recommended animals per plate).
    3. Remove adult animals from plates. Ensure that all adult animals are removed from plates, as animals will continue to lay eggs and result in an unsynchronized population and/or starvation of the plate.

3. Growth conditions of worms for imaging of transcriptional reporters

  1. Growth of worms
    1. Inoculate bacterial culture of HT115 harboring pL4440 RNAi plasmid (EV) and/or carrying an RNAi cassette against desired target gene(s) into LB media supplemented with 100 µg/mL carbenicillin and 20 µg/mL tetracycline.
    2. Grow culture overnight (~16 hours) to saturation in a shaking 37 °C incubator.
    3. Spot 60 mm NGM RNAi plates with 200 µL of saturated bacterial culture and 100 mm NGM RNAi plates with 1,000 µL of saturated bacterial culture. Let dry at ambient temperature (~22 °C) overnight in the dark (covered loosely with aluminum foil).
    4. Place synchronized population of transgenic worms carrying fluorescent reporters (see Table 3 for complete list) onto NGM RNAi plates seeded with bacteria of choice.
    5. Grow at 15-20 °C to required stages for specific reporters as outlined below.
  2. Considerations for staging of worms for experimentations
    1. Perform experiments for transcriptional reporters at day 1 of adulthood, with the exception of assays that require L4 animals. According to WormAtlas, L4 animals are obtained approximately 2.5 days (~56 h) of growth at 20 °C from the egg stage (www.wormatlas.org).
    2. For "day 1 adults," use animals at approximately 3-4 days (~65-96 h) of growth at 20 °C after plating eggs.
      NOTE: This wide range is explained as follows: ~65 h at 20 °C is when animals reach "egg-laying," which is the true "adulthood" state. 96 h is when animals enter what WormAtlas describes as "egg-laying maximal," which is when the adult is a gravid adult and has a full egg sac. This is when animals would be described as being older than day 1 and may start to display differences, and thus the protocols described here are all recommended to start in this "day 1" stage starting as early as 65 h and as late as 96 h. For the assays described here, major differences were not observed when using animals in this ~65-96 h window.
    3. For replicates of a single experiment, use a similar time point for more robust reproducibility (e.g., perform all experiments at ~65 h or ~96 h after plating eggs).
      NOTE: Some transgenic animals and mutants display slowed growth rates. For this, two recommendations exist. 1) Use staggered synchronization, where animals can be bleached at different times in order for experimentation to be performed at the same time. This is recommended when technical variability in the assay may be larger than the technical variabilities that may arise from the synchronization assay (e.g., survival assays, which run for long durations may suffer if they are not performed simultaneously). 2) Use staggered analysis, where animals can be bleached at the same time, but the assay itself is performed at different times. This is recommended for very simple assays that do not have inherent variability (e.g., RNAi-induction of stress responses).

4. Induction of stress responses

  1. Using hsp-4p::GFP as a readout for the activation of the UPRER
    1. Inducing ER stress using RNAi
      1. Prepare plates spotted with RNAi bacteria targeting the gene of interest onto NGM RNAi plates (Table 1) as in section 3. Use EV as a control for basal UPRER levels and RNAi knockdown of tag-335 (enzyme for N-linked glycosylation of ER resident proteins; RNAi knockdown has similar effects to tunicamycin treatment) as a positive control for activation of the UPRER under ER stress.
      2. Synchronize hsp-4p::GFP reporter animals using methods described in section 2.
      3. Plate eggs onto RNAi plates using criteria recommended in Table 2.
      4. Incubate eggs at 20 °C for approximately 3-4 days (~65-96 h) to perform experiments at day 1 of adulthood. For the UPRER experiments, there are differences in basal fluorescence of the hsp-4::GFP reporter when grown at different temperatures. Therefore, perform all experiments at 20 °C.
    2. Inducing ER stress using a chemical agent
      1. Synchronize hsp-4p::GFP reporter animals using methods described in section 2 and grow at 20 °C until animals reach the L4 stage. Transfer animals to a tube of M9. Allow worms to settle (~2-3 min by gravity or a 30 s spin at 1,000 x g), and then remove M9.
      2. Dilute tunicamycin to 25 ng/mL in M9 (a 1:40 dilution from 1 mg/mL stock). As a control, also dilute an equivalent volume of DMSO in M9.
      3. Add 25 ng/mL tunicamycin/M9 or control DMSO/M9 solution to worms (use 400-500 mL for a 1.5 mL tube or 2 mL for a 15 mL conical tube). Incubate at 20 °C on a rotating platform for 3-4 hours.
        NOTE: Tunicamycin can also be diluted directly into worm/M9 mix.
      4. Allow worms to settle, remove M9/TM solution, and wash with 1 mL of M9.
      5. Transfer animals to NGM plates or NGM RNAi plates and allow to recover overnight (or ~15-20 h) and reach Day 1 of adulthood at 20 °C prior to performing fluorescent microscopy (section 5). An overnight recovery is performed to allow for a detectable level of GFP to accumulate.
      6. Alternatively, induce hsp-4p::GFP by moving L4 animals to agar plates containing 25 ng/µL tunicamycin for 16-24 h. This has a much more robust induction of hsp-4p::GFP due to the longer duration of stress, and thus the dynamic range is much lower than the assay described above.
  2. Using hsp-6p::GFP as a readout for the activation of the UPRMT
    1. Inducing mitochondrial stress using RNAi
      1. Activate UPRMT following the same protocol as section 4.1.1, except using RNAi knockdown of mitochondrial genes, such as cox-5b/cco-1 (cytochrome c oxidase subunit 5B; knockdown inhibits electron transport chain activity). For UPRMT activation through perturbations in electron transport chain function, RNAi knockdown needs to be performed during early development20. Therefore, perform RNAi from hatch for these experiments.
    2. Inducing mitochondrial stress using a chemical agent
      1. Prepare plates spotted with RNAi bacteria targeting the gene of interest as in section 3. Use HT115 bacteria even in experiments not involving RNAi knockdown (see Section 1). Ensure that both NGM RNAi plates (or NGM RNAi + DMSO0.2) and NGM RNAi + antimycin A plates (Table 1) are both prepared for step 4.2.2.5.
      2. Synchronize hsp-6p::GFP or hsp-60p::GFP reporter animals using methods described in section 2.
      3. Plate eggs onto seeded plates of choice using criteria recommended in Table 2. Since antimycin A is dissolved in DMSO, grow the animals on NGM RNAi + DMSO0.2 plates from hatch.
      4. Incubate eggs at 20 °C for 2 days (~56 h) to the L4 stage. Alternatively, grow animals at 15 °C for 3 days (~75 h) instead.
      5. Move worms from NGM RNAi + DMSO0.2 plates to NGM RNAi + antimycin A plates or NGM RNAi + DMSO0.2 plates as a control. Worms can be moved manually with a pick for small-scale experiments, but for large-scale experiments, we recommend washing animals with M9, settling with centrifugation, aspirating M9, and then plating to NGM RNAi + antimycin A plates.
      6. Incubate worms for an additional ~20 h and image at day 1 adult (section 5).
  3. Using gst-4p::GFP as a readout for the oxidative stress response.
    1. Inducing OxSR using RNAi
      1. Alternatively, induce gst-4p::GFP using RNAi-knockdown of wdr-23 (it encodes a negative regulator of skn-1; thus, its knockdown induces OxSR) using the protocol described in section 4.1.1.
    2. Inducing the OxSR using exposure to the chemical oxidant Tert-butyl hydroperoxide (TBHP)
      1. Prepare plates spotted with RNAi bacteria targeting the gene of interest as in section 3. Use HT115 bacteria even in experiments not involving RNAi knockdown (see Section 1).
      2. Synchronize gst-4p::GFP reporter animals using methods described in section 2.
      3. Plate eggs onto seeded plates of choice using criteria recommended in Table 2. Be sure to prepare more plates than necessary as the drug treatment protocol results in loss of >10-20% of animals. For imaging, start with >100 animals, and for sorting, start with >1,000 animals.
      4. Incubate eggs in 20 °C for 2 days (~56 h) to the L4 stage. Alternatively, grow animals at 15 °C for 3 days (~75 h) instead.
      5. Wash L4 animals off the plates and split into two 15 mL conical tubes per condition. Aspirate volume down to at least 1 mL and add an equal volume of freshly made 2 mM TBHP. Use a total liquid volume to at least 2 mL, as lower volumes can cause significant death of worms when spinning. Do not wash prior to drug treatment, as residual bacteria from plates will help to ensure worms to not overstarve during incubation.
      6. Incubate worms on the rotator for 4 h at 20 °C.
      7. Wash worms by spinning at 1,000 x g, aspirating M9 + TBHP mix, and replacing with 15 mL of M9. Repeat for a second wash.
      8. Plate worms on EV RNAi to recover overnight (~16-24 h) at 20 °C. Worms can be recovered on matching RNAi of choice, but no significant differences were seen when recovered on EV RNAi, so this can be done for ease of experimental set-up. Take images of day 1 adults after recovery.
        NOTE: An overnight recovery is performed to allow for a detectable level of GFP to accumulate. Without this recovery, there is no detectable GFP signal. If a shorter-term recovery is desired, it is possible to use the assay described in section 4.3.3.
    3. Inducing the OxSR using exposure to the chemical oxidant paraquat (PQ)
      1. Repeat all steps in section 4.2.2 to get 2 batches of L4 gst-4p::GFP animals in 15 mL conical tubes per condition.
      2. Aspirate volume down to at least 1 mL and add an equal volume of freshly made 100 µM PQ. Similar to 4.3.2.5, a minimum volume of 2 mL is recommended.
      3. Incubate worms on the rotator for 2 h at 20 °C.
      4. Wash worms by spinning at 1,000 x g, aspirating M9 + PQ mix, and replacing with 15 mL of M9. Repeat for a second wash.
      5. Plate worms on EV RNAi to recover for 2 h at 20 °C, and then take images immediately after recovery.
        NOTE: 2 h of recovery was the minimal recovery required to visualize the GFP induction.
  4. Using hsp-16.2p::GFP and hsp-70p::GFP as a readout for HSR activation.
    1. Inducing HSR using exposure to elevated temperatures
      1. Prepare plates spotted with RNAi bacteria targeting the gene of interest as in section 3. Use HT115 bacteria, even in experiments not involving RNAi knockdown (see Introduction).
      2. Synchronize hsp-16.2p::GFP or hsp-70p::GFP reporter animals using methods described in section 2.
      3. Plate eggs onto seeded plates of choice using criteria recommended in Table 2. Be sure to prepare 2x the number of plates necessary as half of the sample will be exposed to elevated temperatures for heat-shock induction, and the other half will serve as a non-heat-shocked control.
      4. Incubate eggs at 20 °C for approximately 3-4 days (~65-96 h) to perform experiments at day 1 of adulthood. Do not grow worms at 15 °C for heat-shock experiments as there are only minor differences between animals experiencing heat-shock out of 15 °C versus 20 °C.
      5. Move experimental groups of animals to a 34 °C incubator for 2 h. Place plates in the incubator as a single layer (i.e., no stacking of plates) to ensure the fastest and most equal distribution of heat across the plates.
      6. Move heat-shocked animals to a 20 °C incubator to recover for 2 h and then image immediately (see Section 5). Animals can be recovered longer if necessary for higher GFP induction.
        NOTE: 2 h of recovery was the minimal recovery required to visualize the GFP induction.

5. Imaging using a stereo microscope or low-magnification wide-field/compound microscope

  1. Preparation of worms for fluorescent microscopy
    1. Pipette 5-10 µL of 100 mM sodium azide on top of a standard NGM plate (i.e., no bacteria).
      NOTE: Sodium azide concentration can be brought down as low as 10 mM, although the most robust immobilization was observed at 100 mM sodium azide with no detectable effect on fluorescent signal.
    2. Under a dissecting microscope, pick 10-20 animals from experimental plates, and transfer into the spot of sodium azide. Animals should cease movement shortly after landing in sodium azide, and sodium azide itself will evaporate within seconds.
    3. Once sodium azide has evaporated, line up animals to desired imaging setup. Move the animals side by side with anterior and posterior sides in the same orientation for all animals. Image animals immediately.
      NOTE: No changes in reporter signal were observed for any of the transcriptional reporters in Table 3 for up to 15 min after paralyzing in sodium azide.
  2. Image acquisition using a stereomicroscope
    NOTE: For this protocol, a Leica M205FA microscope equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software was used. Recommended settings for exposure times can be found in Table 4.
    1. Launch LAS X program.
    2. Start a new project: Open the acquisition tab, click on Open Projects and click Folder to open a new project. This project can be renamed by right-clicking the folder and scrolling down to Rename or clicking F2. In the acquisition tab, there are also options to adjust exposure time and zoom to desired settings.
    3. Position the worm sample under the microscope objective and locate the correct focal point of worms using the bright-field setting to minimize fluorescent bleaching. The center of the sample is where the line of eggs is clearly visible and not fuzzy. Set the exposure time, zoom, focus, and bright-field condensers to desired settings.
    4. Acquire an image using the Capture Image button.
    5. Save the image in .lif (Leica Image File) format as this saves all raw images and metadata. A TIFF can also be exported by right clicking the image (or project) and under the Save as option, click TIFF. This will store all channels (e.g., bright-field and GFP) with any modifications (e.g., if contrast was adjusted, this will be saved into the TIFF).
  3. Quantitative analysis of fluorescent images
    1. If quantitative analysis will be performed, take 3-D images. This is performed by clicking the z-section option labelled with "z" at the top right. Z-sections will be active if this box is red.
    2. Optimize z-sections by selecting the range and slice thickness in the bottom left of adjustable options. Whenever possible, use the System Optimized button for optimal settings.
    3. Capture the image and store the image as described above in section 5.2. Line up worms with spaces between them for easier measurements.
    4. Import TIFF images into the imaging software of choice (e.g., ImageJ).
    5. For ImageJ, from the Analyze menu, choose Set Measurements. Check the following: area, mean gray value, integrated density, display label.
    6. Using the ROI (region of interest) tool, draw a ROI. Measure each worm individually. From the Analyze menu, choose Measure or press M. Draw a ROI in the background where there are no worms, and then measure the background in the same manner. Copy or save measurements that appear in the Results window.
    7. Subtract the background integrated density from the integrated density of each measured ROI. The background intensity for a ROI is defined as the product of the background mean gray value and the area of the ROI drawn.
  4. Image acquisition using a compound/wide-field microscope
    NOTE: For imaging of transcriptional reporters using a compound/wide-field microscope, this protocol uses a Revolve ECHO R4 microscope equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, a standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for the camera and to drive the ECHO software. Recommended settings for exposure times can be found in Table 4.
    1. Use the touchpad to launch the control program. Create a new album and file name.
    2. Position plate under the objective lens. Set the exposure time and fluorescence intensity by using the baseline (EV/control treatment) and positive control, so that the signal is visible but not saturated.
    3. Save a bright-field image and GFP/FITC image.

6. Quantitative measurements of reporters using a large-particle flow cytometer

NOTE: Growth and preparation of worms for large-particle flow cytometer analysis can follow the same paradigms as sections 1-5 for preparation of worms for fluorescent imaging, with the exception that a larger number of animals are required. Use >500 animals per condition, as some animals are lost during manipulation, not all animals pass the filtering criteria during quantification, and some animals are not properly read by the flow cytometer. Wash animals ready for sorting off plates in 5-10 mL of M9 solution into 15 mL conical tubes for subsequent sorting on the flow cytometer.

  1. Sorting setup using a large particle flow cytometer
    1. Before turning on the flow cytometer
      1. Make sure the sheath liquid bottle is not empty. Prepare sheath liquid from the 250x stock at least a few hours prior to using the sorter, as there is a small amount of detergent in the sheath fluid, which can cause bubbles that can cause artifacts during acquisition.
      2. Ensure that all waste containers are not full.
    2. Turning on the flow cytometer
      1. Turn on the air compressor. Turn it to Auto. Check the pressure gauge - it should be around 30 psi.
      2. Turn on the instrument. Use the power switch that is next to the power cord on the left of the instrument.
      3. Turn on lasers. A 488 nm light source is usually sufficient for most experiments, although a 561 nm light source needs to be used if higher excitation is required for red fluorescence.
      4. Open the FlowPilot software; the instrument should make a series of clicks switching on the different valves.
      5. Turn on the lasers in the software window by clicking Start. Initiate laser in the Argon laser control popup window by clicking Run. This should cause the laser to turn on and reach around 12 mW. The 488 light source level will go up to around 12.
      6. Click Done to close the window.
    3. Checks on software before progressing
      1. Check pressure gauges -Look at the 4 pressure values displayed in the bottom of the window. The values should be around the original setup (Sheath 5.5-5.7; Sample 5.7-6.0; Sorter 3.1-3.3; Clean 8.5-8.7). If it looks similar, check the box next to Pressure OK.
      2. Check fluidics -To make sure there are no air bubbles and debris blocking the flow of sheath/sample through the flow cell, click Clean several times.
      3. Check sheath flow rate -For this, collect sheath for 60 s. Switch Off Sort, then switch On Sheath in the manual controls to start the flow of sheath. Collect in a 15 mL tube for 60 s; the flow rate should be ~9-10 mL/min.
    4. Cleaning before use of the flow cytometer
      1. Put ~3-5 mL of 10% bleach solution into the collection 'cup' and click Acquire. Let run for ~30 s, click Abort, and remove excess with vacuum.
      2. Rinse the collection 'cup' with deionized water and remove with vacuum. Repeat 2x.
      3. Put ~3-5 mL of COPAS cleaning solution into the collection 'cup' and click Acquire. Let run for ~30 s, click Abort, and remove excess cleaning solution with vacuum.
      4. Rinse the collection 'cup' with deionized water and remove with vacuum. Repeat 2x.
      5. Put ~3-5 mL of M9 solution into the collection 'cup' and click Acquire. Let run for ~30 s, click Stop, and remove excess M9 solution with vacuum.
  2. Running samples on sorter
    1. Adjust laser PMT power and size gating based on the condition that causes the brightest activation of the transcriptional reporter of interest. Recommended settings can be found in Table 4.
    2. Add prepared worms to 'cup'. Click Acquire. Watch to make sure that all the liquid is not taken up into the machine; this will cause the flow cytometer to take in air and create bubbles in the detector.
    3. Click Abort when the sample is low and/or enough animals have been collected.
    4. Click Setup | Data Storage | Gated Only. This will save the data only based on the size constraints. Click Store Gated and save gated data. Click Erase to erase data.
    5. Rinse the collection 'cup' with deionized water and remove with vacuum. Repeat 2x.
    6. Repeat steps 6.2.1-6.2.5 with the rest of the samples.
  3. Calibration/ Quality Control - if necessary
    NOTE: This requires running control 42 µM GYR fluorescent particles provided, to calibrate the 488 laser.
    1. Press the metal lip on the top of the sample cup to remove the air tube. Unscrew the cap and use a syringe to remove liquid from the sample cup.
    2. Mix the bottle of control particles well before use and add few milliliters into the sample cup. Close the cap and put the air back on by pressing it on till it clicks in place.
    3. In the software, go to the Tools option and click Run Control Particles.
    4. For control particles, reset the PMT values to: GREEN - 325; YELLOW - 365; RED - 575.
    5. Click Acquire. The sheath should turn on followed by sample. Once the beads start to go through the flow cell, the flow rate will be seen at the bottom of the screen. Optimally, the flow rate should be between 5/s and 15/s. If the flow rate is too low or zero, turn the sample valve physically clockwise to increase flow rate. If the flow rate is too high, turn the sample valve physically anti-clockwise to decrease flow rate.
      NOTE: Normally, under bead saver mode, 500 beads are read before switching off. The data can be erased and beads re-read.
    6. Once the reading is completed, check for clean single peaks for the 5 parameters as well as the CV values. The Coefficient of Variance (CV) should be <15%. Also, make sure the CV values for the three different fluorescent channels are close to each other.
    7. Make a record of the QC check: under the File tab, click Save as screen image.
  4. Cleaning and shutdown
    1. Use a vacuum to remove the sample from the sample cup and repeat section 4.1.4.
    2. Put ~3-5 mL of deionized water into collection 'cup' and click Acquire, let run for ~ 30 s, and then click Abort. Leave some distilled water behind in the sample cup.
    3. Empty the sample recovery cup and the waste bottle.
    4. Turn off software. Under the File tab, click Exit. In the pop-up menu, click Turn Off Without Purging.
    5. Turn off the laser, turn off the instrument, and then turn off the air compressor. Close the hatch to cover the instrument.

7. Physiological assays to measure stress sensitivity in C. elegans

  1. Measurement of ER stress sensitivity using tunicamycin exposure
    1. Prepare NGM RNAi DMSO plates spotted with RNAi bacteria targeting the gene of interest as in section 3. Use HT115 bacteria even in experiments not involving RNAi knockdown (see Section 1). Remember to also seed NGM RNAi TM plates (see Table 1). Seed a sufficient amount of plates: plan for ~5-7 sets of NGM RNAi DMSO plates and ~2-3 sets of NGM RNAi TM plates.
    2. Synchronize animals of choice using methods described in section 2.
    3. Plate eggs onto NGM RNAi DMSO seeded plates of choice using criteria recommended in Table 2. Be sure to prepare 2x the number of plates necessary as half of the sample will be transferred to NGM RNAi TM plates.
    4. Incubate eggs at 20 °C for approximately 3-4 days (~65-96 h) to day 1 of adulthood.
    5. At day 1, prepare lifespans by transferring animals onto separate plates. To conserve plates (as TM costs are high), use 8 plates of 15 animals per condition, for a total of 120 animals per condition. This allows a manageable number of animals per plate for scoring and allows a sufficient amount of animals for statistical analyses, even with some censorship.
    6. For the first 5-7 days, move adult animals away from progeny every day onto a new plate until progeny are no longer visible. During this stage, censor animals that are bagged, exhibit vulval protrusions/explosions, or crawling up the sides of the plates, as these are not deaths associated with ER stress sensitivity. Note that TM treatment causes arrest in animals, and thus only 1-2 moves of these animals every 2-3 days is sufficient to minimize the costs associated with producing TM-containing plates. Wild-type animals have an average survival of ~15-17 days on DMSO and 12-14 days on tunicamcyin.
    7. After animals have stopped producing progeny, score lifespans every 1-2 days until all animals are scored as dead or censored. TM-treat animals every day during day 6-14 of adulthood for higher resolution.
  2. Measurement of mitochondrial and oxidative stress sensitivity using exposure to paraquat
    1. Prepare plates spotted with RNAi bacteria targeting the gene of interest as in section 3. Use HT115 bacteria even in experiments not involving RNAi knockdown (see Introduction).
    2. Synchronize animals of choice using methods described in section 2.
    3. Plate eggs onto NGM RNAi seeded plates of choice using criteria recommended in Table 1. The assay calls for ~60-100 animals per condition, so prepare accordingly.
    4. Incubate eggs at 20 °C for approximately 3-4 days (~65-96 h) to day 1 of adulthood.
    5. Prepare a fresh vial of 100 mM paraquat in M9 solution.
    6. Pipette 50-75 µL of M9+paraquat into as many wells of a flat-bottom 96-well plate as desired. It is generally recommended to have ~8-10 wells per condition containing ~8-10 animals per well. This allows for an easily visible number of animals per well with ~80 animals per strain.
    7. Pick 8-10 animals per condition and transfer them into each well containing M9+paraquat. Use a pick to transfer animals into the wells rather than pipetting to avoid differences in volume and unintended changes in paraquat concentrations.
    8. Every 2 h, score for death of animals in each well. Tap the plates gently, which will cause live animals to thrash or bend. Note that it is possible that live animals are sometimes paralyzed long enough to be scored as dead. Therefore, if the number of live animals exceeds the number of live animals from a previous timepoint, it is likely that the animal was alive and should be unscored (e.g., if at hour 4, 2/10 animals are scored as dead, and at hour 6, only 1/10 animals are dead, hour 4 should be rescored as 1/10 animals dead).
  3. Measurement of heat sensitivity using exposure to elevated temperatures
    1. Prepare plates spotted with RNAi bacteria targeting the gene of interest as in section 3. Use HT115 bacteria even in experiments not involving RNAi knockdown (see Section 1).
    2. Synchronize animals of choice using methods described in section 2.
    3. Plate eggs onto seeded plates of choice using criteria recommended in Table 1. Have 60-100 animals per condition for thermotolerance assays. For thermotolerance assays, use L1 arrest or egg lay assays for the best synchronization as there is major variability based on age of animals in the assay.
    4. Incubate animals at 20 °C for approximately 3-4 days (~65-96 h) to perform experiments at day 1 of adulthood. Do not grow worms at 15 °C for heat-shock experiments as there is a minor difference between animals experiencing heat-shock out of 15 °C versus 20 °C.
    5. At day 1, prepare animals by transferring them onto separate plates. It is generally recommended to have ~10-15 animals per plate with 4-6 plates, for a total of 60 animals. This allows a manageable number of animals per plate for scoring and allows for minimal time for animals to be pulled out of elevated temperatures.
    6. Place animals into a 37 °C incubator and score every 2 h. Start scoring for thermotolerance at 37 °C at hour 5, as little to no death occurs prior to 5 hours. Median thermotolerance is accomplished at ~9 hours, so hour 7, 9, and 11 are critical timepoints, although due to incubator and lab-to-lab variability, this may need to be titrated per lab. Moreover, any methods to decrease variability will help (e.g., not stacking plates, placing plates in the same area within a single incubator, minimizing time the incubator is opened or closed, taking as few plates out of the incubator at a time to minimize time animals spend outside of 37 °C, etc. For a full guide, see21).
    7. As an alternative to step 7.3.6, place animals at 34 °C instead of 37 °C. Median thermotolerance at 34 °C is at a little over 14 h, so time points 12, 14, and 16 are critical for 34 °C thermotolerance assays.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Using transcriptional reporters to measure activation of stress responses
Here, fluorescent transcriptional reporters are used, which serve as robust tools to measure activation of most stress responses in C. elegans. GFP expression is driven under the promoter of canonical targets of master transcriptional regulators involved in responding to compartment-specific stresses. A comprehensive list of commonly used transcriptional reporters is available in Table 3.

Perturbing ER homeostasis via unfolded or misfolded proteins or lipid bilayer stress causes the activation of the unfolded protein response of the ER (UPRER) to restore ER quality and function. The UPRER consists of 3 distinct branches defined by the transmembrane sensors: inositol-requiring protein 1 (IRE1), activating transcription factor 6 (ATF6), and protein kinase RNA (PKR)-like ER kinase (PERK), all of which are conserved in C. elegans7,22,23. The most common tool to monitor activation of the UPRER in the nematode, is the transcriptional reporter strain expressing GFP under the control of the hsp-4 promoter (hsp-4p::GFP)7. The gene hsp-4 encodes an orthologue of mammalian Hsp70, HSPA5 (or BiP/Grp78). In times of ER stress when the UPRER is activated, the hsp-4p::GFP reporter strain expresses GFP. This reporter has minimal basal expression in the absence of stress, but exhibits robust GFP expression when animals are exposed to tunicamycin (Figure 1A). These differences can also be quantified using a large-particle flow cytometer (Figure 1B). Moreover, the induction of hsp-4p::GFP under ER stress can be completely suppressed by RNAi-knockdown of xbp-1, as the activation of this transcriptional reporter is dependent on the transcription factor, XBP-112.

Similar to the UPRER, the mitochondria houses its own protective mechanism against proteotoxic stress. This mechanism, termed the mitochondrial UPR (UPRMT)24, is mainly regulated by the transcription factor, ATFS-1, which fails to enter the mitochondria under stress due to decreased import efficiency, resulting in entry of ATFS-1 into the nucleus25. Interestingly, different perturbations to mitochondrial processes can activate this response, including protein aggregation, knock down of electron transport chain (ETC) complexes subunits, mitochondrial DNA replication stress, and mitochondrial protein translation8,26. The activation of the UPRMT has been monitored by using worms expressing a transgenic construct in which GFP was placed under the regulation of the promoters of the mitochondrial chaperone genes, hsp-6 and hsp-608. Similar to hsp-4p::GFP animals, hsp-6p::GFP animals exhibit minimal basal signal in the absence of stress. The most robust method to induce the UPRMT is through RNAi-knockdown of the following mitochondrial proteins: cox-5B, the cytochrome c oxidase subunit Vb/COX4 (Complex IV)20, nuo-4, the NADH dehydrogenase protein (Complex I)27, or mrps-5, a mitochondrial ribosomal protein28, activated the hsp-6p::GFP reporter. GFP expression through this reporter is robustly activated and can be easily visualized and quantified under these conditions (Figure 2A-B). The UPRMT can also be triggered through chemical inhibition of the electron transport chain (ETC), such as with antimycin A, which inhibits cytochrome c reductase (complex III). Similar to RNAi-knockdown of ETC components, antimycin A treatment causes a robust induction of hsp-6p::GFP (Figure 2C-D).

The ability for organisms to sense and respond to oxidative stress is a conserved process present from bacteria to humans29. In C. elegans, the NRF2 homologue, SKN-1, serves as an important transcription factor, which is sensitive to redox changes due to reactive cysteines throughout the protein. SKN-1 serves as one of the transcriptional activator of the OxSR through binding to conserved consensus sequence highly resembling the antioxidant response elements bound by NRF230. In humans, NRF2 is negatively regulated by KEAP1, which is thought to be sensitive to redox changes due to reactive cysteines throughout the protein31. While there is no direct ortholog of KEAP1 in worms, SKN-1 is negatively regulated by the WD-repeat protein, WDR-23, in a manner that is mechanistically distinct from KEAP1/NRF2 inhibition32. Upon oxidative stress, such as tert-butyl hydroperoxide (TBHP), SKN-1 activates detoxification and antioxidant genes such as gst-4, a Glutathione S-Transferase. To measure oxidative stress, GFP expression is placed under the promoter of gst-4, a glutathione S-transferase33. Unlike the other transcriptional regulators presented here, gst-4p::GFP has high basal expression. However, this expression can still be robustly activated under conditions of oxidative stress, which can be performed both genetically and chemically. To genetically induce oxidative stress, we knockdown wdr-23, which encodes a protein that plays a role in proteasomal degradation of SKN-134. wdr-23 knockdown results in robust activation of gst-4p::GFP. Moreover, treatment of worms with the chemical oxidant, TBHP, results in a milder, but still significant, activation of gst-4p::GFP (Figure 3). Both chemical and genetic activation of gst-4p::GFP can be almost completely suppressed by RNAi knockdown of the skn-1, the gene encoding the master transcriptional regulator of the OxSR.

Most cellular proteins are translated in the cytoplasm and reside there, even if only temporarily before being targeted elsewhere. Thus, the cytoplasm hosts a diverse array of chaperones that promote proper protein folding and function, as well as enzymes and proteins responsible for degrading damaged, dysfunctional, or excess proteins. To protect this complex protein landscape of the cytoplasm, the cell has evolved several cytoplasmic stress response pathways, including the heat-shock response (HSR)35,36. The HSR is a pathway dedicated to promoting protein homeostasis under conditions of heat stress and is modulated by the master transcriptional regulator, HSF-137. Under steady state conditions, HSF-1 is bound by cytoplasmic chaperones, HSP90 and HSP70/40, which keeps it locked in a monomeric, inactive state. Under conditions of heat or similar stress, an increase in misfolded proteins results in titration of chaperones away from HSF-1, allowing it to trimerize and translocate to the nucleus to activate the HSR38,39. Perhaps the most-studied downstream targets of HSF-1 under HSR activation are the heat-shock proteins (HSPs), such as HSP70, HSP90, DNAJ, and HSP6017,40. In C. elegans, transcriptional reporters for HSR have been synthesized by driving the expression of GFP under the promoters of canonical HSPs, hsp-16.2 and hsp-709,41. Like their UPRMT and UPRER counterparts, hsp-16.2p::GFP and hsp-70p::GFP show minimal basal expression in the absence of stress. However, both reporters are robustly induced under conditions of heat stress, which can be easily visualized by microscopy or quantified using a large particle flow cytometer (Figure 4). Both reporters have large dynamic range, and induction is completely dependent on hsf-1, as RNAi-knockdown of hsf-1 fully suppresses induction of hsp-16.2p::GFP and hsp-70p::GFP. While these reporters can be used interchangeably for most situations, there may be differences in expression levels and expression across tissues.

Physiological assays to measure stress sensitivity in C. elegans
C. elegans are a great model organism to measure stress sensitivity due to the low cost in maintenance and experimentation and ease of genome editing or genetic knockdown using RNAi, which provides the capacity to perform large-scale experiments in a whole organism. To assay stress tolerance to ER stress, we expose C. elegans to the chemical agent, tunicamycin, which causes accumulation of damaged proteins in the ER by blocking N-linked glycosylation10. Animals are exposed to tunicamycin post-development, as the drug causes developmental defects. When exposed to tunicamycin, adult worms exhibit a marked decline in lifespan. Moreover, knockdown of the gene, xbp-1, which encodes one of the primary transcription factors involved in UPRER induction, results in a significant increase in sensitivity to tunicamycin (Figure 5A)12. Thus, this serves as a robust assay to measure ER stress sensitivity in adult worms.

To measure oxidative stress and mitochondrial stress, we expose animals to the chemical agent, paraquat. Paraquat causes mitochondrial stress by synthesis of ROS within the mitochondrial matrix, which can then be converted into hydrogen peroxide and diffuse out of the mitochondria to cause whole-cell oxidative damage13. Similar to ER stress assays, we expose animals to paraquat at adulthood. However, we perform paraquat assays in liquid to reduce cost and manual labor and agar plate-based assays would be difficult for most labs. Here, we show that animals exposed to paraquat in liquid show median survival of approximately 5 hours (Figure 5B). Moreover, knockdown of the insulin receptor, daf-2, results in an increased resistance to paraquat as activation of DAF-16/FOXO results in increased expression of involved in clearance of ROS, such as sod-342,43. Paraquat survival assays are short, lasting up to 14 hours, and thus serve as an efficient method to interrogate mitochondrial and oxidative stress responses.

Finally, survival at elevated temperatures is used to interrogate the physiological response to heat stress. These assays can be performed both in liquid or solid agar, and there exist numerous different protocols outlined21. It is recommended to standardize a single assay in the lab to decrease variability, which is exceptionally high in this assay. Thermotolerance should be performed in day 1 adult animals on standard agar plates, either at 34 °C or 37 °C. At 37 °C, a majority of death occurs between 7-11 hours, making this a simple single-day assay, whereas 12-16 hour experiments at 34 °C are most easily performed overnight (Figure 5C-E). Mutation in the gene, ttx-3, results in failure of specification of the AIY interneurons responsible for the thermosensory neural circuit, and causes a significant increase in thermosensitivity44. While thermotolerance data can be plotted as a survival curve (Figure 5C), these assays should be performed at least 4-6 times and all replicates should be plotted against each other (Figure 5D-E), as thermotolerance shows incredibly high variability in comparison to other stress assays. This is due to the many caveats that exist in setting up these experiments, including variability in strains of interest, unequal cycling of air in incubators, uneven agar plates, etc.21. At 34 °C, median survival occurs at approximately 14 hours, and similar to 37 °C, ttx-3 mutants exhibit decreased survival at 34 °C (Figure 5E).

Figure 1
Figure 1: Using hsp-4p::GFP as a reporter for UPRER induction. (A) Representative fluorescent micrographs of hsp-4p::GFP expressing animals grown on control empty vector (EV) or xbp-1 RNAi. Animals were grown on RNAi from hatch until L4 at 20 °C, then treated with 25 ng/µL tunicamycin or 1% DMSO floating in M9 at 20 °C for 4 hours, and recovered on an OP50 plate for 16 hours at 20 °C prior to imaging. Animals were paralyzed in 100 µM sodium azide on an NGM agar plate and imaged using a stereomicroscope. (B) Quantitative analysis of (A) using a large particle biosorter. Data is represented as integrated fluorescence intensity across the entire animal where each dot represents a single animal; DMSO control is in grey and tunicamycin treated animals are in red. Central line represents the median, and whiskers represent the interquartile range. n = 123-291 animals per strain. ***p < 0.001 using non-parametric Mann-Whitney testing. Please click here to view a larger version of this figure.

Figure 2
Figure 2: Using hsp-6p::GFP as a reporter for UPRMT induction. (A) Representative fluorescent micrographs of hsp-6p::GFP expressing animals grown on control empty vector (EV), cco-1, mrps-5, or nuo-4 RNAi. Animals were grown on RNAi from hatch and imaged on day 1 of adulthood at 20 °C. Animals were paralyzed in 100 µM sodium azide on an NGM agar plate and imaged using a compound microscope. (B) Quantitative analysis of (A) using a large particle biosorter. Data is represented as integrated fluorescence intensity across the entire animal where each dot represents a single animal; EV control is in grey RNAi-treated animals are in red. Central line represents the median, and whiskers represent the interquartile range. n = 303-384 animals per strain. ***p < 0.001 compared to EV control using non-parametric Mann-Whitney testing. (C) Representative images of hsp-6p::GFP animals treated with DMSO or Antimycin A. Animals were grown from hatch on 0.2% DMSO plates and transferred to plates containing 0.2% DMSO or 3 mM antimycin A for 16 hours prior to imaging on a Revolve ECHO R4 compound microscope. All growth was performed at 20 °C. (D) Quantitative analysis of (C) using a large particle biosorter similar to (B). DMSO controls are in great, and Antimycin A-treated animals are in red. n = 495 for DMSO and 219 for Antimycin A. ***p < 0.001 compared to EV control using non-parametric Mann-Whitney testing. Please click here to view a larger version of this figure.

Figure 3
Figure 3: Using gst-4p::GFP as a reporter for the OxSR. (A) Representative fluorescent micrographs of gst-4p::GFP expressing animals grown on control empty vector (EV), skn-1, or wdr-23 RNAi. Animals were grown on RNAi from hatch until L4 stage at 20 °C. Animals were grown on RNAi from hatch until L4 at 20 °C, then treated with 2 mM TBHP in M9 or only M9 for "untreated" control at 20 °C for 4 hours, and recovered on an EV plate for 16 hours at 20 °C prior to imaging. Animals were paralyzed in 100 µM sodium azide on an NGM agar plate and imaged using a compound microscope. (B) Quantitative analysis of (A) using a large particle biosorter. Data is represented as integrated fluorescence intensity across the entire animal where each dot represents a single animal; untreated control is in grey and TBHP-treated animals are in red. Central line represents the median, and whiskers represent the interquartile range. n = 101-204 animals per strain. ***p < 0.001 compared to respective EV control using non-parametric Mann-Whitney testing. Please click here to view a larger version of this figure.

Figure 4
Figure 4: Using hsp16.2p::GFP and hsp-70p::GFP as reporters for the heat-shock response. (A) Representative fluorescent micrographs of hsp16.2p::GFP expressing animals grown on control empty vector (EV) or hsf-1 RNAi. Animals were grown on RNAi from hatch at 20 °C until day 1. Day 1 animals were either left at 20 °C (untreated) or exposed to 2 hours of heat stress at 34 °C, then recovered for 2 hours at 20 °C. Animals were paralyzed in 100 µM sodium azide on an NGM agar plate and imaged using a stereomicroscope. (B) Quantitative analysis of (A) using a large particle biosorter. Data is represented as integrated fluorescence intensity across the entire animal where each dot represents a single animal; untreated control is in grey and heat-shocked animals are in red. Central line represents the median, and whiskers represent the interquartile range. n = 320-364 animals per strain. ***p < 0.001 using non-parametric Mann-Whitney testing. (C) Representative fluorescent micrographs of hsp-70p::GFP expressing animals grown on control EV and hsf-1 RNAi and treated as described in (A). (D) Quantitative analysis of (C) as described in (B). n = 773-941 animals per strain. Please click here to view a larger version of this figure.

Figure 5
Figure 5: Physiological survival assays under stress in C. elegans. (A) Lifespans of nematodes grown on 1% DMSO containing 25 ng/µL tunicamycin (TM) plates. Animals were grown on 1% DMSO plates from hatch until day 1, and transferred to respective TM plates at day 1. Animals were kept on control empty vector (EV) or xbp-1 RNAi from hatch until the end of the assay at 20 °C. Adult animals are manually moved away from progeny every day until ~ day 7-8 when progeny were no longer detected, then scored every 2 days until all animals were recorded as dead or censored. Animals with bagging, vulval protrusions/explosions, or those that crawled up the sides of plates were considered censored. (B) Survival curve of nematodes in 100 mM paraquat (PQ) dissolved in M9 solution. Animals were grown on EV or daf-2 RNAi from hatch until day 1 of adulthood at 20 °C. Animals were placed into 50 µL of M9 + PQ solution in a 96 well-plate at 20 °C and visualized every 2 hours until all animals were motionless. (C) Survival curve of nematodes at 37 °C. Wild-type (N2), ttx-3(KS5), and sur-5p::hsf-1 animals were grown on EV plates from hatch until day 1 at 20 °C. At day 1, animals were moved to 37 °C and scored every 2 hours until all animals were scored as dead or censored. (D) Pooled data of all thermotolerance assays performed at 37 °C. Data are represented as percent alive at hour 9 of a thermotolerance assay, with each line representing a matched experiment performed on the same day. (E) Pooled data of all thermotolerance assays performed at 34 °C. Data are represented as percent alive at hour 14 of a thermotolerance assay, with each line representing a matched experiment performed on the same day. All statistics for A-C were performed using Log-Rank (Mantel-Cox) testing and can be found in Table 5. Please click here to view a larger version of this figure.

Reagent Recipe
Lysogeny Broth (LB) In this protocol, commercial LB was used (see Materials), but all standard LB home-made recipes using Bacto-tryptone, yeast extract, and NaCl are sufficient.
Nematode Growth Media (NGM) 1 mM CaCl2, 5 µg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl
Bleach solution 1.8% (v/v) sodium hypochlorite, 0.375 M KOH
M9 solution 22 mM KH2PO4 monobasic, 42.3 mM Na2HPO4, 85.6 mM NaCl, 1 mM MgSO4
NGM RNAi plates 1 mM CaCl2, 5 µg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 µg/mL carbenicillin/ampicillin. Store at 4 ° C in dark for up to 3 months
Tetracycline 10 mg/mL stock solution (500x) in 100% ethanol. Store at -20 °C
Carbenicillin 100 mg/mL stock solution (1000x) in water. Store at 4 °C for up to 6 months or -20 °C for long-term storage
Sodium azide 1 M stock (~6.5%) stock solution of sodium azide in water. Store in the dark at 4 °C. This is a 10x solution and is diluted to a 100 mM working stock for most imaging experiments
Tunicamycin 2.5 mg/mL stock solution in 100% DMSO. Store at -80 °C for long-term storage. This is a 100x solution (25 ng/µL working solution)
Antimycin A 15 mM antimycin A stock solution in 100% DMSO. Store at -20 °C. This is a 5000x solution (3 µM working stock)
Paraquat 50 µM solution in water – should be prepared fresh
Tert-butyl hydroperoxide (TBHP) 7.7 M solution in water. This is a 3850x solution (2 mM working stock)
NGM RNAi + DMSO0.2 1 mM CaCl2, 5 µg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 µg/mL carbenicillin/ampicillin, 0.2% DMSO
(control for antimycin A)
NGM RNAi + antimycin A 1 mM CaCl2, 5 µg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 µg/mL carbenicillin/ampicillin, 0.2% DMSO, 3 mM antimycin A
NGM RNAi DMSO 1 mM CaCl2, 5 µg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 µg/mL carbenicillin/ampicillin; 1% DMSO
(control for tunicamycin)
NGM RNAi TM 1 mM CaCl2, 5 µg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 µg/mL carbenicillin/ampicillin; 1% DMSO, 25 ng/µL tunicamycin
IPTG 1 M solution in water.

Table 1: Recommended recipes for reagents used. All the exact recipes of the reagents used in this protocol are outlined here. Specific companies where reagents were purchased are also available in the Table of Materials. Many different sources of chemicals were tested, and those listed in the Table of Materials are those that exhibited the most robust and reproducible results.

Plate Size Bacteria Type # of animals to reach day 1 adulthood # of animals to reach L4 stage
60 mm OP50 100-150 150-300
60 mm HT115 70-100 120-200
100 mm OP50 600-1000 1500-2000
100 mm HT115 350-600 700-1300

Table 2: Recommended number of animals to plate post-synchronization to avoid starvation. To avoid starvation, we recommend plating a specific number of animals per condition. Since OP50 grows denser than HT115, more animals can be plated. All numbers listed here are the guidelines used in our lab, and numbers may be slightly different due to several variables and differences between laboratory conditions. Therefore, or recommended numbers are on the lower side in bold font. Max numbers are what could be plated in optimal conditions in our lab without reaching starvation, but it is not recommended to use these values without first titrating your conditions. All numbers are determined with the assumption that bacteria are seeded onto plates and allowed to grow for ~24 hours at ambient temperature (~22 °C) on plates prior to worms being placed on them. Although there is no major difference in starvation rates when plating eggs or L1s, we recommend plating ~10% higher numbers when plating eggs, since not all eggs will hatch post-bleaching.

Strain name Transgene Purpose Recommended application(s) of stress Source
SJ4005 hsp-4p::GFP UPRER 25 µg/mL tunicamycin CGC
SJ4100 hsp-6p::GFP UPRMT 3 µM antimycin A; CGC
RNAi against ETC or mitochondrial ribosome
SJ4058 hsp-60p::GFP UPRMT 3 µM antimycin A; CGC
RNAi against ETC or mitochondrial ribosome
CL2070 hsp-16.2p::GFP heat-shock response 34 °C 2 hours CGC
AM446 hsp-70p::GFP heat-shock response 34 °C 2 hours Morimoto Lab
CL2166 gst-4p::GFP OxSR 50 mM paraquat; CGC
2 mM tert-butyl hydroperoxide
CF1553 sod-3p::GFP OxSR & insulin signaling RNAi against daf-2 (insulin receptor) CGC
AU78 T24B8.5p::GFP innate immune response pathogen exposure (e.g. P. aeruginosa) CGC

Table 3: Transcriptional reporters for assessing activation of cellular stress responses. The strains listed here are all available through CGC or through special requests to laboratories for use in both qualitative and quantitative imaging methods described in this manuscript. These strains are all derived from the Bristol N2 background. Recommended methods to apply stress to activate the reporters are also provided. All reporters, with the exception of sod-3p::GFP45 and T24B8.5p::GFP46 are described in the text.

Transgene Recommended application(s) of stress Exposure time using a Leica M2250FA stereo microscope Exposure time using a Revolve ECHO microscope PMT values using a Union Biometrica COPAS biosorter
hsp-4p::GFP 25 µg/mL tunicamycin (~4 hours with overnight recovery) 200 ms 275 ms 450
hsp-6p::GFP 3 µM antimycin A (~16 hours); 100ms 50 ms 350
RNAi against ETC or mitochondrial ribosome (from hatch)
hsp-60p::GFP 3 µM antimycin A (~16 hours); 200 ms 100 ms 450
RNAi against ETC or mitochondrial ribosome (from hatch)
hsp-16.2p::GFP 34 °C 2 hours 400 ms 200 ms 500
hsp-70p::GFP 34 °C 2 hours 400 ms 300 ms 500
gst-4p::GFP 50 mM paraquat (~2 hours); 100 ms 50 ms 350
2 mM tert-butyl hydroperoxide (~4 hours with overnight recovery)
sod-3p::GFP RNAi against daf-2 (insulin receptor) 300 ms 300 ms 475
T24B8.5p::GFP pathogen exposure (e.g. P. aeruginosa) 100 ms 50 ms 350

Table 4: Recommended settings for fluorescent microscopy and quantification using a large particle biosorter. This table serves as guideline for recommended exposure times for fluorescent microscopy or PMT values for the large particle biosorter. These will serve as good starting points, but the exposure time and PMT value should be adjusted for every experiment to ensure that no saturation occurs and that fluorescent values are over the detection limit of background signal. If the sample with the brightest signal for an experiment is known (e.g., positive controls for stress induction), those samples can be used to determine the highest exposure time or PMT that can be used without saturating signal. If the brightest samples are not known, then the control can be used and an exposure time or PMT at the center of the dynamic range of your system can be used.

Corresponding Figure Strain, Treatment Median Lifespan # Deaths/# Total % change in median lifespan p-value (Log-Rank; Mantel-Cox)
5A N2, vector RNAi, 1% DMSO 22 days 95/120 -- --
N2, xbp-1 RNAi, 1% DMSO 14 days 92/120 -36.4 < 0.001
N2, vector RNAi, 25 ng/µL TM 14 days 97/120 -36.4 < 0.001
N2, xbp-1 RNAi, 25 ng/µL TM 12 days 98/120 -45.4 < 0.001
5B N2, vector RNAi, 100 mM PQ 5 hours 73/73 -- --
N2, daf-2 RNAi, 100 mM PQ 6.5 hours 74/74 30 < 0.001
5C N2, vector RNAi, 37 °C 8 hours 59/60 -- --
ttx-3(KS5), vector RNAi, 37 °C 7 hours 60/60 -12.5 0.002
sur-5p::hsf-1, vector RNAi, 37 °C 9 hours 59/60 12.5 0.012

Table 5: Statistics for lifespans and stress survival assays. All sample sizes, statistics, and censorship rates for Figure 5 are available here.

Stress Response Target Gene Forward Primer Reverse Primer
UPRER hsp-3 TCGCTGGATTGAACGTTGTTCG GTTGCGTTCTCCGTCCTTCTTG
UPRER hsp-4 GAACAACCTACTCGTGCGTTGG GAACAACCTACTCGTGCGTTGG
UPRER sel-11 TTGATCTCCGGAAAACGCAACG TTGATCTCCGGAAAACGCAACG
UPRER ire-1 TCCTCAACCGCTCCATCAACAT TCCTCAACCGCTCCATCAACAT
UPRER xbp-1 GGACTTCTTCGGCTTCTGGAGT GGACTTCTTCGGCTTCTGGAGT
UPRER xbp-1 (spliced) GGTGGATGGAGGGAGAAGATT GGTGGATGGAGGGAGAAGATT
UPRER crt-1 GAAGTAATAGCCGAGGGAAGC GAAGTAATAGCCGAGGGAAGC
UPRER T14G8.3 CACCTCCATCAACAACAACAT CACCTCCATCAACAACAACAT
HSR hsp-17 TCGTTTTCCACCATTCTCCCCA TGTTTGATCGGCCCAGTATGGT
HSR hsp-70 TGTTTGATCGGCCCAGTATGGT TTCGCAATGAGAAGGGACGACT
HSR F44E5.4 TTCGCAATGAGAAGGGACGACT CGTTGTGCTGCGTCTTCTCTTT
HSR hsp-16.2 TCCATCTGAGTCTTCTGAGATT
GTTA
TGGTTTAAACTGTGAGACGTTGA
HSR hsf-1 TTTGCATTTTCTCGTCTCTGTC TCTATTTCCAGCACACCTCGT
UPRMT hsp-6 GAGATCGTGGAACCGGAAAGGA CGGCATTCTTTTCGGCTTCCTT
UPRMT hsp-60 CGGCATTCTTTTCGGCTTCCTT CGTCGTTGCAGAGCTCAAGAAG
UPRMT ymel-1 CAAAACCTGATCTCGCTGGG TTCTCAATGTCGGCTCCAGT
UPRMT clpp-1 TGATAAGTGCACCAGTGTCCA TGATTCTGGAGTTCGGGAGA
UPRMT lonp-1 CGATGATGGCCATTGTGCAG CGCTTTGAAACATCAATTTCAT
CCA
OxSR gst-4 GATGCTCGTGCTCTTGCTG CCGAATTGTTCTCCATCGAC
OxSR gst-6 CCGAATTGTTCTCCATCGAC TTTGGCAGTTGTTGAGGAG
OxSR gst-7 TTTGGCAGTTGTTGAGGAG TGGGTAATCTGGACGGTTTG
OxSR gcs-1 TGGGTAATCTGGACGGTTTG ATGTTTGCCTCGACAATGTT
OxSR skn-1 GGACAACAGAATCCCAAAGG TCAGGACGTCAACAGCAGAC
OxSR sod-3 GTAACGGGCGATAGCATGAG GCGAGAGCACATTGATGAC
OxSR ptps-1 AATCGATTCCTTTGGAGACC CAATCTACTGCTCGCACTGCTT
CAAAGC
reference pmp-3 TGGCCGGATGATGGTGTCGC ACGAACAATGCCAAAGGCCAGC
reference Y45F10.4 CGAGAACCCGCGAAATGTCGGA CGGTTGCCAGGGAAGATGAGGC
reference sap-49 TGGCGGATCGTCGTGCTTCC ACGAGTCTCCTCGTTCGTCCCA
reference tba-1 TCAACACTGCCATCGCCGCC TCCAAGCGAGACCAGGCTTCAG

Table 6: Recommended gene targets and primer pairs for measuring transcriptional upregulation of stress response genes.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Here, methods to interrogate cellular stress responses in C. elegans, using fluorescent transcriptional reporters and physiological stress survival assays are described. The reporters all utilize GFP expression driven under the promoter of a downstream transcriptional target of the transcription factors involved in mounting cellular stress responses. The use of hsp-4p::GFP modulated by XBP-1s-mediated UPRER, hsp-6p::GFP controlled by ATFS-1-mediated UPRMT, gst-4p::GFP under SKN-1-mediated OxSR, and hsp16.2p::GFP and hsp-70p::GFP under HSF-1-mediated heat-shock response are explained. Other standardized transcriptional reporters can be found in Table 3. All the transcriptional reporters presented here have a wide dynamic range and can be robustly activated by applying stress either through genetic perturbations or exposure to stress-inducing chemicals. Moreover, these reporters can all be suppressed by knockdown of the transcription factors upstream of the promoters employed. Finally, each transcriptional reporter is paired to a specific physiological stress survival assay to provide a physiological readout of the impact of either activating or repressing a specific stress response.

To successfully employ the use of transcriptional reporters, it is essential to determine the dynamic range of each reporter. Due to major lab-to-lab variability caused by differences in media, agar, ambient environment, etc., it is recommended to titrate each drug or stress induction paradigm for concentrations and timing using our recommendations as a baseline. Next, it is critical to ensure the animals are healthy and properly synchronized. Animals that have experienced some sort of stress (e.g., starvation, long-term exposure to light, exposure to elevated temperature, etc.) should be recovered for several generations prior to experimentation. Proper synchronization can be achieved by using the methods outlined in section 2, which is essential as several stress responses have different levels of activation during the aging process. Finally, imaging protocols are essential to standardize, as there are various things that can affect image and data quality. For example, duration of animals in sodium azide should be minimized, as this causes stress to animals and can affect reporter signal. Moreover, microscope and biosorter specifications should be properly set to maximize signal-to-noise ratio and dynamic range, without causing saturation. Saturated pixels can cause major issues in quantitative analysis of samples, as maximum fluorescent signal can be severely underestimated.

While the transcriptional reporters described here provide a robust and efficient means to measure activation of stress responses, it is critical to understand that it is a single gene target of a known transcription factor. Therefore, while it serves as a reliable method for large-scale screens or first-pass tests of strains of interest, proper validations should be performed. We recommend performing qPCR to measure several canonical target genes activated upon induction of each stress response being assayed. A list of suggested gene targets can be found in Table 6. In addition, transcriptome profiling through RNA-seq is another alternative for a broader look at effects on multiple transcriptional targets at once. Of particular note, the imaging of fluorescent reporters provides spatial information regarding tissues that are affected by the perturbations. Such information cannot be obtained from qRT-PCR or RNA-seq, as it uses whole-worm extracts, except by scRNA-seq, FISH, and tissue-specific RNAseq protocols47. Finally, these stress reporters are generally characterized as being specific to their stress response machinery. However, it is important to remember that not all stress response paradigms are unique and distinct. For example, ER stress can activate OxSR and vice versa48, and overlaps between heat-shock response and ER stress responses have been commonly found49. These are just a few of the many examples in the literature of cross-communication and overlap between stress responses, and thus it is important to understand that all assays should also be tested for specificity to derive final conclusions.

Another limitation of the methods described are that imaging and quantification through a biosorter has limited throughput. While biosorter quantification can be performed in 96-well plates for higher throughput, it is still limited by the necessity to transfer worms into solution, whereas imaging is limited by the investigator's capacity to prepare worms and perform microscopy. Therefore, large-scale screens will most likely involve only a visual screening of fluorescent reporter signal, with only hits being imaged and quantified.

An important caveat with using these fluorescent reporters is that activation or suppression of stress responses do not always contribute to physiologically meaningful phenotypes, or may reflect other global effects (e.g., decrease in protein synthesis). Therefore, every transcriptional reporter is paired to a method to assay stress survival. It is recommended to perform tunicamycin survival assays for the UPRER, paraquat survival assays for the UPRMT and the OxSR, and survival in elevated temperatures for the heat-shock response. While these are generally robust, fast, and simple assays, they require intensive manual labor, and thus are severely limited in scalability. Moreover, almost all thermotolerance assays published to date have major variability, making a large number of replicates almost essential21. While the tunicamycin and paraquat survival assays do not suffer from this lack of reproducibility, they have their own challenges, including extensive hands-on labor and duration of the protocol. As new technologies are born in automating lifespan and survival assays, it is likely that these stress survival assays can also become high-throughput50. However, until these automated assays become standard, survival assays are currently limited to validation of physiological consequences in altering dynamics of stress response activity.

Beyond the stress survival assays described here, there are a number of other methods to measure physiology in animals. For example, a commercially available Seahorse XFp Analyzer can allow monitoring of cellular respiration, which provides additional mechanistic insight51. Another alternative to transcriptional reporters is the use of nuclear localization of fluorescently labelled transcription factors. There are numerous variants of this technique, but of particular interest to the methods described here include: HSF-1::GFP for the heat-shock response52, DVE-1::GFP for the UPRMT53, and DAF-16::GFP and SKN-1::GFP for the OxSR54,55. Finally, direct interrogation of morphology of specific organelles of interest can be performed. For example, mitochondrial morphology can be visualized by utilizing a fluorophore targeted to the mitochondrial matrix using a mitochondrial-localization sequence56. ER morphology can be visualized by utilizing a fluorophore targeted to the ER through a signal-sequence fused to the N-terminus and HDEL fused to the C-terminus57 or GFP fused to an ER membrane protein58. Finally, actin cytoskeletal integrity can be used as a proxy for thermal stress sensitivity downstream of HSF-1. The actin cytoskeleton is regulated by transcriptional targets of HSF-1, specifically during aging and heat-stress, and thus actin organization can be visualized to determine functional readout of HSF-1 and heat-related stress59,60.

All of the methods described here can be used independently or in combination with each other for a comprehensive analysis of genes or drugs of interest and their impact on stress response. Large-scale screens can be performed using high-throughput transcriptional reporter assays, and secondary screens can be performed using quantitative analyses of these reporters. Once more manageable candidate gene/drug lists are identified, physiological assays can be performed to identify those candidates that have direct impact on whole animal physiology. The other methods suggested above can also be used as validation or further investigation.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

The authors have nothing to disclose.

Acknowledgments

R.BZ. is supported by the EMBO long term fellowship and The Larry L. Hillblom Foundation. R.H.S is supported by grant 5F32AG032023-02 through the National Institute of Aging (NIA) and the Glenn Foundation for Medical Research Postdoctoral Fellowship. A.F. is supported by grant F32AG051355 through the NIA. H.K.G. is supported by grant DGE1752814 through the National Science Foundation Graduate Research Fellowship Program. M.G.M. is supported by 1F31AG060660-01 through NIA. A.D. is supported by the Thomas and Stacey Siebel Foundation, the Howard Hughes Medical Institute, and 4R01AG042679-04 and 5R01AG055891-02 from NIA, and 5R01ES021667-09 from NIEHS. We thank Larry Joe, Melissa Sanchez, Naame Kelet, and Anel Esquivel for significant technical assistance. We thank the Morimoto lab and the CGC (funded by NIH Office of Research Infrastructure Program P40 OD010440) for strains.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).
Measurements of Physiological Stress Responses in <em>C. Elegans</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).More

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter