Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Измерения физиологических стрессовых реакций у C. Elegans

doi: 10.3791/61001 Published: May 21, 2020
* These authors contributed equally

Summary

Здесь мы характеризуем клеточные протеотоксические реакции стресса в нематоде C. elegans путем измерения активации флуоресцентных транскрипционных репортеров и просказа чувствительности к физиологическому стрессу.

Abstract

Организмы часто подвергаются колебаниям среды и изменения внутриклеточного гомеостаза, которые могут иметь пагубные последствия для их протеома и физиологии. Таким образом, организмы развивались целенаправленные и конкретные реакции стресса, посвященный ремонту повреждений и поддерживать гомеостаз. Эти механизмы включают в себя развернутую реакцию белка эндоплазмического ретикулума (UPRER),развернутую белковую реакцию митохондрий (UPRMT),реакцию теплового шока (HSR) и окислительную реакцию стресса (OxSR). Представленные здесь протоколы описывают методы обнаружения и характеристики активации этих путей и их физиологических последствий в нематоде, C. elegans. Во-первых, использование флуоресцентных транскрипционных репортеров, специфичных для использования в пути, описывается для быстрой клеточной характеристики, скрининга наркотиков или крупномасштабного генетического скрининга (например, библиотеки РНК или мутантов). Кроме того, описаны дополнительные, надежные физиологические анализы, которые могут быть использованы для непосредственной оценки чувствительности животных к конкретным стрессорам, служа функциональной проверкой транскрипционных репортеров. Вместе эти методы позволяют быстро охарактеризовать клеточные и физиологические эффекты внутренних и внешних протеотоксических возмущений.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Способность организма реагировать на изменения внутри- и внеклеточной среды имеет решающее значение для его выживания и адаптации. Это достигается на клеточном уровне через многочисленные защитные пути, которые обеспечивают целостность клетки. В то время как многочисленные клеточные компоненты подвержены стресс-ассоциированных повреждений, одним из основных участие клеточных реакций стресса является ремонт и защита гомеостаза клеточного протеома. Тем не менее, разобщенство белков в специальные структуры, называемые органеллами, представляет собой проблему для клетки, так как она не может полагаться на одну централизованную форму контроля качества белка, чтобы гарантировать, что все белки в клетке правильно сложены и функциональны. Поэтому, чтобы справиться с возмущениями к их белкам, органеллы развили специальные механизмы контроля качества, которые могут чувствовать неправильно сложенные белки и активировать стресс ответ в попытке облегчить стресс в этом отсеке. Например, цитозол опирается на реакцию теплового шока (HSR), в то время как эндоплазмический ретикулум (ER) и митохондрии полагаются на их отсек конкретных развернутых белковых реакций (UPR). OxSR служит для облегчения токсического воздействия реактивных видов кислорода (ROS). Каждый стресс ответ вызывается в присутствии сотовых проблем и экологических оскорблений и вызывает индивидуальный транскрипционный ответ. Отличительными чертами этих ответов являются синтез молекулы, которые повторно складываются неправильно сложенные белки (например, сопровождающие), предназначенные для надлежащей органеллы, или же, удалить поврежденные белки путем деградации белка. Неспособность активировать эти стрессовые реакции приводит к накоплению поврежденных белков, клеточной дисфункции, распространяемых на системный отказ тканей, и в конечном итоге смерти организма. Функция и регулирование различных ответов на стресс рассматриваются в другом месте1.

Многие идеи в отношении регулирования и активности клеточных реакций стресса были отнесены к нематод, Caenorhabditis elegans, многоклеточной модели организма в генетических исследованиях. Нематоды позволяют изучать активацию стрессовых реакций не только на клеточном уровне, но и на уровне организма; нематод были использованы для изучения влияния генетических возмущений или воздействия наркотиков и загрязняющих веществ на их рост и выживание. Их быстрое время генерации, изогенность, прозрачность, генетическая уступчивость и простота использования во время экспериментов делают их идеальными для таких исследований. Кроме того, относительно быстрая физиологическая реакция на стресс (между часами и несколькими днями) и эволюционное сохранение клеточных путей делают нематоды выдающимся инструментом в изучении стрессоустойчивости.

Есть два широко используемых штаммов кишечной палочки, используемых в качестве источника пищи для выращивания C. elegans: стандартный OP50, штамм B, в котором большинство экспериментов было исторически выполнено2 и HT115, штамм K-12, который используется почти для всех экспериментов РНК3,4. Важно отметить, что существуют значительные различия между OP50 и HT115 бактериальных диет. Рост на этих различных бактериальных источников было показано, что причиной серьезных различий в метаболических профиля, митохондриальной КОПИи днк номер, и несколько основных фенотипов, в том числе продолжительность жизни5. Некоторые из этих различий объясняются дефицитом витамина В12, связанным с ростом бактерий OP50, что может привести к дефектам митохондриального гомеостаза и повышенной чувствительности к патогенам и стрессам. Все эти фенотипы, как было показано, были смягчены ростом на HT115 бактерий, которые имеют более высокий уровень витамина B126. Поэтому рекомендуется проводить все эксперименты по физиологическим стрессовым реакциям на бактериях HT115, независимо от необходимости РНК. Однако, из-за простоты поддержания животных на OP50, весь стандартный рост (т.е. обслуживание и усиление животных) может быть выполнен на OP50, так как значительные различия в экспериментальных парадигмах, описанных здесь, не были обнаружены у червей, поддерживаемых на OP50 до тех пор, пока они не были перенесены на HT115 пост синхронизации (т.е. от люка после отбеливания с или не-ареста).

Здесь описана характеристика активности клеточных стрессовых реакций с использованием двух функциональных методов. Следует отметить, что представленные протоколы в первую очередь ориентированы на клеточные реакции стресса и их влияние на белок гомеостаза. Во-первых, используются флуоресцентные транскрипционные репортеры, которые регулируются эндогенными генными промоутерами, которые специально активируются в ответ на различные клеточные стрессы. Эти флуоресцентные транскрипционные репортеры основаны на транскрипционной индукции конкретных генов, которые являются родным и частью реакции на стресс. Например, HSP-4, белок теплового шока orthologous для человека сопровождающего HSPA5/BiP, активируется на ER-стресс и локализуется в ER, чтобы облегчить стресс. В условиях стресса ER (например, воздействие туникамицина), зеленый флуоресцентный белок (GFP), помещенный под регулирование hsp-4 промотор, синтезируется в высоких уровнях, как может быть оцененфлоесцентной микроскопии или количественно измеряется с помощью крупночастицного потока цитометрии нематод7. Аналогичным образом, промоутер митохондриального сопровождающего, hsp-6 (ортологос для млекопитающих HSPA9), используется для мониторинга активации UPRMT8, и промоутер цитосоликического сопровождающего hsp-16.2 (ортолологос того к кристаллическому альфа-генам человека) используется для оценки активности HSR9. Эти репортеры позволяют быстро охарактеризовать пути, активированные в ответ на различные возмущения.

Часто представленные здесь репортеры изображены с помощью микроскопии, которая обеспечивает качественный выход активации стрессовых реакций. Однако, хотя методы визуализации предоставляют как информацию об интенсивности, так и местонахождении тканей репортеров, описанных выше, ее количественная оценка не всегда является точной или надежной. Хотя можно количественно флуоресцентной активации с помощью инструментов анализа изображений, эти методы являются относительно низкой пропускной всей и размер выборки невелик, из-за относительно низкого числа животных изображения. Легкость и способность получать большое количество животных быстро делают C. elegans идеальной модельной системой для того чтобы рассказать активацию флуоресцентных репортеров усилия через использование цитометра потока больших частиц. Цитометр потока больших частиц способен регистрировать, анализировать и сортировать на основе размера и флуоресценции от многих живых животных. Используя этот метод, можно получить флуоресцентную интенсивность, размер, а также пространственную (2D) информацию для тысяч червей. Система управляется с помощью FlowPilot, что позволяет в режиме реального времени получать и анализировать измеренные параметры. Здесь в качестве методов измерения активации стрессовых реакций предлагаются методы как микроскопической визуализации, так и количественного анализа с использованием цитметра потока больших частиц.

Помимо анализа репортера, чувствительность или устойчивость животных к стрессу может быть измерена с помощью физиологических анализов стресса. Это достигается путем воздействия животных на стрессовых средах, которые активируют конкретные клеточные пути стресса. Здесь предусмотрено несколько методов измерения чувствительности целых животных к определенным видам стрессоров.

ER стресс применяется к C. elegans с помощью химического агента, туникамицина, который блокирует N-связанных гликозилирования, вызывая накопление неправильно сложенных белков в ER10. В C. elegans, рост при воздействии туникамицина приводит к серьезным возмущениям в функции ER, и значительно сократилась продолжительность жизни11. Путем измерять выживание животных на туникамицин-содержащих плитах, чувствительность усилия ER может быть измерять. Например, животные с внематочной индукцией UPRER и, таким образом, повышенной устойчивостью к воздействию белка неправильно горит в ER, имеют повышенную выживаемость при воздействии туникамицина по сравнению с дикими животнымитипа 12.

Оксидативный и митохондриальный стресс применяется к C. elegans, подвергая животных химическому агенту, параквату. Паракват является широко используемым гербицидом, который вызывает образование супероксида специально в митохондриях13. В связи с конкретной локализацией митохондрий полученных реактивных видов кислорода (ROS), паркватные анализы часто используются в качестве "митохондриального" стресс-анализ. Тем не менее, супероксид быстро преобразуется в перекись водорода митохондриальной супероксид дисмутазы (SODs)14. Перекись водорода может впоследствии диффундии из митохондрий и вызвать окислительный стресс в других отсеках клетки. Таким образом, мы описываем паракват выживания анализы как измерение чувствительности как к митохондриальной и окислительного стресса (другие окислительные стрессы анализы можно найти15).

Термотерпимость анализы выполняются в C. elegans путем размещения животных в повышенной температуре. Температура нематод температуры нематод составляет 15-20 градусов по Цельсию, а тепловой стресс индуцируется при температурах выше 25 градусов по Цельсию16,17. Термотерпимость анализы, как правило, выполняются при температурах, начиная от 30-37 градусов по Цельсию, как животные проявляют основные клеточные дефекты при такой температуре, и выживание анализы завершены в течение 24 часов16,18. Здесь предусмотрены два альтернативных метода для проведения термопереносимости анализов: рост при 34 градусах Цельсия и рост при 37 градусах Цельсия. Вместе, протоколы, представленные здесь могут быть использованы для выполнения крупномасштабных экранов в сочетании со стандартным геном нокдаун с помощью РНК-помех или химических библиотек наркотиков.

Протокол может быть разбит на 4 широкие процедуры - рост C. elegans и подготовка к визуализации (разделы 1 и 2), визуализация транскрипционных репортеров с использованием флуоресцентной микроскопии (раздел 3-5), количественные измерения репортеров с использованием китометра потока больших частиц (раздел 6), и физиологические анализы для измерения чувствительности к стрессу в C. elegans (раздел 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Стандартные условия роста температур ы и OP50 против HT115

  1. Стандартный рост и расширение
    1. Выращивайте культуру OP50 в LB(таблица 1)или эквивалентные носители выбора для 24-48 ч при температуре окружающей среды (22-25 градусов по Цельсию). Выращивайте бактерии при комнатной температуре, так как OP50 является урацил auxotroph и есть более высокая частота ревертантов (например, супрессор мутантов) при выращивании при температуре 37 градусов по Цельсию. Долгосрочное хранение культур OP50 не рекомендуется (максимум 1 неделя при 4 градусах Цельсия).
    2. Семя объемом 100-200 евро насыщенной культуры OP50 на 60-мм пластине NGM(Таблица 1) для поддержания червей и 1 мл насыщенной культуры OP50 на 100-мм пластину для расширения животных для экспериментов.
    3. Пусть пластины высохнут на ночь на скамейке.
      ПРИМЕЧАНИЕ: 100 мм пластин, возможно, потребуется больше времени, чтобы высохнуть, особенно при использовании невентилируемых пластин. Храните все пластины C. elegans в герметичных контейнерах, хранящихся при 4 градусах Цельсия. Не используйте пластины последние 6 месяцев, как высыхание пластин будет происходить, что изменит физиологию животных на пластинах из-за различных осмотического давления и жесткости пластин.
    4. Для стандартного обслуживания, переместить 10-15 молодых животных (яйца, L1, или L2 этапов) на 60 мм пластины, хотя больше может быть перемещено, если дело с мутантами или трансгенных животных с более низкой плодовитостью. Для животных с дефектами развития или плодовитости, кусок более переменный пул животных, чтобы предотвратить потерю запасов. При необходимости держать при 15 градусах Цельсия, перемещать животных каждую неделю; в течение 20 градусов по Цельсию, перемещать животных каждые 3-4 дня.
    5. Выполните свежую оттепель животных каждые 25-30 проходов (6 месяцев, если животные перемещаются один раз в неделю и содержатся при 15 градусах Цельсия).
    6. Для расширения, кусок полный 60 мм пластины на 100 мм пластин для расширения. В качестве эталона, животные с дикого типа плодовитость может иметь полный 60 мм пластины нарезать 4ths-6ths и быть chunked на большую пластину на 20 градусов по Цельсию в течение 2 дней или 15 градусов по Цельсию в течение 3 дней, чтобы создать полный 100 мм пластины, не достигнув голода.

2. Постановка/синхронизация червей с помощью отбеливания

  1. Протокол отбеливания для синхронизации червей
    1. Вымойте gravid червей (взрослые полные яйца) от агар пластин с помощью M9 (Таблица 1). Начните с несинхронизированной популяции червей (т.е. коренастых червей от шага 1.1.6) до отбеливателя для экспериментов, так как значительный генетический дрейф может произойти при последовательных раундах синхронизации с помощью отбеливания.
    2. Переместите смесь червя/M9 в коническую трубку 15 мл с помощью стеклянной пипетки; несколько пластин червей могут быть собраны в одну коническую трубку 15 мл.
    3. Спин животных вниз на 30 с на 1000 х г. Аспират M9 супернатант. Нет необходимости смывать остаточные бактерии, если нет вопиющего количества загрязнения или больших скоплений бактерий. Если это так, выполните несколько сравлки с M9.
    4. Приготовьте свежий запас отбеливания раствора(Таблица 1). Отбеливание раствор может храниться в течение нескольких дней при 4 градусах Цельсия, но используйте свежеприготовленный отбеливание, так как неэффективное отбеливание может привести к неравномерному отбеливанию, что приведет к повреждению яиц, прежде чем устранить все туши червей.
    5. Добавьте животным 2-10 мл отбеливания (1 мл раствора отбеливателя на каждые 0,1 мл гранул животного происхождения). Перевернуть смесь отбеливателя и червя в течение 5 мин (не превышать 10 мин; обратите внимание, что время отбеливания может варьироваться и должны быть тистрированы специально для каждой лаборатории). Энергично встряхните, чтобы помочь растворить туши червя быстрее и для оптимального сохранения яиц. Периодически посмотрите под микроскопом вскрытия или положить конические трубки на свет, чтобы наблюдать, когда взрослый червь туши полностью растворяются и только яйца остаются в трубке.
    6. Пеллет яйца, вращаясь на 1000 х г в течение 30 с, а затем аспирации супернатанта. Яйца могут быть центрифугированными быстрее, чем черви, не нарушая их целостность, так что если не уверены в скорости центрифуги, яйца могут быть вращаться вниз на до 2500 х г, не влияя на их физиологии.
    7. Добавить M9 до 15 мл и инвертировать трубку, чтобы очистить отбеливатель от яиц.
    8. Повторите шаги 2.1.6-2.1.7 (процесс мытья/гранул) еще 2-3 раза для удаления отбеливателя.
    9. Пипетка яйцо / M9 перемешать на тарелки и расти на 15-20 градусов по Цельсию для экспериментов. Чтобы получить меру того, сколько червей использовать, выполнить приблизительные количество яиц путем pipetting 5 л яичной смеси на агар пластины или слайд и деления яйца кол на 5, чтобы определить количество яиц на 1 л объема. Усреднение 3 независимых отсчетов может повысить точность. Во избежание голодания в таблице 2можно найти таблицу рекомендуемых яйцеклеток на тарелку.
    10. При необходимости L1 арестовывает животных за более жесткую височную синхронизацию, помещая смесь яйца/M9 в ротатор при температуре 20 градусов по Цельсию на срок до 24 ч. Для диких животных, никаких дефектов в физиологии животных были обнаружены, когда L1 арест на срок до 48 ч. Тем не менее, мутанты, чувствительные к голоду (например, лизосомы или аутофагии мутантов) делают очень плохо с L1 арест, и, таким образом, не рекомендуется выполнять этот метод синхронизации для мутантов, которые, как известно, чувствительны к голоду. Если для животных, которые не могут быть арестованы, требуется более жесткая синхронизация, используйте метод яйцеклада, описанный в разделе 2.2.
  2. Протокол яйцеклетки для синхронизации червей
    ПРИМЕЧАНИЕ: В качестве альтернативного метода для отбеливания, яйцекладка можно провести. Яйцекладиспользуется используется, когда отбеливание животных не обеспечивает достаточно близкой синхронизации, так как яйца в яичном мешке взрослых животных могут быть такими же разными, как 8-12 ч друг от друга. Для экспериментальных парадигм, где крайне важно, чтобы животные были как можно ближе поставлены, но там, где l1 арест не представляется возможным (например, в голодной мутантов), яйцеклад анализы рекомендуется. Однако следует отметить, что из-за труда, связанного с протоколом яйцеклада, менее целесообразно проводить масштабные эксперименты.
    1. Поместите 4-12 gravid взрослых (см. Примечание после шага 2.2.2) на стандартный OP50 или HT115-посеянный NGM пластины (см. раздел 1 выше для рекомендаций по бактериальным штаммам). В зависимости от масштаба экспериментов можно использовать несколько пластин. Обязательно задокументируйте, сколько животных на каждой тарелке для шага 2.2.
    2. Поместите животных при желаемой температуре для экспериментов (15-20 градусов по Цельсию) на 4-8 ч.
      ПРИМЕЧАНИЕ: Количество часов животных, оставленных на тарелке будет определять, насколько тесно синхронизированы первое яйцо отложено и последнее яйцо отложено будет, так что сроки могут быть скорректированы по мере необходимости. Поскольку более короткое время инкубации будет означать, что каждое животное имеет меньше времени, чтобы отложить яйца, больше животных должны быть помещены на тарелки, чтобы обеспечить достаточное количество яиц откладываются. В то время как фактическая скорость яйцекладки не полностью нормализована из-за тенденции животных пройти через короткие очередей яйцекладки, а не нормализованной скорости яйцеклада, средняя скорость яиц, отложенных на животное, может быть оценена в 5 яиц/час для животных, демонстрирующих дикую плодовитость19. При попытке вырастить животных на день 1 взрослого этапа, время яйцеклада, чтобы иметь lt;100 яиц на тарелку, чтобы избежать голода (обратитесь к таблице 2 для получения более подробной информации о рекомендуемых животных на тарелку).
    3. Удалить взрослых животных из пластин. Убедитесь, что все взрослые животные снимаются с тарелок, так как животные будут продолжать откладывать яйца и приводить к несинхронизированной популяции и/или голоду плиты.

3. Условия роста червей для визуализации транскрипционных репортеров

  1. Рост червей
    1. Прививать бактериальную культуру HT115 укрывательство pL4440 РНК плазмида (EV) и / или проведение РНК кассеты против желаемого гена цели (ы) в LB СМИ дополняется 100 мкг /мл карбенициллин и 20 мкг /мл тетрациклин.
    2. Расти культуры в одночасье (16 часов) до насыщения в тряске 37 C инкубатор.
    3. Найдите 60-мм пластины NGM RNAi с 200 л насыщенной бактериальной культуры и 100-мм пластинами NGM RNAi с 1000 л насыщенной бактериальной культуры. Дайте высохнуть при температуре окружающей среды (22 градуса Цельсия) на ночь в темноте (покрытые слабо алюминиевой фольгой).
    4. Поместите синхронизированную популяцию трансгенных червей, несущих флуоресцентные репортеры (см. таблицу 3 для полного списка) на пластины NGM RNAi, посеянные бактериями выбора.
    5. Расти при 15-20 градусах по Цельсию до требуемых этапов для конкретных репортеров, как указано ниже.
  2. Рассмотрение для постановки червей для экспериментов
    1. Выполняйте эксперименты для транскрипционных репортеров в первый день взрослой жизни, за исключением анализов, которые требуют L4 животных. По данным WormAtlas, L4 животных получают примерно 2,5 дней (56 ч) роста на 20 градусов по Цельсию от стадии яйца(www.wormatlas.org).
    2. Для "день 1 взрослых", использовать животных примерно на 3-4 дней (65-96 ч) роста при 20 градусов по Цельсию после покрытия яиц.
      ПРИМЕЧАНИЕ: Этот широкий диапазон объясняется следующим образом: 65 ч при 20 градусах Цельсия , когда животные достигают "яйцекладки", которая является истинным "взрослого" состояние. 96 ч, когда животные вводят то, что WormAtlas описывает как "яйцо укладки максимум", который, когда взрослый является gravid взрослых и имеет полный мешок яйцо. Это когда животные будут описаны как старше первого дня и могут начать отображать различия, и, таким образом, протоколы, описанные здесь все рекомендуется начать в этом "день 1" этап, начиная с 65 ч и как только 96 ч. Для анализов, описанных здесь, основные различия не наблюдались при использовании животных в этом окне 65-96 ч.
    3. Для реплики одного эксперимента используйте аналогичную точку времени для более надежной воспроизводимости (например, выполняйте все эксперименты на уровне 65 ч или 96 ч после покрытия яиц).
      ПРИМЕЧАНИЕ: Некоторые трансгенные животные и мутанты показывают замедленные темпы роста. Для этого существуют две рекомендации. 1) Используйте ступенчатую синхронизацию, где животные могут быть отбелены в разное время для того, чтобы эксперименты должны быть выполнены в то же время. Это рекомендуется, когда техническая изменчивость в анализе может быть больше, чем технические изменчивости, которые могут возникнуть в результате синхронизации анализ (например, анализы на выживание, которые работают в течение длительного времени может пострадать, если они не выполняются одновременно). 2) Используйте шахматный анализ, где животные могут быть отбелены в то же время, но само анализ выполняется в разное время. Это рекомендуется для очень простых анализов, которые не имеют присущей изменчивости (например, РНК-индукции стрессовых реакций).

4. Индукция стрессовых реакций

  1. Использование hsp-4p::GFP в качестве считывания для активацииER UPR
    1. Индуцирование ER стресс с помощью РНК
      1. Подготовка пластин пятнистый с бактериями РНК ориентации гена интереса на NGM РНК пластин(Таблица 1), как в разделе 3. Используйте EV в качестве контроля для базальных уровней UPRER и РНК нокдаун ам-335 (фермент для N-связанных гликозилирования ER резидентных белков; RNAi нокдаун имеет аналогичные эффекты для лечения туникамицина) в качестве положительного контроля для активации ERUPR под стрессом ER.
      2. Синхронизируйте hsp-4p::GFP репортер животных с использованием методов, описанных в разделе 2.
      3. Плита яйца на РНК пластины с использованием критериев, рекомендованных в таблице 2.
      4. Инкубировать яйца при 20 градусах По Цельсию в течение примерно 3-4 дней (65-96 ч) для проведения экспериментов в первый день взрослой жизни. Для экспериментов UPRER существуют различия в базальной флуоресценции hsp-4::GFP репортера при выращивании при разных температурах. Поэтому, выполнять все эксперименты при 20 градусах Цельсия.
    2. Индуцирование er стресс с помощью химического агента
      1. Синхронизируйте hsp-4p::GFP репортер животных с использованием методов, описанных в разделе 2 и расти при 20 градусах Цельсия, пока животные не достигнут стадии L4. Перенесите животных в трубку M9. Разрешить червей, чтобы урегулировать (2-3 мин под действием силы тяжести или 30 с спина на 1000 х г),а затем удалить M9.
      2. Разбавить туникамицин до 25 нг/мл в M9 (1:40 разбавления из 1 мг/мл бульона). В качестве контроля, а также разбавить эквивалентный объем DMSO в M9.
      3. Добавьте 25 нг/мл туникамицина/M9 или управляйте раствором DMSO/M9 червям (используйте 400-500 мл для трубки 1,5 мл или 2 мл для конической трубки 15 мл). Инкубировать при 20 градусах Цельсия на вращающейся платформе в течение 3-4 часов.
        ПРИМЕЧАНИЕ: Туникамицин также может быть разбавлена непосредственно в червь / M9 смеси.
      4. Разрешить червям, чтобы оседать, удалить M9/TM решение, и мыть с 1 мл M9.
      5. Перенос животных на пластины NGM или пластины NGM RNAi и позволяют восстановиться на ночь (или 15-20 ч) и достичь первого дня взрослого возраста при 20 градусах Цельсия до выполнения флуоресцентной микроскопии (раздел 5). Ночное восстановление выполняется для того, чтобы обнаружить уровень GFP для накопления.
      6. Кроме того, вызвать hsp-4p::GFP путем перемещения L4 животных в агар пластины, содержащие 25 нг / Л туникамицина для 16-24 ч. Это имеет гораздо более надежную индукцию hsp-4p::GFP из-за более длительной продолжительности стресса, и, таким образом, динамический диапазон намного ниже, чем описано выше.
  2. Использование hsp-6p::GFP в качестве считывания для активации UPRMT
    1. Индуцирование митохондриального стресса с помощью РНК
      1. Активируйте UPRMT по тому же протоколу, что и раздел 4.1.1, за исключением использования РНК-нокдауна митохондриальных генов, таких как cox-5b/cco-1 (цитохром c оксидаза субъединица 5B; нокдаун подавляет активность электронной транспортной цепи). Для активации UPRMT через возмущения в функции электронной транспортной цепи, НОкдаун RNAi должен быть выполнен во время ранней разработки20. Таким образом, выполнять РНК из люка для этих экспериментов.
    2. Индуцирование митохондриального стресса с помощью химического агента
      1. Подготовка пластин пятнистый с бактериями РНК ориентации гена интерес, как и в разделе 3. Используйте бактерии HT115 даже в экспериментах, не связанных с НОкдауном РНК (см. раздел 1). Убедитесь, что обе пластины NGM RNAi (или NGM RNAi и DMSO0.2) и NGM RNAi и антимицин А пластины(таблица 1) подготовлены к шагу 4.2.2.5.
      2. Синхронизируйте hsp-6p::GFP или hsp-60p::GFP репортер животных с использованием методов, описанных в разделе 2.
      3. Плита яйца на семенами пластин выбора с использованием критериев, рекомендованных в таблице 2. Так как антимицин А растворяется в DMSO, выращивайте животных на пластинах NGM RNAi и DMSO0.2 из люка.
      4. Инкубировать яйца при 20 градусах По Цельсию в течение 2 дней (56 ч) до стадии L4. Кроме того, выращивайте животных при 15 градусах по Цельсию в течение 3 дней (75 ч) вместо этого.
      5. Переместите червей из пластин NGM RNAi и DMSO0.2 в NGM RNAi - антимицин А плиты или NGM RNAi и DMSO0.2 пластины в качестве контроля. Черви могут перемещаться вручную с подбором для небольших экспериментов, но для крупномасштабных экспериментов мы рекомендуем мыть животных с помощью M9, улаживая с центрифугированием, успокоив M9, а затем приправляя к пластинам NGM RNAi и antimycin A.
      6. Инкубировать червей для дополнительных 20 ч и изображение на следующий день 1 взрослых (раздел 5).
  3. Использование gst-4p::GFP как считывание для окислительного стресса.
    1. Индуцирование OxSR с использованием РНК
      1. Кроме того, вызвать gst-4p::GFP с использованием RNAi-нокдаун Wdr-23 (он кодирует отрицательный регулятор скн-1; таким образом, его нокдаун вызывает OxSR) с помощью протокола, описанного в разделе 4.1.1.
    2. Индуцирование OxSR с использованием воздействия химического окислителя терт-бутил гидропероксида (TBHP)
      1. Подготовка пластин пятнистый с бактериями РНК ориентации гена интерес, как и в разделе 3. Используйте бактерии HT115 даже в экспериментах, не связанных с НОкдауном РНК (см. раздел 1).
      2. Синхронизируйте gst-4p::GFP репортер животных с использованием методов, описанных в разделе 2.
      3. Плита яйца на семенами пластин выбора с использованием критериев, рекомендованных в таблице 2. Будьте уверены, чтобы подготовить больше пластин, чем это необходимо, как протокол лечения наркотиками приводит к потере 10-20% животных. Для визуализации, начните с йgt;100 животных, и для сортировки, начните с 1000 животных.
      4. Инкубировать яйца в 20 градусов по Цельсию в течение 2 дней (56 ч) до стадии L4. Кроме того, выращивайте животных при 15 градусах по Цельсию в течение 3 дней (75 ч) вместо этого.
      5. Вымойте L4 животных с пластин и разделить на две 15 мл конических труб в состоянии. Объем аспирироваться до по крайней мере 1 мл и добавить равный объем свежеприготовленных 2 мМ TBHP. Используйте общий объем жидкости, по крайней мере 2 мл, так как более низкие объемы могут привести к значительной гибели червей при вращении. Не мыть перед медикаментозным лечением, так как остаточные бактерии из пластин помогут обеспечить червей не перемораживаться во время инкубации.
      6. Инкубировать червей на ротаторе в течение 4 ч при 20 градусах Цельсия.
      7. Вымойте червей, вращаясь на 1000 х г, аспирбируя M9 и TBHP смесь, и заменить 15 мл M9. Повторите для второй стирки.
      8. Плита червей на EV RNAi, чтобы восстановить в одночасье (16-24 ч) при 20 градусах Цельсия. Черви могут быть восстановлены на соответствие RNAi выбора, но никаких существенных различий не было замечено при восстановлении на EV RNAi, так что это может быть сделано для удобства экспериментальной настройки. Возьмите изображения 1-го дня взрослых после выздоровления.
        ПРИМЕЧАНИЕ: Ночное восстановление выполняется для того, чтобы обнаружить уровень GFP для накопления. Без этого восстановления не существует обнаруживаемого сигнала GFP. Если желательно кратковременное восстановление, можно использовать результаты, описанные в разделе 4.3.3.
    3. Индуцирование OxSR с использованием химического окислителя паракват (ПЗ)
      1. Повторите все шаги в разделе 4.2.2, чтобы получить 2 партии L4 gst-4p::GFP животных в 15 мл конических труб в состоянии.
      2. Объем аспирироваться до по крайней мере 1 мл и добавить равный объем свежеприготовленных 100 мкм ПЗ. Как и 4.3.2.5, минимальный объем 2 мл рекомендуется.
      3. Инкубировать червей на ротаторе в течение 2 ч при 20 градусах Цельсия.
      4. Вымойте червей, вращаясь на 1000 х г, аспирбируя M9 и P е смесь, и заменить 15 мл M9. Повторите для второй стирки.
      5. Плита червей на EV RNAi восстановить в течение 2 ч при 20 градусов по Цельсию, а затем принимать изображения сразу после восстановления.
        ПРИМЕЧАНИЕ: 2 ч восстановления было минимальное восстановление, необходимое для визуализации индукции GFP.
  4. Использование hsp-16.2p::GFP и hsp-70p::GFP как считывание для активации HSR.
    1. Индуцирование HSR с использованием воздействия при повышенных температурах
      1. Подготовка пластин пятнистый с бактериями РНК ориентации гена интерес, как и в разделе 3. Используйте бактерии HT115, даже в экспериментах, не связанных с РНК нокдаун (см. Введение).
      2. Синхронизируйте hsp-16.2p::GFP или hsp-70p::GFP репортер животных с использованием методов, описанных в разделе 2.
      3. Плита яйца на семенами пластин выбора с использованием критериев, рекомендованных в таблице 2. Будьте уверены, чтобы подготовить 2x количество пластин, необходимых, как половина образца будет подвергаться повышенной температуры для тепло-шок индукции, а другая половина будет служить в качестве не-тепло-шокирован контроля.
      4. Инкубировать яйца при 20 градусах По Цельсию в течение примерно 3-4 дней (65-96 ч) для проведения экспериментов в первый день взрослой жизни. Не выращивайте червей при температуре-шоке, так как между животными, испытывающими тепло-шок, есть лишь незначительные различия.
      5. Переместите экспериментальные группы животных в инкубатор 34 градуса по Цельсию на 2 ч. Поместите пластины в инкубатор в виде одного слоя (т.е. без укладки пластин), чтобы обеспечить максимально быстрое и равное распределение тепла по пластинам.
      6. Переместите тепло-шокированных животных в инкубатор 20 градусов по Цельсию, чтобы восстановить сяризм в течение 2 ч, а затем изображение немедленно (см. раздел 5). При необходимости животных можно восстановить дольше для повышения индукции GFP.
        ПРИМЕЧАНИЕ: 2 ч восстановления было минимальное восстановление, необходимое для визуализации индукции GFP.

5. Изображение с помощью стерео микроскопа или широкоугольного микроскопа с низким увеличением/соединения

  1. Приготовление червей для флуоресцентной микроскопии
    1. Пипетка 5-10 л 100 мМ азида натрия поверх стандартной пластины NGM (т.е. без бактерий).
      ПРИМЕЧАНИЕ: Концентрация азида натрия может быть снизилась до 10 мМ, хотя наиболее надежная иммобилизация наблюдалась при азиде натрия 100 мМ без заметного влияния на флуоресцентный сигнал.
    2. Под рассекающим сядр микроскопом выберите 10-20 животных из экспериментальных пластин и перенесите в пятно азидея натрия. Вскоре после посадки в азиде натрия животные должны прекратить движение, а сам азид натрия испаряется в течение нескольких секунд.
    3. После того, как азид натрия испарился, выстраивайте животных в желаемую установку изображений. Перемещение животных бок о бок с передней и задней стороны в той же ориентации для всех животных. Изображение животных немедленно.
      ПРИМЕЧАНИЕ: Никаких изменений в сигналрепортера не наблюдалось для любого из транскрипционных репортеров в таблице 3 на срок до 15 минут после паралича в азиде натрия.
  2. Приобретение изображения с помощью стереомикроскопа
    ПРИМЕЧАНИЕ: Для этого протокола использовался микроскоп Leica M205FA, оснащенный монохромной камерой Leica DFC3000G CCD, стандартным фильтром Leica GFP (ex 395-455, EM 480 LP) и программным обеспечением LAS X. Рекомендуемые настройки для времени экспозиции можно найти в таблице 4.
    1. Запуск программы LAS X.
    2. Начните новый проект: откройте вкладку приобретения, нажмите на Open Projects и нажмите Folder, чтобы открыть новый проект. Этот проект может быть переименован путем нажатия правой нажатия папки и прокрутки вниз, чтобы переименовать или нажав F2. Во вкладке приобретения также есть варианты настройки времени экспозиции и увеличения до желаемых настроек.
    3. Расположите образец червя под целью микроскопа и найдите правильный координационный центр червей, используя настройки яркого поля, чтобы свести к минимуму флуоресцентное отбеливание. Центр образца, где линия яиц четко видны и не нечеткой. Установите время экспозиции, масштабирование, фокусироворы и конденсаторы яркого поля в желаемые настройки.
    4. Приобретите изображение с помощью кнопки Capture Image.
    5. Сохранить изображение в формате .lif (Leica Image File), так как это сохраняет все необработанные изображения и метаданные. TIFF также может быть экспортирован, нажав на изображение (или проект) и под опцией Сохранить в качестве опции, нажмите TIFF. Это позволит хранить все каналы (например, ярко-поле и GFP) с любыми изменениями (например, если контраст был скорректирован, это будет сохранено в TIFF).
  3. Количественный анализ флуоресцентных изображений
    1. Если будет выполнен количественный анализ, возьмите трех-D изображения. Это выполняется, нажав на опцию z-раздела с надписью "z" в правом верхнем правом. Разделы будут активны, если эта коробка красная.
    2. Оптимизируйте z-разделы, выбрав диапазон и срез толщину в левом нижнем углу регулируемых опций. По возможности используйте кнопку System Optimized для оптимальных настроек.
    3. Захват изображения и хранение изображения, как описано выше в разделе 5.2. Выровняйте червей с космосами между ими для более легких измерений.
    4. Импорт изображений TIFF в программное обеспечение для визуализации по выбору (например, ImageJ).
    5. Для ImageJ из меню «Анализ» выберите Set Measurements. Проверьте следующее: область, среднее серое значение, встроенная плотность, этикетка дисплея.
    6. Используя инструмент roI (регион интересов), нарисуйте рентабельность инвестиций. Измерьте каждого червя по отдельности. Из меню «Анализ» выберите Measure или press M. Нарисуйте рентабельность инвестиций в фоновом режиме, где нет червей, а затем измерить фон таким же образом. Копирование или сохранение измерений, отображаемых в окне результатов.
    7. Вычесть фоновую плотность интегратой из интегрированной плотности каждой измеренной рентабельности инвестиций. Интенсивность фона для рентабельности инвестиций определяется как продукт фонового среднего серого значения и области нарисованной рентабельности инвестиций.
  4. Приобретение изображения с помощью микроскопа соединения/широкого поля
    ПРИМЕЧАНИЕ: Для визуализации транскрипционных репортеров с помощью микроскопа соединения/широкого поля, этот протокол использует микроскоп Revolve ECHO R4, оснащенный объективным объективом Olympus 4x Plan Fluorite NA 0.13, стандартным фильтром Olympus FITC (ex 470/40; em 525/50; DM 560), и iPad Pro для камеры и для управления программным обеспечением ECHO. Рекомендуемые настройки для времени экспозиции можно найти в таблице 4.
    1. Используйте сенсорную панель для запуска программы управления. Создайте новый альбом и имя файла.
    2. Позиционная пластина под объективным объективом. Установите время экспозиции и интенсивность флуоресценции с помощью базового (EV/контрольлечения) и положительного контроля, чтобы сигнал был виден, но не насыщен.
    3. Сохраните яркое поле изображения и GFP / FITC изображения.

6. Количественные измерения репортеров с использованием цитометра потока больших частиц

ПРИМЕЧАНИЕ: Рост и подготовка червей для анализа цитометра потока больших частиц могут следовать тем же парадичным, что и разделы 1-5 для подготовки червей для флуоресцентной визуализации, за исключением того, что требуется большее количество животных. Используйте 500 животных на одно условие, так как некоторые животные теряются во время манипуляций, не все животные проходят критерии фильтрации во время количественной оценки, а некоторые животные не считываются должным образом цитометром потока. Вымойте животных, готовых к сортировке плит в 5-10 мл раствора М9, в конические трубки 15 мл для последующей сортировки на цитометре потока.

  1. Установка сортировки с использованием цитметра потока больших частиц
    1. Перед включением цитометра потока
      1. Убедитесь, что оболочка жидкая бутылка не пуста. Подготовка оболочки жидкости из 250x запасов по крайней мере за несколько часов до использования сортировки, так как есть небольшое количество моющего средства в оболочке жидкости, которые могут вызвать пузырьки, которые могут вызвать артефакты во время приобретения.
      2. Убедитесь, что все контейнеры для отходов не заполнены.
    2. Включение цитометра потока
      1. Включите воздушный компрессор. Поверните его на Auto. Проверьте датчик давления - он должен быть около 30 пси.
      2. Включите инструмент. Используйте выключатель питания, который находится рядом с шнуром питания слева от инструмента.
      3. Включите лазеры. Источник света 488 нм обычно достаточен для большинства экспериментов, хотя для красной флуоресценции необходимо использовать источник света 561 нм, если требуется более высокое возбуждение.
      4. Откройте программное обеспечение FlowPilot; инструмент должен сделать серию кликов, переключаясь на различные клапаны.
      5. Включите лазеры в окне программного обеспечения, нажав Кнопку Start. Инициировать лазер в Аргон лазерного управления всплывающее окно, нажав Run. Это должно привести к тому, что лазер включится и достигнет около 12 мВт. Уровень источника света 488 будет доходить до 12.
      6. Нажмите Сделано, чтобы закрыть окно.
    3. Проверка программного обеспечения перед прогрессированием
      1. Проверьте датчики давления - Посмотрите на 4 значения давления, отображаемые в нижней части окна. Значения должны быть вокруг исходной установки (Sheath 5.5-5.7; Пример 5.7-6.0; Сортер 3.1-3.3; Очистить 8,5-8,7). Если он выглядит так же, проверьте поле рядом с давлением OK.
      2. Проверьте жидкости -Чтобы убедиться, что Есть нет пузырьков воздуха и мусора, блокирующего поток оболочки / образца через ячейку потока, нажмите Чистый несколько раз.
      3. Проверьте скорость потока оболочки -Для этого, собирать оболочки для 60 s. Выключите Сортировать, затем включите оболочку в ручном управлении, чтобы начать поток оболочки. Соберите в трубку 15 мл на 60 с; скорость потока должна быть 9-10 м/мин.
    4. Очистка перед использованием цитометра потока
      1. Положите 3-5 мл 10% отбеливатель раствора в коллекцию "чашка" и нажмите Приобрести. Пусть запустить для 30 с, нажмите Прервать, и удалить избыток с вакуумом.
      2. Промыть коллекцию «чашкой» с деионированной водой и снять с вакуумом. Повторите 2x.
      3. Положите 3-5 мл чистящего раствора COPAS в коллекцию 'чашка' и нажмите Приобрести. Пусть запустить для 30 с, нажмите Прервать, и удалить избыток очистки раствора с вакуумом.
      4. Промыть коллекцию «чашкой» с деионированной водой и снять с вакуумом. Повторите 2x.
      5. Положите 3-5 мл раствора M9 в коллекцию 'чашка' и нажмите Приобрести. Пусть запустить для 30 с, нажмите Стоп, и удалить избыток m9 раствор с вакуумом.
  2. Запуск образцов на сортировке
    1. Отрегулируйте мощность лазера PMT и размер gating на основе состояния, которое вызывает ярчайшую активацию транскрипционного репортера интереса. Рекомендуемые настройки можно найти в таблице 4.
    2. Добавить подготовленные черви в "чашку". Нажмите Приобрести. Следите за тем, чтобы вся жидкость не попала в машину; это приведет к потоку цитометра, чтобы взять в воздух и создать пузырьки в детекторе.
    3. Нажмите Прервать, когда образец низкий и / или достаточно животных были собраны.
    4. Нажмите на настройку Хранение данных Только для того, чтобы забыть о ней. Это позволит сохранить данные только на основе ограничений по размеру. Нажмите Store Gated и сохраните закрытые данные. Нажмите Erase, чтобы удалить данные.
    5. Промыть коллекцию «чашкой» с деионированной водой и снять с вакуумом. Повторите 2x.
    6. Повторите шаги 6.2.1-6.2.5 с остальными образцами.
  3. Калибровка/ Контроль качества - при необходимости
    ПРИМЕЧАНИЕ: Это требует управления 42 мкм GYR флуоресцентных частиц при условии, для калибровки 488 лазера.
    1. Нажмите металлическую губу на верхней части чашки образца, чтобы удалить воздушную трубку. Отвиньте крышку и используйте шприц для удаления жидкости из чашки образца.
    2. Смешайте бутылку контрольных частиц задолго до использования и добавить несколько миллилитров в чашку образца. Закройте крышку и положите воздух обратно, нажав на него, пока он не нажимает на месте.
    3. В программном обеспечении перейдите на опцию Tools и нажмите на частицы управления запуском.
    4. Для контрольных частиц сбросить значения PMT на: GREEN - 325; ЖЕЛТЫЙ - 365; КРАСНЫЙ - 575.
    5. Нажмите Приобрести. Оболочка должна включиться с последующим образцом. Как только шарики начинают проходить через ячейку потока, скорость потока будет видна в нижней части экрана. Оптимально скорость потока должна быть между 5/s и 15/s. Если скорость потока слишком низкая или равна нулю, поверните пробный клапан физически по часовой стрелке, чтобы увеличить скорость потока. Если скорость потока слишком высока, поверните пробный клапан физически против часовой стрелки, чтобы уменьшить скорость потока.
      ПРИМЕЧАНИЕ: Обычно, в режиме заставки шарика, 500 шариков считываются перед выключением. Данные могут быть стерты и бусы перечитывать.
    6. После завершения чтения проверьте наличие чистых одиночных пиков для 5 параметров, а также значений cv. Коэффициент дисперсии (CV) должен быть йт-15%. Кроме того, убедитесь, что значения резюме для трех различных флуоресцентных каналов близки друг к другу.
    7. Сделайте запись проверки КК: под вкладкой Файл, нажмите Сохранить как изображение экрана.
  4. Очистка и остановка
    1. Используйте вакуум, чтобы удалить образец из чашки образца и повторить раздел 4.1.4.
    2. Положите 3-5 мл деионизированной воды в коллекцию 'чашка' и нажмите Приобрести, пусть запустить для 30 с, а затем нажмите Abort. Оставьте немного дистиллированной воды позади в чашке образца.
    3. Освободите чашку для восстановления образца и бутылку отходов.
    4. Выключите программное обеспечение. Под вкладкой Файл нажмите Exit. В всплывающем меню нажмите Turn Off without Purging.
    5. Выключите лазер, выключите прибор, а затем выключите воздушный компрессор. Закройте люк, чтобы покрыть инструмент.

7. Физиологические анализы для измерения чувствительности к стрессу в C. elegans

  1. Измерение чувствительности к стрессу ER с использованием воздействия туникамицина
    1. Подготовка NGM RNAi DMSO пластины пятнистый с бактериями РНК таргетинга гена интерес, как и в разделе 3. Используйте бактерии HT115 даже в экспериментах, не связанных с НОкдауном РНК (см. раздел 1). Не забудьте также семян NGM RNAi TM пластин (см. Таблица 1). Семя достаточное количество пластин: план для 5-7 наборов пластин NGM RNAi DMSO и 2-3 комплектов пластин NGM RNAi TM.
    2. Синхронизация животных по выбору с помощью методов, описанных в разделе 2.
    3. Плита яйца на NGM RNAi DMSO семенами пластин выбора с использованием критериев, рекомендованных в таблице 2. Обязательно подготовьте 2x количество пластин, необходимых, так как половина образца будет передана на пластины NGM RNAi TM.
    4. Инкубировать яйца при 20 градусах По Цельсию в течение примерно 3-4 дней (65-96 ч) до первого дня взрослой жизни.
    5. На 1-й день подготовьте продолжительность жизни, переведя животных на отдельные тарелки. Для сохранения пластин (так как затраты На ТМ высоки), используйте 8 пластин по 15 животных на одно состояние, в общей сложности 120 животных на одно состояние. Это позволяет управляемое количество животных на пластину для скоринга и позволяет достаточное количество животных для статистического анализа, даже с некоторой цензуры.
    6. В течение первых 5-7 дней, переместить взрослых животных от потомства каждый день на новую тарелку, пока потомство больше не видны. На этом этапе, цензура животных, которые мешках, выставки вульвы выступы / взрывы, или ползать по бокам пластин, так как это не смерти, связанные с ЧУВСТВИТЕЛЬНОСТЬю стресс ER. Обратите внимание, что тМ лечение вызывает арест у животных, и, таким образом, только 1-2 ходов этих животных каждые 2-3 дня достаточно, чтобы свести к минимуму расходы, связанные с производством ТМ-содержащих пластин. Дикие животные имеют среднюю выживаемость 15-17 дней на DMSO и 12-14 дней на туникамцине.
    7. После того, как животные перестали производить потомство, оценка продолжительности жизни каждые 1-2 дней, пока все животные забил, как мертвые или цензуре. ТМ-лечить животных каждый день в течение дня 6-14 взрослого возраста для более высокого разрешения.
  2. Измерение чувствительности митохондриального и окислительного стресса с использованием воздействия параквата
    1. Подготовка пластин пятнистый с бактериями РНК ориентации гена интерес, как и в разделе 3. Используйте бактерии HT115 даже в экспериментах, не связанных с НОкдауном РНК (см. Введение).
    2. Синхронизация животных по выбору с помощью методов, описанных в разделе 2.
    3. Плита яйца на NGM RNAi семенами пластин выбора с использованием критериев, рекомендованных в таблице 1. В ассе требуется 60-100 животных на одно состояние, поэтому подготовьте соответственно.
    4. Инкубировать яйца при 20 градусах По Цельсию в течение примерно 3-4 дней (65-96 ч) до первого дня взрослой жизни.
    5. Приготовьте свежий флакон 100 мМ параквата в растворе M9.
    6. Пипетка 50-75 л M9-paraquat в так много колодцев плоской нижней 96-хорошо пластины по желанию. Как правило, рекомендуется иметь 8-10 скважин в состоянии, содержащем 8-10 животных на скважину. Это позволяет легко видимое количество животных на хорошо с 80 животных на штамм.
    7. Выберите 8-10 животных в состоянии и перенесите их в каждый колодец, содержащий M9'paraquat. Используйте выбрать для передачи животных в скважины, а не пипетка, чтобы избежать различий в объеме и непреднамеренных изменений в концентрациях параквата.
    8. Каждые 2 ч, оценка за смерть животных в каждом колодце. Нажмите на пластины осторожно, что приведет к живой животных трэш или согнуть. Обратите внимание, что вполне возможно, что живые животные иногда парализованы достаточно долго, чтобы быть забил как мертвые. Поэтому, если количество живых животных превышает количество живых животных с предыдущего времени, вполне вероятно, что животное было живо и должно быть незачитано (например, если в час 4, 2/10 животных забил как мертвые, а в час 6, только 1/10 животных мертвы, час 4 должны быть переименованы в 1/10 животных мертвы).
  3. Измерение теплочувствительности с использованием воздействия повышенных температур
    1. Подготовка пластин пятнистый с бактериями РНК ориентации гена интерес, как и в разделе 3. Используйте бактерии HT115 даже в экспериментах, не связанных с НОкдауном РНК (см. раздел 1).
    2. Синхронизация животных по выбору с помощью методов, описанных в разделе 2.
    3. Плита яйца на семенами пластин выбора с использованием критериев, рекомендованных в таблице 1. Ите 60-100 животных в состоянии для термопереносимости анализов. Для термотерпимости анализы, используйте L1 арест или яйцо лежал анализы для лучшей синхронизации, как есть основные изменчивости на основе возраста животных в анализе.
    4. Инкубировать животных при 20 градусах Цельсия в течение примерно 3-4 дней (65-96 ч) для проведения экспериментов в первый день взрослой жизни. Не выращивайте червей при температуре-шоке, так как существует незначительная разница между животными, испытывающими тепло-шок из 15 градусов по Цельсию против 20 градусов по Цельсию.
    5. На 1-й день приготовьте животных, переведя их на отдельные тарелки. Как правило, рекомендуется иметь 10-15 животных на тарелку с 4-6 пластин, в общей сложности 60 животных. Это позволяет управляемое количество животных на пластину для скоринга и позволяет минимальное время для животных, которые будут вытащил из повышенной температуры.
    6. Поместите животных в инкубатор 37 градусов по Цельсию и оценка каждые 2 ч. Начните оценка для термотерпимости при 37 градусах По Цельсию в час 5, так как практически нет смерти происходит до 5 часов. Медианная термопереносимость достигается на 9 часов, так что час 7, 9 и 11 являются критическими точками времени, хотя из-за инкубатора и лабораторных изменчивости, это, возможно, потребуется титровать в лаборатории. Кроме того, помогут любые методы снижения изменчивости (например, не укладка пластин, размещение пластин в одной области в пределах одного инкубатора, минимизация времени открытия или закрытия инкубатора, взятие нескольких пластин из инкубатора за один раз, чтобы свести к минимуму время, необходимое для того, чтобы животные проводили вне 37 градусов по Цельсию и т.д. Для полного руководства,см.
    7. В качестве альтернативы шагу 7.3.6, поместите животных на 34 градуса по Цельсию вместо 37 градусов по Цельсию. Медианная термопереносимость при 34 градусах Цельсия составляет чуть более 14 ч, поэтому временные точки 12, 14 и 16 имеют решающее значение для термотоций 34 градусов по Цельсию.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Использование транскрипционных репортеров для измерения активации стрессовых реакций
Здесь используются флуоресцентные транскрипционные репортеры, которые служат надежными инструментами для измерения активации большинства стрессовых реакций в C. elegans. Выражение GFP определяется в соответствии с пропагандой канонических целей мастер транскрипционных регуляторов, участвующих в реагировании на отсек конкретных стрессов. Полный список широко используемых транскрипционных репортеров доступен в таблице 3.

Возмущение ER гомеостаз через развернутые или неправильно сложенные белки или липидный двухслойный стресс вызывает активацию развернутой реакции белка ER (UPRER)для восстановления качества и функции ER. UPRER состоит из 3 различных ветвей, определяемых трансгембранными датчиками: инозитол-требующий белка 1 (IRE1), активации транскрипции фактор 6 (ATF6), и белка киназы РНК (PKR) - как ER киназы (PERK), все из которых сохраняются в C. elegans7,22,23. Наиболее распространенным инструментом для мониторинга активации UPRER в нематоде, является транскрипционный штамм репортера, выражающего GFP под контролем hsp-4 промоутер(hsp-4p::GFP)7. Ген hsp-4 кодирует ортоголог млекопитающих Hsp70, HSPA5 (или BiP/Grp78). Во время стресса ER, когда UPRER активируется, hsp-4p::GFP репортер штамм выражает GFP. Этот репортер имеет минимальное базальное выражение в отсутствие стресса, но демонстрирует надежное выражение GFP, когда животные подвергаются воздействию туникамицина(рисунок 1A). Эти различия также могут быть количественно с помощью китометра потока больших частиц(рисунок 1B). Кроме того, индукция hsp-4p::GFP под стрессом ER может быть полностью подавлена RNAi-нокдаун xbp-1, как активация этого транскрипционного репортера зависит от транскрипции фактор, XBP-112.

Подобно УПОER,митохондрии дома свой собственный защитный механизм от протеотоксического стресса. Этот механизм, называемый митохондриальной УПО (UPRMT)24, в основном регулируется транскрипционный фактор, ATFS-1, который не вошел в митохондрии под стрессом из-за снижения эффективности импорта, в результате чего вступления ATFS-1 в ядро25. Интересно, что различные возмущения митохондриальных процессов могут активировать эту реакцию, в том числе агрегацию белка, сбить электрон транспортной цепи (ETC) комплексов субъединиц, митохондриальной репликации ДНК стресс, и митохондриальный перевод белка8,26. Активация UPRMT была проверена с помощью червей, выражающих трансгенную конструкцию, в которой GFP был помещен под регулирование промоутеров митохондриальных генов сопровождающего, hsp-6 и hsp-608. Подобно hsp-4p::GFP животных, hsp-6p::GFP животных проявлять минимальный базальный сигнал в отсутствие стресса. Наиболее надежный метод, чтобы вызвать UPRMT через РНК-нокдаун следующих митохондриальных белков: cox-5B, цитохром c оксидазы субъединицы Vb/COX4 (Комплекс IV)20, nuo-4, NADH дегидрогеназы белка (комплекс I)27, или mrps-5, митохондриальный рибосомный белок28, активирован hsp-6p::GFP репортер. Выражение GFP через этого репортера надежно активируется и может быть легко визуализировано и количественно в этих условиях(рисунок 2A-B). UPRMT также может быть вызвано путем химического ингибирования цепи транспортировки электронов (ETC), например, с антимицином А, который подавляет цитохром c редуктазу (комплекс III). Подобно RNAi-нокдаун компонентов ETC, антимицин лечение вызывает надежную индукцию hsp-6p::GFP (Рисунок 2C-D).

Способность организмов чувствовать и реагировать на окислительный стресс является сохраненный процесс, присутствующий от бактерий к людям29. В C. elegans, гомолог NRF2, SKN-1, служит важным фактором транскрипции, который чувствителен к изменениям редокса из-за реактивных цистеинов во всем белке. SKN-1 служит в качестве одного из транскрипционных активатор OxSR через привязку к сохранению последовательности консенсуса очень напоминающие антиоксидантные элементы ответа связаны NRF230. У людей, NRF2 отрицательно регулируется KEAP1, который, как полагают, чувствительны к изменениям redox из-за реактивных цистеина по всему белку31. Хотя нет прямой ортологии KEAP1 у червей, SKN-1 негативно регулируется WD-повторный белок, WDR-23, таким образом, что механистически отличается от KEAP1/NRF2 ингибирование32. При окислительном стрессе, например, тер-бутил гидроперексида (TBHP), SKN-1 активизирует детоксикацию и антиоксидантные гены, такие как gst-4, Глютатион S-Transferase. Для измерения окислительного стресса, выражение GFP помещается под промоутер gst-4,33глутатион S-трансфераз3 . В отличие от других транскрипционных регуляторов, представленных здесь, gst-4p::GFP имеет высокое базальное выражение. Тем не менее, это выражение все еще может быть надежно активирована в условиях окислительного стресса, который может быть выполнен как генетически, так и химически. Чтобы генетически вызвать окислительный стресс, мы нокдаун Wdr-23, который кодирует белок, который играет роль в протеасомальной деградации SKN-134. wdr-23 нокдаун приводит к надежной активации gst-4p::GFP. Кроме того, лечение червей с химическим окислителем, TBHP, приводит к мягкой, но все еще значительной активации gst-4p::GFP (Рисунок 3). Как химическая, так и генетическая активация gst-4p::GFP может быть почти полностью подавлена РНК нокдауном скн-1, геном, кодируя мастер транскрипционный регулятор OxSR.

Большинство клеточных белков переведены в цитоплазму и проживают там, даже если только временно, прежде чем быть мишенью в другом месте. Таким образом, цитоплазма содержит широкий спектр сопровождающих, которые способствуют правильному сворачиванию и функции белка, а также ферментам и белкам, отвечающим за деградацию поврежденных, дисфункциональных или избыточных белков. Для защиты этого сложного белкового ландшафта цитоплазмы, клетка развилась несколько цитоплазмических путей реакции на стресс, в том числе тепло-шок ответ (HSR)35,36. HSR является путь, посвященный продвижению белка гомеостаза в условиях теплового стресса и модулируется мастер транскрипционного регулятора, HSF-137. В стабильных условиях HSF-1 связан цитоплазмическими сопровождающими, HSP90 и HSP70/40, что держит его запертым в мономерном, неактивном состоянии. В условиях жары или аналогичного стресса, увеличение неправильно сложенных белков приводит к титрации сопровождающих от HSF-1, что позволяет ему тримизеризировать и перемещаться в ядро, чтобы активировать HSR38,39. Возможно, наиболее изученных вниз по течению целей HSF-1 под активацией HSR являются тепло-шоковые белки (HSP), такие как HSP70, HSP90, DNAJ, и HSP6017,40. В C. elegans, транскрипционные репортеры для HSR были синтезированы путем вождения выражение GFP под промоутеров канонических HSPs, hsp-16.2 и hsp-709,41. Как и их коллеги UPRMT и UPRER, hsp-16.2p::GFP и hsp-70p::GFP показывают минимальное базальное выражение в отсутствие стресса. Тем не менее, оба репортера надежно индуцированных в условиях теплового стресса, который может быть легко визуализирован с помощью микроскопии или количественно с помощью цитометра потока больших частиц(рисунок 4). Оба репортера имеют большой динамический диапазон, и индукция полностью зависит от hsf-1,так как РНК-нокдаун hsf-1 полностью подавляет индукцию hsp-16.2p::GFP и hsp-70p::GFP. Хотя эти репортеры могут быть использованы взаимозаменяемы для большинства ситуаций, могут быть различия в уровнях выражения и выражения между тканями.

Физиологические анализы для измерения чувствительности к стрессу у C. elegans
C. elegans являются отличным модельным организмом для измерения чувствительности к стрессу из-за низкой стоимости в обслуживании и экспериментах и простоты редактирования генома или генетического нокдауна с использованием РНК, который обеспечивает возможность для проведения крупномасштабных экспериментов во всем организме. Чтобы проанализировать стрессоустойчивость к стрессу, мы подвергаем C. elegans химическому агенту, туникамицину, который вызывает накопление поврежденных белков в ER, блокируя N-связанные гликозилирование10. После развития животных подвергаются воздействию туникамицина, так как препарат вызывает дефекты развития. При воздействии туникамицина, взрослые черви проявляют заметное снижение продолжительности жизни. Кроме того, нокдаун гена, xbp-1, который кодирует один из основных факторов транскрипции, участвующих в индукции UPRER, приводит к значительному увеличению чувствительности к туникамицину (Рисунок 5А)12. Таким образом, это служит надежным анализом для измерения чувствительности стресса ER у взрослых червей.

Для измерения окислительного стресса и митохондриального стресса, мы подвергаем животных химическому агенту, параквату. Паракват вызывает митохондриальный стресс путем синтеза ROS в митохондриальной матрице, которая затем может быть преобразована в перекись водорода и диффузии из митохондрий, чтобы вызвать цельноклеточное окислительное повреждение13. Подобно ER стресс анализы, мы подвергаем животных паракватом в зрелом возрасте. Тем не менее, мы выполняем паракват анализы в жидкости, чтобы уменьшить стоимость и ручного труда и агар пластины на основе анализов будет трудно для большинства лабораторий. Здесь мы показываем, что животные, подвергшиеся воздействию параквата в жидкости, показывают медианную выживаемость примерно 5 часов(рисунок 5B). Кроме того, нокдаун рецептора инсулина, daf-2, приводит к повышенной резистентности к параквату, как активация DAF-16/FOXO приводит к увеличению экспрессии участвующих в очистке ROS, таких как sod-342,43. Анализы выживания параквата короткие, длящиеся до 14 часов, и, таким образом, служат эффективным методом для допроса митохондриальных и окислительных реакций стресса.

Наконец, выживание при повышенных температурах используется для допроса физиологической реакции на тепловой стресс. Эти анализы могут быть выполнены как в жидком или твердом агаре, и существуют многочисленные различные протоколы, изложенные21. Рекомендуется стандартизировать один анализ в лаборатории, чтобы уменьшить изменчивость, которая является исключительно высокой в этом анализе. Термотерпимость должна быть выполнена в первый день взрослых животных на стандартных агар пластин, либо при 34 градусах Цельсия или 37 градусов по Цельсию. При 37 градусах Цельсия, большинство смерти происходит между 7-11 часов, что делает это простой однодневный анализ, в то время как 12-16 часов экспериментов при 34 градусов по Цельсию наиболее легко выполняются в одночасье(Рисунок 5C-E). Мутация в гене, ttx-3, приводит к отказу спецификации AIY interneurons, ответственных за термосенсорной нейронной цепи, и вызывает значительное увеличение термочувствительности44. В то время как термопереносимы данные могут быть построены как кривая выживания(Рисунок 5C), эти анализы должны быть выполнены по крайней мере 4-6 раз, и все репликации должны быть построены друг против друга (Рисунок 5D-E), как термопереносики показывает невероятно высокую изменчивость по сравнению с другими стресс-анализы. Это связано со многими оговорками, которые существуют в создании этих экспериментов, в том числе изменчивость штаммов интерес, неравное езда на воздухе в инкубаторах, неравномерное агар пластины и т.д.21. При 34 градусах Цельсия, медианная выживаемость происходит примерно в 14 часов, и, как и 37 градусов по Цельсию, ttx-3 мутантов экспонат снижение выживаемости на 34 градусов по Цельсию(рисунок 5E).

Figure 1
Рисунок 1: Использование hsp-4p::GFP в качестве репортера для индукции UPRER. (A) Представитель флуоресцентные микрографы hsp-4p::GFP, выражающие животных, выращенных на контрольном пустом векторе (EV) или xbp-1 РНК. Звери выращивались на РНК от люка до L4 при 20 градусах Цельсия, затем обработали 25 нг/ЗЛ туникамицином или 1% DMSO, плавающими в M9 при 20 градусах Цельсия в течение 4 часов, и восстановились на пластине OP50 в течение 16 часов при 20 градусах Цельсия до получения изображения. На агарной пластине NGM животные были парализованы в 100 азидах натрия и смогли сделать снимок с помощью стереомикроскопа. (B) Количественный анализ (A) с помощью большого биосортитера частиц. Данные представлены как интегрированная интенсивность флуоресценции по всему животному, где каждая точка представляет собой одно животное; Контроль DMSO в серый и туникамицин обработанных животных в красном цвете. Центральная линия представляет среднюю, а усы представляют межквартильный диапазон. n - 123-291 животных на штамм. р Злт; 0.001 с использованием непараметрических испытаний Манн-Уитни. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2: Использование hsp-6p::GFP в качестве репортера для индукции UPRMT. (A) Представитель флуоресцентных микрографов hsp-6p::GFP, выражающих животных, выращенных на контрольный пустой вектор (EV), cco-1, mrps-5, или nuo-4 RNAi. Звери выращивались на РНК из люка и изображены на 1-й день взрослой жизни при 20 градусах Цельсия. Звери были парализованы в 100 мкм азида натрия на ngM агар пластины и изображение с помощью сложного микроскопа. (B) Количественный анализ (A) с помощью большого биосортитера частиц. Данные представлены как интегрированная интенсивность флуоресценции по всему животному, где каждая точка представляет собой одно животное; EV управления в серый РНК-обработанных животных в красном цвете. Центральная линия представляет среднюю, а усы представляют межквартильный диапазон. n - 303-384 животных на штамм. р Злт; 0,001 по сравнению с EV управления с использованием непараметрических Манн-Уитни тестирования. (C) Репрезентативные изображения hsp-6p::GFP животных, обработанных DMSO или Antimycin A. Животные были выращены из люка на 0,2% пластин DMSO и переданы пластин, содержащих 0,2% DMSO или 3 мМ антимицин А в течение 16 часов до изображения на реверсаторе РЕКОСТ R4 микроскопа. Весь рост был выполнен при 20 градусах Цельсия. (D) Количественный анализ (C) с использованием крупных частиц биосортитер похож на (B). DMSO управления в большой, и Antimycin-обработанных животных в красном цвете. n 495 для DMSO и 219 для Antimycin A. »p slt; 0.001 по сравнению с EV control с использованием непараметрического тестирования Манн-Уитни. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3: Использование gst-4p::GFP в качестве репортера для OxSR. (A) Представитель флуоресцентные микрографы gst-4p::GFP, выражающие животных, выращенных на контрольном пустом векторе (EV), скн-1,или Wdr-23 РНК. Звери выращивались на РНК от люка до стадии L4 при 20 градусах Цельсия. Звери выращивались на РНК от люка до L4 при 20 градусах Цельсия, затем обработали 2 мМ TBHP в M9 или только M9 для "необработанного" контроля при 20 градусах Цельсия в течение 4 часов, и восстановили на пластине EV в течение 16 часов при 20 градусах Цельсия до получения изображения. Звери были парализованы в 100 мкм азида натрия на ngM агар пластины и изображение с помощью сложного микроскопа. (B) Количественный анализ (A) с помощью большого биосортитера частиц. Данные представлены как интегрированная интенсивность флуоресценции по всему животному, где каждая точка представляет собой одно животное; необработанный контроль в серый и TBHP-обработанных животных в красном цвете. Центральная линия представляет среднюю, а усы представляют межквартильный диапазон. n - 101-204 животных на штамм. р Злт; 0,001 по сравнению с соответствующим контролем EV с использованием непараметрических испытаний Манн-Уитни. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 4
Рисунок 4: Использование hsp16.2p::GFP и hsp-70p::GFP как репортеры для реакции жар-шока. (A) Представитель флуоресцентных микрографов hsp16.2p::GFP, выражающих животных, выращенных на контрольный пустой вектор (EV) или hsf-1 RNAi. Звери выращивались на RNAi из люка при 20 градусах Цельсия до первого дня. Первое день животных либо оставили при температуре 20 градусов по Цельсию (необработанные), либо подвергали 2 часа теплового стресса при температуре 34 градусов по Цельсию, а затем восстанавливались в течение 2 часов при температуре 20 градусов по Цельсию. На агарной пластине NGM животные были парализованы в 100 азидах натрия и смогли сделать снимок с помощью стереомикроскопа. (B) Количественный анализ (A) с помощью большого биосортитера частиц. Данные представлены как интегрированная интенсивность флуоресценции по всему животному, где каждая точка представляет собой одно животное; необработанный контроль в серых и тепло-шокированных животных в красном. Центральная линия представляет среднюю, а усы представляют межквартильный диапазон. n - 320-364 животных на штамм. р Злт; 0.001 с использованием непараметрических испытаний Манн-Уитни. (C) Представитель флуоресцентные микрографы hsp-70p::GFP выражения животных, выращенных на контроль EV и hsf-1 РНК и рассматриваются как описано в (A). (D) Количественный анализ (C), как описано в (B). n 773-941 животных на штамм. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 5
Рисунок 5: Физиологическая выживаемость анализы при стрессе в C. elegans. (A) Продолжительность жизни нематод, выращенных на 1% DMSO, содержащих 25 нг / Л туникамицина (TM) пластин. Звери выращивались на 1% пластинах ДМСО от люка до 1-го дня, а в первый день передавались на соответствующие тмплиты. От люка до конца асссса животных держали под контролем пустой вектор (EV) или xbp-1 RNAi. Взрослые животные вручную отодвигаются от потомства каждый день до 7-8-го дня, когда потомство больше не обнаруживается, а затем забивают каждые 2 дня, пока все животные не будут зарегистрированы как мертвые или подвергнуты цензуре. Звери с мешками, вульвы выступы / взрывы, или те, которые ползли по бокам пластин считались цензуре. (B) Кривая выживания нематод в 100 мМ параквата (ПЗ) растворяется в растворе M9. Звери выращивались на EV или daf-2 РНК с люка до первого дня взрослой жизни при 20 градусах Цельсия. Зверей помещали в раствор 50 л раствора M9 и P' в 96 хорошо пластине при 20 градусах Цельсия и визуализировали каждые 2 часа, пока все животные не были неподвижны. (C) Кривая выживания нематод при 37 градусах Цельсия. Дикий тип (N2), ttx-3 (KS5)и sur-5p::hsf-1 животные выращивались на пластинах EV от люка до 1 дня при 20 градусах Цельсия. На 1 день, животные были перемещены до 37 градусов по Цельсию и забил каждые 2 часа, пока все животные были забиты как мертвые или цензуре. (D) Собранные данные всех анализов термотерпимости, выполненных при 37 градусах Цельсия. Данные представлены в качестве процента живых в час 9 термопереносимости анализа, с каждой строки, представляющие соответствующие эксперимент, выполненный в тот же день. (E) Собранные данные всех анализов термотерпимости, выполненных при 34 градусах Цельсия. Данные представлены в качестве процента живых в час 14 термопереносимости анализа, с каждой строки, представляющие соответствующие эксперимент, выполненный в тот же день. Все статистические данные по A-C были выполнены с помощью тестирования Log-Rank (Mantel-Cox) и можно найти в таблице 5. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Реагента Рецепт
Лисогений Бульон (LB) В этом протоколе, коммерческие LB был использован (см. Материалы), но все стандартные LB самодельные рецепты с использованием Bacto-триптон, дрожжевой экстракт, и NaCl достаточно.
Nematode Рост СМИ (NGM) 1 мМ CaCl2, 5 мкг/мл холестерина, 25 мМ KPO4 рН 6,0, 1 мМ MgSO4, 2% (w/v) агар, 0,25% (w/v) Бакто-Пептон, 51,3 мм NaCl
Решение отбеливателя 1,8% (v/v) гипохлорит натрия, 0,375 М кН
Решение M9 22 мМ KH2PO4 монобасичный, 42,3 мм Na2HPO4, 85,6 мМ NaCl, 1 мМ MgSO4
Пластины NGM RNAi 1 мМ CaCl2, 5 мкг/мл холестерина, 25 мМ KPO4 рН 6,0, 1 мМ MgSO4, 2% (w/v) агар, 0,25% (w/v) Бакто-Пептоне, 51.3 mM NaCl, 1 мМ IPTG, 10 мкг/мл карбениллин/ампицилин. Хранить при 4 с в темноте до 3 месяцев
Тетрациклин 10 мг/мл бульонного раствора (500x) в 100% этанола. Хранить при -20 градусах по Цельсию
Карбенициллин 100 мг/мл бульонного раствора (1000x) в воде. Хранить при 4 градусах по Цельсию в течение 6 месяцев или -20 градусов по Цельсию для длительного хранения
Азид натрия 1 M акции (6,5%) стоковой раствор азида натрия в воде. Хранить в темноте при 4 градусах По Цельсию. Это 10x решение и разбавлен до 100 мМ рабочий запас для большинства изображений экспериментов
Туникамицин 2,5 мг/мл бульонного раствора в 100% DMSO. Хранить при -80 градусах по Цельсию для длительного хранения. Это 100x решение (25 нг / л рабочего решения)
Антимицин А 15 мМ антимицин складе решение в 100% DMSO. Хранить при -20 градусах по Цельсию. Это решение 5000x (3 ММ рабочего запаса)
Паракват 50 мкм раствор в воде - должны быть подготовлены свежие
Терт-бутилгидрооксид (TBHP) Раствор 7,7 М в воде. Это решение 3850x (2 мМ рабочий запас)
NGM РНКИ и DMSO0.2 1 мМ CaCl2, 5 мкг/мл холестерина, 25 мМ KPO4 рН 6,0, 1 мМ MgSO4, 2% (w/v) агар, 0,25% (w/v) Бакто-Пептон, 51.3 mM NaCl, 1 мМ IPTG, 10 мкг/мЛ карбенил/ампицил.
(контроль за антимицином А)
NGM RNAi и антимицин A 1 мМ CaCl2, 5 мкг/мл холестерина, 25 мм КПО4 рН 6,0, 1 мМ MgSO4, 2% (w/v) агар, 0,25% (w/v) Бакто-Пептон, 51,3 мМ. NaCl, 1 мМ IPTG, 100 мкг/мл карбенициллин/ампипиллин, 0,2% ДМ.
NGM РНКД ДМСО 1 мМ CaCl2, 5 мкг/мл холестерина, 25 мМ KPO4 рН 6,0, 1 мМ MgSO4, 2% (w/v) агар, 0,25% (w/v) Бакто-Пептоне, 51,3 мм НаК, 1 мМ IPTG, 10 мкм/мл карбениллин/ампицилин; 1% ДМСО
(контроль за туникамицином)
NGM RNAi TM 1 мМ CaCl2, 5 мкг/мл холестерина, 25 мМ KPO4 рН 6,0, 1 мМ MgSO4, 2% (w/v) агар, 0,25% (w/v) Бакто-Пептоне, 51,3 мм НаК, 1 мМ IPTG, 10 мкм/мл карбениллин/ампицилин; 1% ДМСО, 25 нг/Л туникамицина
IPTG 1 М раствор в воде.

Таблица 1: Рекомендуемые рецепты для реагентов, используемых. Все точные рецепты реагентов, используемых в этом протоколе, изложены здесь. Конкретные компании, где были приобретены реагенты, также доступны в таблице материалов. Было протестировано множество различных химических веществ, и те, которые перечислены в таблице материалов, являются теми, которые продемонстрировали наиболее надежные и воспроизводимые результаты.

Размер плиты Тип бактерий - животных, чтобы достичь дня 1 взрослой жизни - животных, чтобы достичь стадии L4
60 мм OP50 100-150 150-300
60 мм HT115 70-100 120-200
100 мм OP50 600-1000 1500-2000
100 мм HT115 350-600 700-1300

Таблица 2: Рекомендуемое количество животных для пластины после синхронизации, чтобы избежать голода. Чтобы избежать голода, мы рекомендуем надеть определенное количество животных на одно состояние. Так как OP50 становится плотнее, чем HT115, больше животных может быть покрыто. Все номера, перечисленные здесь, являются руководящими принципами, используемыми в нашей лаборатории, и цифры могут быть немного разными из-за нескольких переменных и различий между лабораторными условиями. Поэтому, или рекомендуемые номера находятся на нижней стороне жирным шрифтом. Максимальные числа являются то, что может быть покрыта в оптимальных условиях в нашей лаборатории, не достигнув голода, но это не рекомендуется использовать эти значения без предварительного titrating ваши условия. Все числа определяются с предположением, что бактерии посеяны на пластинах и разрешено расти в течение 24 часов при температуре окружающей среды (22 градусов по Цельсию) на пластинах до того, как на них помещаются черви. Хотя нет никакой существенной разницы в темпах голодания при обшивке яиц или L1s, мы рекомендуем покрытие 10% больше номеров при покрытии яйца, так как не все яйца будут люк пост-отбеливания.

Название штамма Трансген Цель Рекомендуемое применение (ы) стресса Источник
SJ4005 hsp-4p::GFP УПОER 25 мкг/мл туникамицина CGC
SJ4100 hsp-6p::GFP УПОМТ 3 мкм антимицин А; CGC
РНК против ЕТК или митохондриальной рибосомы
SJ4058 hsp-60p:GFP УПОМТ 3 мкм антимицин А; CGC
РНК против ЕТК или митохондриальной рибосомы
CL2070 hsp-16.2p:GFP тепло-шок ответ 34 кв 2 часа CGC
AM446 hsp-70p:GFP тепло-шок ответ 34 кв 2 часа Лаборатория Моримото
CL2166 gst-4p::GFP OxSR 50 мМ паракват; CGC
2 мМ терт-бутил гидроперекиси
CF1553 sod-3p::GFP ОксисР и инсулин сигнализации РНК против даф-2 (инсулиновый рецептор) CGC
AU78 T24B8.5p:GFP врожденный иммунный ответ воздействия патогена (например, P. aeruginosa) CGC

Таблица 3: Транскрипционные репортеры для оценки активации клеточных реакций стресса. Перечисленные здесь штаммы доступны через CGC или через специальные запросы в лаборатории для использования как в качественных, так и в количественных методах визуализации, описанных в данной рукописи. Все эти штаммы являются производными от бристоля N2 фона. Также предоставляются рекомендуемые методы применения стресса для активации репортеров. Все репортеры, за исключением sod-3p::GFP45 и T24B8.5p::GFP46 описаны в тексте.

Трансген Рекомендуемое применение (ы) стресса Время экспозиции с помощью стерео микроскопа Leica M2250FA Время экспозиции с помощью микроскопа Revolve ECHO Значения PMT с помощью биосортиного биосортиру Union Biometrica COPAS
hsp-4p::GFP 25 мкг/мл туникамицина (4 часа с ночным восстановлением) 200 мс 275 мс 450
hsp-6p::GFP 3 мкм антимицина А (16 часов); 100мс 50 мс 350
РНК против ЕТК или митохондриальной рибосомы (из люка)
hsp-60p:GFP 3 мкм антимицина А (16 часов); 200 мс 100 мс 450
РНК против ЕТК или митохондриальной рибосомы (из люка)
hsp-16.2p:GFP 34 кв 2 часа 400 мс 200 мс 500
hsp-70p:GFP 34 кв 2 часа 400 мс 300 мс 500
gst-4p::GFP 50 мМ паракват (2 часа); 100 мс 50 мс 350
2 мМ терт-бутил гидроперекиси (4 часа с ночным восстановлением)
sod-3p::GFP РНК против даф-2 (инсулиновый рецептор) 300 мс 300 мс 475
T24B8.5p:GFP воздействия патогена (например, P. aeruginosa) 100 мс 50 мс 350

Таблица 4: Рекомендуемые настройки для флуоресцентной микроскопии и количественной оценки с использованием биосортера крупных частиц. Эта таблица служит в качестве ориентира для рекомендуемого времени воздействия для флуоресцентной микроскопии или значения PMT для биосортера крупных частиц. Они будут служить хорошими отправными точками, но время экспозиции и значение PMT должны быть скорректированы для каждого эксперимента, чтобы убедиться, что никакой насыщенности не происходит и что флуоресцентные значения выше предела обнаружения фонового сигнала. Если известно образец с самым ярким сигналом для эксперимента (например, положительные элементы управления для индукции напряжения), эти образцы могут быть использованы для определения самого высокого времени воздействия или ПМТ, которые могут быть использованы без насыщения сигнала. Если самые яркие образцы не известны, то можно использовать элемент управления и время экспозиции или PMT в центре динамического диапазона вашей системы.

Соответствующая фигура Напряжение, Лечение Средняя продолжительность жизни - Смертность/Всего % изменение средней продолжительности жизни p-значение (Лог-рейтинг; Мантел-Кокс)
5a N2, вектор РНК, 1% DMSO 22 дня 95/120 -- --
N2, xbp-1 РНК, 1% DMSO 14 дней 92/120 -36.4 Злт; 0,001
N2, вектор РНК, 25 нг/ЗЛ ТМ 14 дней 97/120 -36.4 Злт; 0,001
N2, xbp-1 РНК, 25 нг/ЗЛ ТМ 12 дней 98/120 -45.4 Злт; 0,001
5B N2, вектор РНК, 100 мМ ПЗ 5 часов 73/73 -- --
N2, daf-2 РНК, 100 мМ ПЗ 6,5 часов 74/74 30 Злт; 0,001
N2, вектор РНК, 37 КК 8 часов 59/60 -- --
ttx-3 (KS5), вектор РНК, 37 КК 7 часов 60/60 -12.5 0.002
сюр-5p::hsf-1, вектор РНК, 37 КК 9 часов 59/60 12.5 0.012

Таблица 5: Статистика продолжительности жизни и анализы на выживание в стрессе. Все размеры выборки, статистика и цензура для рисунка 5 доступны здесь.

Реакция на стресс Целевой ген Форвард Праймер Обратный праймер
УПОER hsp-3 ТГГКТГАТТГААКГТГТГТГТКГCG GTTGCGTCTCTCCCTCTCTCTTTTTG
УПОER hsp-4 ГААКААККАКТККГГГГГТГТГГГ ГААКААККАКТККГГГГГТГТГГГ
УПОER sel-11 TTGATCTCCGGAAACGCAACGCGCGCGCGCG TTGATCTCCGGAAACGCAACGCGCGCGCGCG
УПОER ire-1 ТКЦЦАКККТЦКАААКАТ ТКЦЦАКККТЦКАААКАТ
УПОER xbp-1 ГГАКТТЦГГТТЦГАГТГАГТ ГГАКТТЦГГТТЦГАГТГАГТ
УПОER xbp-1 (сплайсированный) GGTGGATGGAGGGAGAAGATT GGTGGATGGAGGGAGAAGATT
УПОER crt-1 ГААГТААТАГККГАГгААГГГГК ГААГТААТАГККГАГгААГГГГК
УПОER T14G8.3 CACCTCCATCAACAACAAACAT CACCTCCATCAACAACAAACAT
Hsr hsp-17 ТГКТТТЦАККАЦТЦКККК ТГТТТГАТККЦКККСАГТАТГГТГТ
Hsr hsp-70 ТГТТТГАТККЦКККСАГТАТГГТГТ TTCGCAATGAGAAGGGACGACT
Hsr F44E5.4 TTCGCAATGAGAAGGGACGACT CGTTGTGTGCGTCTCTCTCTCTTTT
Hsr hsp-16.2 TCCATCTGAGCTCTCTGAGATT
GTTA
TGGTTAAACTGTGAGGTTGA
Hsr hsf-1 TTTGCATTCTCGTCTCTCTCTCCCC ТЦТАТЦАКАКККТКККТККТГКТКТХТ
УПОМТ hsp-6 ГАГАТКГТГГЯАККААААГАГАГА CGGCATCTTTTCGGCTCTCTCTTTT
УПОМТ hsp-60 CGGCATCTTTTCGGCTCTCTCTTTT CGTCGTGCAGAGCTCAAGAAG
УПОМТ ymel-1 CAAAACCTGATCTCGCTGGGGG TTCTCAATGTCGGCTCCAGT
УПОМТ clpp-1 TGATAAGTGCACCAGTGTCCA TGATTCTGGAGTTCGGGAGA
УПОМТ lonp-1 КГАТГАТГАТГКАТТАТГГГГГГГГГГГГГГГГГГГАГГГГГ CGCTTGAAACATCAATTTCAT
Cca
OxSR gst-4 ГАТГТГТГТТКТКТГТТГТГТГТГТГТГТГГГТГГТГ CCGAATGTTCTCTCCCGAC
OxSR gst-6 CCGAATGTTCTCTCCCGAC TTTGGCAGTGTGTGAG
OxSR gst-7 TTTGGCAGTGTGTGAG TGGGTAATCTGGACGGTTTG
OxSR gcs-1 TGGGTAATCTGGACGGTTTG ATGTTGCCTCGACAATGTT
OxSR skn-1 GGACAAGAATCCCAAAGG ТКАГХТАКГЦАКАГГАГАГАК
OxSR sod-3 GTAACGGGCGATAGCATGAGGAGGAG GCGAGACACATTGATGAC
OxSR ptps-1 ААТГХАТЦкТТГАГААКК КААТКТЕКТЦКККАКТТТТ
CAAAGC
Ссылки pmp-3 TGGCCGGATGTGTGTCGCC ACGAACAATGCCAAAGGCCAGC
Ссылки Y45F10.4 CGAGAACCCGCGAAATGTCGGA CGGTTGCCAGGGAAGATGAGGAGGC
Ссылки сок-49 TGGCGCGTCGTTTTCCCC ACGAGTCTCCTCGTCGTCCCA
Ссылки tba-1 TCAACACTGCCATCGCCGCCCC TCCAAGCGAGACCAGGCTTCAG

Таблица 6: Рекомендуемые генные цели и грунтовые пары для измерения транскрипционной апрегерегигена генов реакции на стресс.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Здесь описаны методы для изучения клеточных реакций стресса в C. elegans,с помощью флуоресцентных транскрипционных репортеров и физиологических анализов выживания стресса. Репортеры все используют выражение GFP приводом под промоутер вниз по течению транскрипционной цели транскрипции факторов, участвующих в монтаже клеточных реакций стресса. Использование hsp-4p::GFP модулируется XBP-1s-опосредованных UPRER, hsp-6p::GFP контролируется AtFS-1-опосредованных UPRMT, gst-4p::GFP под SKN-1-опосредованный OxSR, и hsp16.2p:GFP и hsp-70p:GFP под HFF-media Другие стандартизированные транскрипционные репортеры можно найти в таблице 3. Все транскрипционные репортеры, представленные здесь, имеют широкий динамический диапазон и могут быть надежно активированы путем применения стресса либо через генетические возмущения, либо воздействие химических веществ, вызывающих стресс. Кроме того, эти репортеры могут быть подавлены нокдаун транскрипции факторов вверх по течению промоутеров занятых. Наконец, каждый транскрипционный репортер в паре с конкретным физиологическим стрессом выживания анализ обеспечить физиологическое считывание воздействия либо активации или подавления конкретного стресса ответ.

Для успешного использования транскрипционных репортеров, важно определить динамический диапазон каждого репортера. В связи с большой изменчивостью лаборатории в лаборатории, вызванной различиями в носителях, агаре, окружающей среде и т.д., рекомендуется титрать каждый препарат или парадигму индукции стресса для концентраций и времени, используя наши рекомендации в качестве базового уровня. Далее, очень важно обеспечить животных здоровыми и должным образом синхронизированы. До начала экспериментов необходимо восстановить животных, которые испытывали какой-то стресс (например, голод, длительное воздействие света, воздействие повышенной температуры и т.д.). Надлежащая синхронизация может быть достигнута с помощью методов, изложенных в разделе 2, что имеет важное значение, поскольку несколько стрессовых реакций имеют различные уровни активации в процессе старения. Наконец, протоколы визуализации необходимы для стандартизации, так как существуют различные вещи, которые могут повлиять на качество изображения и данных. Например, продолжительность животных в азиде натрия должна быть сведена к минимуму, так как это вызывает стресс у животных и может повлиять на сигнал репортера. Кроме того, микроскоп и биосортер спецификации должны быть надлежащим образом установлены для максимального соотношения сигнала к шуму и динамического диапазона, не вызывая насыщения. Насыщенные пиксели могут вызвать серьезные проблемы в количественном анализе образцов, так как максимальный флуоресцентный сигнал может быть сильно недооценен.

В то время как транскрипционные репортеры, описанные здесь, обеспечивают надежное и эффективное средство измерения активации стрессовых реакций, очень важно понимать, что это единая цель гена известного транскрипционного фактора. Таким образом, в то время как он служит надежным методом для крупномасштабных экранов или первопроходных тестов штаммов, представляющих интерес, должны быть выполнены надлежащие проверки. Мы рекомендуем выполнять qPCR для измерения нескольких канонических генов-мишеней, активированных при индукции каждого асссесифика цимата стресса. Список предполагаемых целей генов можно найти в таблице 6. Кроме того, транскриптом профилирование через РНК-сек является еще одной альтернативой для более широкого взгляда на последствия на несколько транскрипционных целей одновременно. Особо следует отметить, что изображение флуоресцентных репортеров предоставляет пространственную информацию о тканях, которые страдают от возмущений. Такая информация не может быть получена из qRT-PCR или RNA-seq, так как она использует экстракты цельного червя, за исключением scRNA-seq, FISH, и ткани конкретных протоколов RNAseq47. Наконец, эти репортеры стресса, как правило, характеризуются как специфические для их механизма реагирования на стресс. Тем не менее, важно помнить, что не все парадигмы реагирования на стресс являются уникальными и различными. Например, ER стресс может активировать OxSR и наоборот48, и перекрытия между тепло-шок ответ и ER реакции стресса были обычно найдены49. Это лишь некоторые из многих примеров в литературе перекрестного общения и перекрытия между стрессовых реакций, и, таким образом, важно понимать, что все анализы должны быть также проверены на специфику для получения окончательных выводов.

Еще одним ограничением описанных методов является то, что визуализация и количественная оценка с помощью биосортера имеют ограниченную пропускную стоимость. В то время как биосортатор количественной оценки может быть выполнена в 96-колодец пластин для более высокой пропускной способности, она по-прежнему ограничивается необходимостью передачи червей в раствор, в то время как изображение ограничено способностью следователя подготовить червей и выполнять микроскопию. Таким образом, крупномасштабные экраны, скорее всего, будет включать только визуальный скрининг флуоресцентного сигнала репортера, только хиты изображаются и количественно.

Важным предостережением с использованием этих флуоресцентных репортеров является то, что активация или подавление реакции на стресс не всегда способствуют физиологически значимых фенотипов, или может отражать другие глобальные эффекты (например, снижение синтеза белка). Таким образом, каждый транскрипционный репортер в паре с методом, чтобы рассказать о выживании стресса. Рекомендуется выполнять анализы выживания туникамицина для UPRER,анализы выживаемости паракватов для UPRMT и OxSR, а также выживание при повышенных температурах для реакции тепло-шока. Хотя они, как правило, надежные, быстрые и простые анализы, они требуют интенсивного ручного труда, и, таким образом, серьезно ограничены в масштабируемости. Кроме того, почти все анализы термотерпимости, опубликованные на сегодняшний день, имеют большую изменчивость, что делает большое количество репликаций почти необходимым21. Хотя туникамицин и паракват выживания анализы не страдают от этого отсутствия воспроизводимости, они имеют свои собственные проблемы, в том числе обширный практический труд и продолжительность протокола. Как новые технологии рождаются в автоматизации продолжительности жизни и выживания анализы, вполне вероятно, что эти стресс выживания анализы также может стать высокой пропускной50. Однако, до тех пор, пока эти автоматизированные анализы становятся стандартными, анализы выживания в настоящее время ограничиваются проверкой физиологических последствий в изменении динамики активности реакции на стресс.

Помимо стресс выживания анализы описаны здесь, Есть ряд других методов для измерения физиологии у животных. Например, коммерчески доступный Seahorse XFp Analyzer может обеспечить мониторинг клеточного дыхания, что обеспечивает дополнительное механистическое понимание51. Другой альтернативой транскрипционным репортерам является использование ядерной локализации флуоресцентно обозначенных транскрипционных факторов. Есть множество вариантов этой техники, но особый интерес к методам, описанным здесь включают в себя: HSF-1::GFP для тепло-шок ответ52, DVE-1::GFP для UPRMT53, и DAF-16::GFP и SKN-1::GFP для OxSR54,55. Наконец, можно провести прямой допрос морфологии конкретных органелл, представляющих интерес. Например, митохондриальная морфология может быть визуализирована с помощью флюорофора, ориентированного на митохондриальную матрицу, используя последовательность митохондриальной локализации56. ER морфологии могут быть визуализированы с помощью флюорофора, направленных на ER через сигнал-последовательность сливается с N-терминов и HDEL сливается с C-терминов57 или GFP сливается с ER мембранного белка58. Наконец, актин цитоскелет целостности может быть использован в качестве прокси для тепловой чувствительности стресс вниз по течению HSF-1. Актин цитоскелет регулируется транскрипционных целей HSF-1, в частности, во время старения и тепло-стресс, и, таким образом, актин организации могут быть визуализированы для определения функционального считывания HSF-1 и тепла связанных стресс59,60.

Все описанные здесь методы могут быть использованы самостоятельно или в сочетании друг с другом для всестороннего анализа генов или препаратов, представляющих интерес, и их влияния на стрессовую реакцию. Крупномасштабные экраны могут быть выполнены с помощью высокой пропускной транскрипции репортер анализы, и вторичные экраны могут быть выполнены с помощью количественного анализа этих репортеров. После того, как более управляемым кандидатом гена / наркотиков списки определены, физиологические анализы могут быть выполнены для выявления тех кандидатов, которые имеют прямое влияние на всей физиологии животных. Другие методы, предложенные выше, также могут быть использованы в качестве проверки или дальнейшего расследования.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

R.BZ. поддерживается EMBO долгосрочной стипендий и Ларри Л. Hillblom фонда. R.H.S поддерживается грантом 5F32AG032023-02 через Национальный институт старения (NIA) и Фонд Гленн для медицинских исследований постдокторской стипендий. A.F. поддерживается грантом F32AG051355 через NIA. H.K.G. поддерживается грантом DGE1752814 в рамках Программы стипендий для аспирантов Национального научного фонда. M.G.M. поддерживается 1F31AG060660-01 через NIA. A.D. поддерживается Фондом Томаса и Стейси Зибеля, Медицинским институтом Говарда Хьюза и 4R01AG042679-04 и 5R01AG05891-02 от NIA и 5R01ES021667-09 от NIEHS. Мы благодарим Ларри Джо, Мелиссу Санчес, Нааме Келет и Анэла Эскивеля за значительную техническую помощь. Мы благодарим лабораторию Моримото и CGC (финансируется NIH Office исследовательской инфраструктуры программы P40 OD010440) для штаммов.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).
Измерения физиологических стрессовых реакций у <em>C. Elegans</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).More

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter