Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

C. Elegans의 생리적 스트레스 반응 측정

doi: 10.3791/61001 Published: May 21, 2020
* These authors contributed equally

Summary

여기서, 우리는 선충 C. 예쁜꼬마선충에서 세포 단백질 독성 스트레스 반응을 형광 전사 기의 활성화를 측정하고 생리적 스트레스에 대한 감수성을 측정하여 특성화한다.

Abstract

유기체는 종종 변동 환경과 세포 내 항상성에 변화에 노출, 이는 자신의 단백질과 생리학에 해로운 영향을 미칠 수 있습니다. 따라서, 유기체는 손상을 복구하고 항상성을 유지하기 위해 최선을 다하고 대상 및 특정 스트레스 응답을 진화했다. 이러한 메커니즘은 내구 성 망막(UPRER),미토콘드리아의 전개된 단백질 반응(UPRMT),열 충격 반응(HSR) 및 산화 스트레스 반응(OxSR)의 전개된 단백질 반응을 포함한다. 여기에 제시 된 프로토콜은 선충, C. elegans에서이러한 경로및 생리적 결과의 활성화를 감지하고 특성화하는 방법을 설명합니다. 먼저, 경로 특이적 형광 전사 기의 사용은 신속한 세포 특성화, 약물 스크리닝, 또는 대규모 유전자 스크리닝(예를 들어, RNAi 또는 돌연변이 라이브러리)에 대해 기술된다. 또한, 상보적이고 견고한 생리학적 측정이 설명되며, 이는 특정 스트레스에 대한 동물의 민감도를 직접 평가하는 데 사용될 수 있으며, 전사 기의 기능적 검증역할을 한다. 함께, 이러한 방법은 내부 및 외부 proteotoxic 섭동의 세포 및 생리적 효과의 신속한 특성화를 허용합니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

세포 내 및 세포 외 환경의 변화에 반응하는 유기체의 능력은 생존과 적응에 매우 중요합니다. 이것은 세포의 무결성을 보장하는 수많은 보호 경로를 통해 세포 수준에서 수행됩니다. 수많은 세포 구성 요소는 스트레스 관련 손상의 대상이 되는 동안, 세포 스트레스 응답의 한 가지 주요 참여는 복구 하 고 세포 proteome의 항상성을 보호 하는. 그러나, 세포기관에게 불린 특별한 구조물로 단백질의 구획화는, 세포 내의 모든 단백질이 제대로 접혀 있고 기능적이다는 것을 확인하기 위하여 단백질 품질 관리의 1개의 중앙 집중식 양식에 의지할 수 없기 때문에, 세포를 위한 도전을 제기합니다. 따라서, 그들의 단백질에 교란을 다루기 위하여는, 세포기관은 잘못 접힌 단백질을 감지하고 그 구획 내의 응력을 경감하기 위하여 시도에서 긴장 반응을 활성화할 수 있는 전용적인 품질 관리 기계장치를 발전시켰습니다. 예를 들어, 시토솔은 열 충격 반응(HSR)에 의존하는 반면, 내포성 망상체(ER)와 미토콘드리아는 구획특이적 전개단백질 반응(UPR)에 의존한다. OxSR 반응성 산소 종의 독성 효과 완화 하는 역 (ROS). 각 스트레스 반응은 세포 도전과 환경 모욕의 존재에서 트리거되고 맞춤형 전사 반응을 유도한다. 이 반응의 특징은 적당한 세포기관을 표적으로 한 잘못 접힌 단백질 (샤페론과 같은) 또는 대안으로, 단백질 분해에 의해 손상된 단백질을 제거하는 분자를 합성하는 것을 포함합니다. 이러한 스트레스 반응을 활성화 하지 못하면 손상된 단백질의 축적, 조직의 전신 장애로 전파 되는 세포 기능 장애, 그리고 결국 유기체의 죽음. 다른 스트레스 응답의 기능과 조절은다른곳에서 검토1 .

세포 스트레스 반응의 조절 및 활동에 관한 많은 통찰력은 선충, 예쁜꼬마선충,유전 연구에서 다세포 모델 유기체에 기인했습니다. 선충은 세포 수준에서 스트레스 반응의 활성화를 연구 할뿐만 아니라 유기체 수준에서도 연구 할 수 있습니다. 선충은 그들의 성장과 생존에 있는 약 및 오염물질에 유전 섭동 또는 노출의 효력을 공부하기 위하여 이용되었습니다. 그들의 빠른 생성 시간, 등소, 투명성, 유전 적 견인성 및 실험 중 사용 편의성은 그러한 연구에 이상적입니다. 또한, 스트레스에 상대적으로 빠른 생리 적 반응 (시간과 몇 일 사이) 그리고 세포 경로의 진화 보존 선충 스트레스 저항을 공부에 눈에 띄는 도구.

C. elegans를성장 하기 위해 식품 소스로 사용 되는 두 개의 일반적으로 사용 되는 대장균 균주가 있다: 표준 OP50, 대부분의 실험역사적으로 수행 된 B 변형2 그리고 HT115, 거의 모든 RNAi실험에사용 되는 K-12 균주3,4. OP50과 HT115 세균성 규정식 사이 중요한 다름이 있다는 것을 주의하는 것이 중요합니다. 이 상이한 세균 성 근원에 성장은 신진 대사 단면도에 있는 중요한 다름을 일으키는 원인이 되기 위하여 보였습니다, 미토콘드리아 DNA 사본 수, 및 수명을 포함하여 몇몇 중요한 표현형, 일생5. 이러한 차이 중 일부는 OP50 박테리아에 성장과 관련 된 비타민 B12 결핍에 기인, 미토 콘 드리 아 항상성 및 병원 체와 스트레스에 증가 감도 발생할 수 있습니다. 이러한 표현형의 모든 HT115 박테리아에 성장에 의해 완화 될 것으로 나타났습니다., 비타민 B12의 상부는6. 따라서 RNAi 조건의 필요성에 관계없이 HT115 박테리아에 대한 생리적 스트레스 반응에 대한 모든 실험을 수행하는 것이 좋습니다. 그러나, OP50상에서 동물을 유지하기 가용하기 때문에, 모든 표준 성장(즉, 동물의 유지 보수 및 증폭)은 OP50에서 수행될 수 있으며, 여기에 설명된 실험 패러다임의 현저한 차이는 OP50에서 유지되는 웜에서 검출되지 않았으며, HT115 포스트 동기화(즉, 부화 후 표백으로부터 또는 L검치없이)

여기서, 두 가지 기능적 방법을 이용한 세포 스트레스 반응의 활성의 특성화가 설명된다. 제시된 프로토콜은 주로 세포 스트레스 반응과 단백질 항상성에 미치는 영향에 초점을 맞추고 있다는 점에 유의해야합니다. 첫째, 형광 전사 기자는 다른 세포 스트레스에 응하여 특별히 활성화되는 내인성 유전자 프로모터에 의해 조절되는 활용된다. 이러한 형광 전사 기자는 기본적으로 스트레스 반응의 일부인 특정 유전자의 전사 유도에 기초한다. 예를 들어, HSP-4는 인간 보호자 HSPA5/BiP에 대한 열 충격 단백질 정형고체로, ER 스트레스시 활성화되고 스트레스를 완화하기 위해 ER에 국소화됩니다. ER 스트레스(예를 들어, tunicamycin에 대한 노출)의 조건에서, hsp-4 프로모터의 조절하에 놓인 녹색 형광 단백질(GFP)은,선충7의대입자 유동 세포학을 사용하여 형광 현미경 또는 정량적으로 측정될 수 있는 바와 같이 높은 수준으로 합성된다. 유사하게, 미토콘드리아 샤페론의 프로모터, hsp-6(포유류 HSPA9에 직교), UPRMT8의활성화를 모니터링하는 데 이용되고, 세포질 샤페론 hsp-16.2의 프로모터는 HSR9의활성을 평가하는데 사용된다. 이 리포터는 다양한 섭동에 대한 응답으로 활성화 된 경로의 신속한 특성화를 허용합니다.

종종 여기에 제시 된 기자는 스트레스 반응의 활성화의 질적 인 출력을 제공하는 현미경 검사를 사용하여 이미지화됩니다. 그러나 이미징 기술은 위에서 설명한 기자의 강도와 조직 위치에 대한 정보를 모두 제공하지만 정량화가 항상 정확하거나 견고한 것은 아닙니다. 이미징 분석 도구를 사용하여 형광 활성화를 정량화할 수 있지만, 이러한 방법은 상대적으로 처리량이 낮고 샘플 크기가 작으며, 이는 상대적으로 적은 수의 동물이 이미지화되기 때문이다. 다량의 동물을 쉽게 얻을 수있는 능력은 C. elegans가 큰 입자 유동 세포계를 사용하여 형광 응력 리포터의 활성화를 분석하는 이상적인 모델 시스템입니다. 큰 입자 유동 세포계는 많은 살아있는 동물의 크기와 형광에 따라 기록, 분석 및 분류 할 수 있습니다. 이 방법을 사용하면 수천 개의 웜에 대한 형광 강도, 크기 및 공간(2D) 정보를 얻을 수 있습니다. 이 시스템은 FlowPilot을 사용하여 제어되며, 이를 통해 측정된 파라미터를 실시간으로 데이터 수집 및 분석할 수 있습니다. 여기서, 대입자 유동 세포계를 이용한 현미경 이미징 및 정량분석 방법 모두 응력 반응의 활성화를 측정하는 방법으로 제안된다.

리포터 분석 외에도 동물의 스트레스에 대한 민감도 또는 저항성을 생리적 스트레스 분석법으로 측정할 수 있습니다. 이것은 특정 세포 스트레스 경로를 활성화 스트레스 환경에 동물을 노출하여 달성된다. 여기서, 특정 유형의 스트레스에 대한 전체 동물의 민감도를 측정하기 위한 몇 가지 방법이 제공된다.

ER 응력은 N-연결된 글리코실화를 차단하는 화학 약제인 튜니카마이신을 사용하여 C. elegans에 가해져 ER10에서잘못 접힌 단백질이 축적됩니다. C. 예쁜꼬마선충에서튜니카마이신에 노출되면 성장하면 ER 기능의 주요 섭동이 발생하며 수명이 현저히 감소하여수명이 11로크게 감소합니다. 튜니카마이신 함유 플레이트에서 동물의 생존을 측정함으로써, 동물의 ER 응력 민감도를 정량화할 수 있다. 예를 들어, 이후성 UPRER 유도를 가진 동물은 ER에서 단백질 오폴딩 스트레스에 대한 내성을 증가시켜 야생형동물(12)에비해 튜니카마이신 노출 시 생존율이 증가한다.

산화 및 미토콘드리아 스트레스는 동물을 화학 약제인 파라쿼트에 노출시킴으로써 C. 예쁜꼬마선충에 가된다. 파라쿼트(Paraquat)는 일반적으로 사용되는 제초제로서, 특히 미토콘드리아13에서과산화물 형성을 일으킨다. 미토콘드리아 유래 반응성 산소 종(ROS)의 특이적 국소화로 인해 파라쿼트 분석제는 종종 "미토콘드리아" 스트레스 분석법으로 사용됩니다. 그러나, 과산화물은 미토콘드리아 수퍼옥사이드 디스뮤타제(SODs)14에의해 과산화수소로 급속히 전환된다. 과산화수소는 이후에 미토콘드리아에서 확산되어 세포의 다른 구획에서 산화 스트레스를 유발할 수 있습니다. 따라서, 우리는 미토콘드리아 및 산화 스트레스 둘 다에 대한 감수성을 측정하는 것으로 파라쿼트 생존 분석을 설명한다(다른 산화 스트레스측정제는 15).

열내성 검사들은 동물을 높은 온도에 두어 C. 예쁜꼬마선충에서 수행됩니다. 선충에 대한 주변 온도는 ~ 15-20 °C이며 열 응력은 25 °C16,,17이상의 온도에서 유도됩니다. 열내성 측정은 일반적으로 동물이 이 온도에서 중요한 세포 결함을 나타내기 때문에 30-37 °C에 이르는 온도에서 수행되며, 생존 측정은 24 시간16,,18이내에 완료됩니다. 여기서, 열내성 검사를 수행하기 위한 두 가지 대체 방법이 제공된다: 34°C에서의 성장 및 37°C에서의 성장. 함께, 여기에 제시된 프로토콜은 RNA 간섭 또는 화학 약물 라이브러리를 사용하여 표준 유전자 노크다운과 결합될 때 대규모 스크린을 수행하기 위해 이용될 수 있다.

프로토콜은 4 개의 넓은 절차로 나눌 수 있습니다- C. elegans의 성장 및 화상 진찰을 위한 준비 (단면도 1 및 2), 형광 현미경 검사법을 사용하여 전사 기자의 화상 진찰 (섹션 3-5), 큰 입자 유량 세포측계를 사용하여 기자의 정량적인 측정 (섹션 6), 및 C. elegans에 있는 긴장 감도를 측정하기 위하여 생리학적 분석 (단면도 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 온도 및 OP50 대 HT115의 표준 성장 조건

  1. 표준 성장 및 확장
    1. LB(표 1)에서OP50의 배양물을 성장시키고 주변 온도(~22-25°C)에서 24-48시간 동안 이에 상응하는 매체를 선택한다. OP50은 우라실 보조트로프로서 실온에서 박테리아를 성장시키고 37°C에서 재배할 때 역류제(예를 들어, 억제기 돌연변이체)의 발생률이 더 높다. OP50 배양물의 장기 보관은 권장되지 않습니다(최대 1주~4°C).
    2. 포화 OP50 배양액의 ~100-200 μL을 60 mm NGM 플레이트 상에 종자(표1)에하여 웜의 유지및 포화 OP50 배양물의 1 mL을 실험을 위해 동물을 팽창시키기 위한 100 mm 플레이트 상에.
    3. 접시를 벤치탑에서 밤새 말리게 합니다.
      참고: 100mm 플레이트는 특히 통풍이 되지 않는 플레이트를 사용하는 경우 건조하는 데 더 많은 시간이 필요할 수 있습니다. 모든 C. 예쁜꼬마선충 플레이트를 4°C에 보관된 밀폐 용기에 보관하십시오. 플레이트의 건조가 발생하기 때문에 6 개월 이상 된 판을 사용하지 마십시오, 이는 다른 삼투압과 플레이트의 강성으로 인해 플레이트에 동물 생리학을 변경합니다.
    4. 표준 유지 보수를 위해, 10-15 어린 동물 (계란, L1, 또는 L2 단계)을 60mm 판상에 옮기지만, 돌연변이 또는 형질전환 동물을 처리하는 경우 더 많이 움직일 수 있습니다. 발달 또는 배분 결함이있는 동물의 경우, 주식의 손실을 방지하기 위해 동물의 더 가변 풀을 청크. 15 °C에서 보관하는 경우, 매주 동물을 이동; 20 °C의 경우 3-4 일마다 동물을 움직이게하십시오.
    5. 25-30개의 구절마다 동물의 신선한 해동을 수행합니다(동물이 일주일에 한 번 이동하고 15°C에서 보관하는 경우~ 6개월).
    6. 확장을 위해 확장을 위해 100mm 플레이트에 전체 60mm 플레이트를 청크하십시오. 참조의 프레임으로서, 야생형 배변을 가진 동물은 4ths-6ths로 완전히 60 mm 플레이트를 절단하고 2일 동안 20°C 또는 15°C에서 큰 판상에 청크하여 3일 동안 기아에 도달하지 않고 전체 100 mm 플레이트를 생성할 수 있다.

2. 표백을 사용하여 벌레의 준비 / 동기화

  1. 웜을 동기화하는 표백 프로토콜
    1. M9(표 1)을사용하여 한천 접시에서 gravid 벌레 (계란이 가득한 성인)를 씻으하십시오. 유의미한 유전 적 드리프트가 표백을 통해 동기화의 연속적인 라운드에 발생할 수 있기 때문에, 실험표백제에 벌레 (즉, 1.1.6 단계에서 청크 웜)의 비 동기화 인구에서 시작합니다.
    2. 유리 파이펫을 사용하여 웜/M9 혼합물을 15 mL 원점 튜브로 옮기십시오. 여러 개의 웜 플레이트를 단일 15 mL 원엽 튜브로 수집할 수 있습니다.
    3. 1,000 x g에서30 s에 대 한 아래로 동물을 스핀. 흡인 M9 상급. 오염의 엄청난 양 또는 박테리아의 큰 덩어리가 없는 한 잔여 박테리아를 씻어 필요가. 이 경우 M9로 여러 번 세서를 수행합니다.
    4. 표백 용액의 신선한 주식을 준비합니다(표 1). 표백 용액은 4 °C에서 며칠 동안 보관 할 수 있지만 비효율적인 표백으로 갓 만든 표백 용액을 사용하면 표백이 고르지 않게 되어 모든 웜 시체를 제거하기 전에 계란에 손상을 입힐 수 있습니다.
    5. 동물에게 표백 용액 2-10 mL을 추가하십시오 (동물 펠릿의 ~ 0.1 mL마다 표백액 1 mL). ~ 5 분 동안 표백제와 웜 혼합물을 반전하십시오 (10 분을 초과하지 마십시오. 표백 시간은 다를 수 있으며 각 실험실에 대해 특별히 적정해야합니다). 웜 시체를 더 빨리 녹이고 계란을 최적으로 보존하기 위해 힘차게 흔들어 줍니다. 주기적으로 해부 현미경의 밑에 보거나 성숙한 벌레 시체가 완전히 용해되고 계란만 관에 남아 있을 때 관찰하기 위하여 빛에 원엽 관을 두십시오.
    6. 30 s에 대 한 1,000 x g에서 회전 하 여 계란을 펠 트 다음 상한을 흡인. 계란은 무결성을 방해하지 않고 벌레보다 빠르게 원심 분리할 수 있으므로 원심 분리 속도를 확신할 수 없는 경우 생리학에 영향을 주지 않고 최대 2,500 x g에서 계란을 분사할 수 있습니다.
    7. M9을 최대 15 mL까지 추가하고 튜브를 뒤집어 알을 치웁히 치웁습니다.
    8. 2.1.6-2.1.7(세척/펠릿 공정) 2-3번 반복하여 표백제를 제거합니다.
    9. 파이펫 계란 /M9 플레이트에 혼합하고 실험을 위해 15-20 °C에서 성장. 사용할 벌레 수를 측정하려면 한천 접시 또는 슬라이드에 5 μL의 달걀 혼합물을 파이펫팅하고 달걀 수를 5로 나누어 부피 1 μL당 계란 수를 결정하여 대략적인 계란 수를 수행합니다. 3개의 독립적인 카운트를 평균화할 경우 정확도가 향상될 수 있습니다. 기아를 피하기 위해 접시당 권장 계란 수표를 표 2에서확인할 수 있습니다.
    10. 필요한 경우, L1은 최대 24시간 동안 20°C의 회전자에 달걀/M9 혼합물을 배치하여 보다 엄격한 시간 동기화를 위해 동물을 체포합니다. 야생형 동물의 경우, L1이 최대 48시간 동안 체포될 때 동물 생리학의 결함이 발견되지 않았습니다. 그러나, 기아에 민감한 돌연변이(예를 들어, 리소좀 또는 자가포식 돌연변이체)는 L1 검거와 매우 저조한 일을 하며, 따라서 기아에 민감한 것으로 알려진 돌연변이에 대해 이 동기화 방법을 수행하지 않는 것이 좋습니다. L1을 체포할 수 없는 동물에 대해 더 엄격한 동기화가 필요한 경우 섹션 2.2에 설명된 계란 낳는 방법을 사용합니다.
  2. 웜 동기화를 위한 계란 누워 프로토콜
    참고 : 표백에 대한 대체 방법으로 계란 누워 분석법을 수행 할 수 있습니다. 계란 누워 는 동물의 표백이 성인 동물의 계란 주머니 내의 계란이 8-12 시간 간격으로 다를 수 있기 때문에 충분히 충분한 동기화를 제공하지 않을 때 사용됩니다. 동물이 가능한 한 밀접하게 준비하는 것이 중요하지만 L1 체포가 불가능한 실험 패러다임의 경우 (예 : 기아 돌연변이체에서) 계란 누워 실험이 권장됩니다. 그러나, 계란 누워 프로토콜에 관련 된 노동으로 인해, 그것은 높은 규모의 실험을 수행 하는 것이 덜 가능 하다는 점에 유의 해야 한다.
    1. 4-12그라비드 성인(2.2.2단계 후 참고 참조)을 표준 OP50 또는 HT115 시드 NGM 플레이트에 놓습니다(세균 균주에 대한 권장 사항은 위의 섹션 1 참조). 실험 의 규모에 따라 여러 플레이트를 사용할 수 있습니다. 2.2단계에 대해 각 접시에 얼마나 많은 동물이 있는지 주의 깊게 문서화하십시오.
    2. 동물을 실험용(15-20°C)에서 4-8시간 동안 원하는 온도로 놓습니다.
      참고 : 동물이 접시에 남아있는 시간의 수는 첫 번째 계란이 놓여 있고 마지막 계란이 얼마나 밀접하게 동기화되는지 결정하므로 필요에 따라 타이밍을 조정할 수 있습니다. 배양 시간이 짧기 때문에 각 동물은 알을 낳을 시간이 적기 때문에 충분한 알을 낳을 수 있도록 접시에 더 많은 동물을 배치해야합니다. 실제 계란 누워 속도 는 계란 누워의 정상화 속도 보다는 계란 누워의 짧은 버스트를 통해 이동 하는 동물의 경향으로 인해 완전히 정상화 되지 않습니다 하는 동안, 동물 당 누워 계란의 평균 속도 ~5 계란/시간 야생 형 fecundity를 전시 하는 동물에 대 한 추정될 수 있다19. 1일째 성인 단계로 동물을 키우려고 할 때, 기아를 피하기 위해 접시당 100개의 달걀을 가지고 있는 달걀을 낳는 시간(플레이트당 권장 동물에 대한 자세한 내용은 표 2 참조).
    3. 접시에서 성인용 동물을 제거합니다. 동물이 계속해서 알을 낳고 비동기화 된 인구 및 / 또는 접시의 기아를 초래하기 때문에 모든 성인 동물이 접시에서 제거되었는지 확인하십시오.

3. 전사 기자의 이미징을위한 웜의 성장 조건

  1. 벌레의 성장
    1. HT115 의 박테리아 배양을 접종 pL4440 RNAi 플라스미드 (EV) 및 / 또는 LB 미디어에 원하는 대상 유전자에 대해 RNAi 카세트를 운반 100 μg / mL 카베니실린 과 20 μg / mL 테트라 사이클린.
    2. 밤새 배양을 성장 (~16 시간) 흔들어 37°C 인큐베이터에서 포화.
    3. 포화 세균 배양 200 μL과 포화 세균 배양 1,000 μL의 100 mm NGM RNAi 플레이트를 가진 자리 60 mm NGM RNAi 접시. 주변 온도 (~ 22 °C)에서 밤새 건조시키십시오 (알루미늄 호일로 느슨하게 덮여 있음).
    4. 형광 리포터를 운반하는 형질전환 벌레의 동기화된 집단을 NGM RNAi 플레이트에 배치하여 박테리아를 선택했습니다. Table 3
    5. 아래에 설명된 대로 특정 리포터에 필요한 단계로 15-20°C에서 성장합니다.
  2. 실험에 대한 웜 준비에 대한 고려 사항
    1. L4 동물을 필요로 하는 실험을 제외하고 성인의 첫날에 전사 기자에 대한 실험을 수행합니다. WormAtlas에 따르면, L4 동물은 계란 단계(www.wormatlas.org)에서20 °C에서 성장의 약 2.5 일 (~ 56 시간)를 수득된다.
    2. "성인 1일째"의 경우, 계란도금 후 20°C에서 약 3-4일(~65-96시간)에 동물을 사용하십시오.
      참고 :이 넓은 범위는 다음과 같이 설명된다 : 20 ° C에서 ~ 65 h는 동물이 진정한 "성년"상태인 "계란 누워"에 도달 할 때입니다. 96 h는 동물이 WormAtlas가 "계란 누워 최대"로 묘사하는 것을 입력 할 때이며, 성인이 중력 성인이고 전체 계란 낭이있는 경우입니다. 이것은 동물이 1 일 보다 더 오래 된 것으로 설명 될 것 이다 하 고 차이 표시 하기 시작할 수 있습니다., 따라서 여기에 설명 된 프로토콜은 모두 이 "1 일" 단계에서 시작 하는 것이 좋습니다 65 h와 늦게 96 시간. 여기에 기술된 실험의 경우, 이 ~65-96h 윈도우에서 동물을 사용할 때 주요 차이점은 관찰되지 않았다.
    3. 단일 실험의 복제의 경우, 보다 강력한 재현성을 위해 유사한 시간 포인트를 사용합니다(예: 계란 도금 후 ~65h 또는 ~96h에서 모든 실험을 수행).
      참고: 일부 형질전환 동물과 돌연변이는 성장 속도가 느려진 것을 나타냅니다. 이를 위해 두 가지 권장 사항이 있습니다. 1) 실험이 동시에 수행되기 위해 동물을 다른 시간에 표백 할 수있는 엇갈린 동기화를 사용합니다. 이는 분석의 기술적 변동성이 동기화 분석에서 발생할 수 있는 기술적 변동성보다 클 수 있는 경우에 권장됩니다(예를 들어, 생존 분석, 이는 장기간 실행되는 동시에 수행되지 않으면 고통받을 수 있음). 2) 동물이 동시에 표백 될 수 있지만 분석 자체는 다른 시간에 수행되는 비틀거리는 분석을 사용합니다. 이것은 내재된 가변성이 없는 매우 간단한 분석은 (예를 들면, 응력 반응의 RNAi 유도)를 위해 추천됩니다.

4. 스트레스 반응 유도

  1. HSP-4p 사용::GFP를 UPRER 활성화를 위한 판독으로 사용
    1. RNAi를 사용하여 ER 스트레스 유도
      1. NGM RNAi 플레이트에 관심 있는 유전자를 표적으로 하는 RNAi 박테리아로 발견된 플레이트를 준비(표 1)섹션 3에서와 같이. 기저 UPRER 수준 및 태그-335의 RNAi 녹다운에 대한 대조군으로 EV를 사용하십시오 (ER 상주 단백질의 N 연동 글리코실화를위한 효소; RNAi 녹다운은 TUNICamycin 처리에 유사한 효력이 있습니다) ER 스트레스하에서 UPRER의 활성화를 위한 긍정적인 통제로.
      2. hsp-4p::GFP 리포터 동물은 섹션 2에 설명된 방법을 사용하여 동물을 동기화합니다.
      3. 접시 계란을 RNAi 접시에 표 2에서권장 하는 기준을 사용 하 여.
      4. 20°C에서 약 3-4일 동안 계란을 배양(~65-96시간)하여 성인기 1일째에 실험을 수행하였다. UPRER 실험의 경우, hsp-4:GFP 리포터의 기저 형광에 차이가 있다. 따라서, 20°C에서 모든 실험을 수행한다.
    2. 화학 약제를 사용하여 ER 응력 유도
      1. hsp-4p::GFP 리포터 동물은 섹션 2에 기재된 방법을 사용하여 동물이 L4 단계에 도달할 때까지 20°C에서 자랍니다. 동물을 M9 튜브로 옮김을 옮김으로 옮김. 벌레가 정착할 수 있도록(중력에 의해 ~ 2-3분 또는 1,000 x g에서30초 회전) M9을 제거합니다.
      2. M9에서 튜니카마이신을 25 ng/mL로 희석합니다(1 mg/mL 스톡에서 1:40 희석). 컨트롤로서 M9의 DMSO와 동등한 부피를 희석합니다.
      3. 웜에 25 ng/mL 튜니카마이신/M9 또는 제어 DMSO/M9 용액을 추가합니다(1.5mL 튜브의 경우 400-500 mL, 15mL 원추형 튜브의 경우 2mL 사용). 3-4 시간 동안 회전 플랫폼에서 20 °C에서 배양하십시오.
        참고 : 튜니 카마이신은 웜 / M9 믹스로 직접 희석 할 수 있습니다.
      4. 웜이 정착하고, M9/TM 용액을 제거하고, M9 1mL로 세척할 수 있도록 합니다.
      5. 동물을 NGM 플레이트 또는 NGM RNAi 플레이트로 옮기고 형광 현미경 검사법을 수행하기 전에 밤새 (또는 ~ 15-20 h) 성인의 1일째에 도달할 수 있도록 합니다(섹션 5). GFP의 검출 가능한 수준이 누적될 수 있도록 하룻밤 복구가 수행됩니다.
      6. 또는, hsp-4p::GFPL4 동물을 16-24시간 동안 25 ng/μL 튜니카마이신을 함유하는 한천 플레이트로 이동시킴으로써 유도한다. 이것은 hsp-4p::GFP의 훨씬 더 강력한 유도를 가지고 있기 때문에 스트레스의 긴 기간, 따라서 동적 범위는 위에서 설명한 분석보다 훨씬 낮습니다.
  2. HSP-6p 사용::GFP를 UPRMT 활성화를 위한 판독으로 사용
    1. RNAi를 사용하여 미토콘드리아 스트레스를 유도
      1. COX-5b/cco-1과 같은 미토콘드리아 유전자의 RNAi 녹다운을 사용하는 것을 제외하고 섹션 4.1.1과 동일한 프로토콜에 따라 UPRMT를 활성화하십시오 (시토크롬 c 옥시다아제 소단위 5B; 녹다운은 전자 수송 사슬 활동을 억제합니다). 전자 수송 사슬 기능의 교란을 통한 UPRMT 활성화를 위해 RNAi 녹다운은 초기 개발20동안 수행되어야 합니다. 따라서 이러한 실험에 대해 해치로부터 RNAi를 수행합니다.
    2. 화학 약제를 사용하여 미토콘드리아 스트레스를 유도
      1. 섹션 3에서와 같이 관심 있는 유전자를 표적으로 하는 RNAi 박테리아로 발견된 플레이트를 준비합니다. RNAi 녹다운을 포함하지 않는 실험에서도 HT115 박테리아를 사용하십시오 (섹션 1 참조). NGM RNAi 플레이트(또는 NGM RNAi + DMSO0.2) 및 NGM RNAi + 항마이신 A플레이트(표 1)가모두 4.2.2.5 단계에 대해 제조되었는지 확인합니다.
      2. hsp-6p 동기화::GFP 또는 hsp-60p::GFP 리포터 동물 섹션 2에 설명된 방법을 사용 하 여.
      3. 접시 계란을 종자 접시에 따라 선택한 기준을 사용하여 표 2에서권장합니다. 항마이신 A가 DMSO에 용해되기 때문에, NGM RNAi + DMSO0.2 플레이트에서 동물을 해치로부터 성장시다.
      4. 20°C에서 2일(~56시간)에 계란을 L4 단계로 배양한다. 또는, 동물을 15°C에서 3일 동안(~75시간) 대신 성장시다.
      5. NGM RNAi + DMSO0.2 플레이트에서 NGM RNAi + 안티마이신 A 플레이트 또는 NGM RNAi + DMSO0.2 플레이트를 대조군으로 이동시다. 웜은 소규모 실험을 위해 선택으로 수동으로 이동할 수 있지만 대규모 실험의 경우 동물을 M9로 세척하고 원심 분리로 정착한 다음 NGM RNAi + 항마이신 A 플레이트에 도금을 하는 것이 좋습니다.
      6. 추가 ~20 시간 동안 벌레를 배양하고 1 일째 성인 (섹션 5)에서 이미지를 배양하십시오.
  3. gst-4p를 사용 하 여::GFP 산화 스트레스 응답에 대 한 판독으로.
    1. RNAi를 사용하여 OxSR 유도
      1. 대안적으로, gst-4p::GFP를 사용하여 wdr-23의 RNAi-knockdown (skn-1의음성 조절자를 인코딩한다. 따라서, 그 녹다운은 섹션 4.1.1에 기술된 프로토콜을 사용하여 OxSR을 유도한다).
    2. 화학 산화제 테르트 부틸 하이드로 과산화물에 노출을 사용하여 OxSR을 유도 (TBHP)
      1. 섹션 3에서와 같이 관심 있는 유전자를 표적으로 하는 RNAi 박테리아로 발견된 플레이트를 준비합니다. RNAi 녹다운을 포함하지 않는 실험에서도 HT115 박테리아를 사용하십시오 (섹션 1 참조).
      2. gst-4p::GFP 리포터 동물 섹션 2에 설명된 방법을 사용 하 여 동기화 합니다.
      3. 접시 계란을 종자 접시에 따라 선택한 기준을 사용하여 표 2에서권장합니다. 약물 치료 프로토콜로 인해 동물의 >10-20%가 손실되기 때문에 필요 이상으로 많은 플레이트를 준비해야 합니다. 이미징을 위해 >100 동물로 시작하고 분류하기 위해 >1,000 동물로 시작하십시오.
      4. 20°C에서 2일(~56시간)에 계란을 L4 단계로 배양한다. 또는, 동물을 15°C에서 3일 동안(~75시간) 대신 성장시다.
      5. L4 동물을 접시에서 씻어 내고 조건당 2 개의 15 mL 원엽 튜브로 나눕습니다. 적어도 1 mL까지 흡인 볼륨과 갓 만든 2mM TBHP의 동일한 볼륨을 추가합니다. 낮은 부피가 회전 할 때 웜의 중요한 죽음을 일으킬 수 있으므로, 적어도 2 mL에 총 액체 볼륨을 사용합니다. 약물 치료 전에 세척하지 마십시오, 접시에서 잔류 박테리아는 배양 하는 동안 과잉 하지 웜을 보장 하는 데 도움이 될 것입니다.
      6. 20°C에서 4시간 동안 회전자 상에 벌레를 배양한다.
      7. 1,000 x g에서회전하여 웜을 세척하고 M9 + TBHP 믹스를 흡입하고 M9의 15 mL로 교체하십시오. 두 번째 세척을 위해 반복합니다.
      8. EV RNAi에 플레이트 웜은 20°C에서 하룻밤(~16-24시간)을 회복한다. 웜은 선택의 RNAi 일치에 복구 할 수 있지만, EV RNAi에서 복구 할 때 중요한 차이가 보이지 않았다, 그래서이 실험 설정의 용이성을 위해 수행 할 수 있습니다. 회복 후 성인 1일째의 이미지를 찍습니다.
        참고: 감지 가능한 수준의 GFP가 누적될 수 있도록 야간 복구가 수행됩니다. 이 복구가 없으면 감지 가능한 GFP 신호가 없습니다. 단기 회복이 필요한 경우, 4.3.3항에 기재된 분석기를 사용할 수 있다.
    3. 화학 산화 파라쿼트 (PQ)에 노출을 사용하여 OxSR을 유도
      1. 섹션 4.2.2의 모든 단계를 반복하여 조건당 15 mL 원엽 튜브에서 L4 gst-4p::GFP 동물을 2회 배치합니다.
      2. 적어도 1 mL까지 흡인 부피를 추가하고 갓 만든 100 μM PQ의 동일한 볼륨을 추가합니다. 4.3.2.5와 유사하게 최소 2mL의 부피를 권장합니다.
      3. 20°C에서 2시간 동안 회전자 상에 벌레를 배양한다.
      4. 1,000 x g에서회전하여 웜을 세척하고 M9 + PQ 믹스를 흡인하고 M9의 15 mL로 교체하십시오. 두 번째 세척을 위해 반복합니다.
      5. EV RNAi의 플레이트 웜은 20°C에서 2시간 동안 회복한 다음, 회복 직후 이미지를 촬영한다.
        참고 : 2 시간의 회복은 GFP 유도를 시각화하는 데 필요한 최소한의 회복이었습니다.
  4. HSP-16.2p:::GFP 및 hsp-70p::GFP를 HSR 활성화를 위한 판독으로 사용.
    1. 높은 온도에 노출을 사용하여 HSR 유도
      1. 섹션 3에서와 같이 관심 있는 유전자를 표적으로 하는 RNAi 박테리아로 발견된 플레이트를 준비합니다. RNAi 녹다운을 포함하지 않는 실험에서도 HT115 박테리아를 사용하십시오 (소개 참조).
      2. hsp-16.2p::GFP 또는 hsp-70p::GFP 리포터 동물 섹션 2에 설명된 방법을 사용 하 여.
      3. 접시 계란을 종자 접시에 따라 선택한 기준을 사용하여 표 2에서권장합니다. 샘플의 절반이 열 충격 유도를 위해 높은 온도에 노출될 때 필요한 플레이트 수를 2배 준비해야 하며, 나머지 절반은 비열 충격 제어역할을 합니다.
      4. 20°C에서 약 3-4일 동안 계란을 배양(~65-96시간)하여 성인기 1일째에 실험을 수행하였다. 열 충격 실험을 위해 15 °C에서 벌레를 성장시키지 마십시오.
      5. 동물의 실험 그룹을 34°C 인큐베이터로 이동하여 2 시간 동안 플레이트를 단일 층(즉, 플레이트 스태킹 없음)으로 인큐베이터에 배치하여 플레이트 전반에 걸쳐 가장 빠르고 가장 균등한 열 분포를 보장합니다.
      6. 열 충격을 받은 동물을 20°C 인큐베이터로 옮겨 2시간 동안 회복한 다음 즉시 이미지화합니다(섹션 5 참조). 더 높은 GFP 유도를 위해 필요한 경우 동물을 더 오래 회복할 수 있습니다.
        참고 : 2 시간의 회복은 GFP 유도를 시각화하는 데 필요한 최소한의 회복이었습니다.

5. 스테레오 현미경 또는 저배율 광시야 /화합물 현미경을 사용하여 이미징

  1. 형광 현미경 검사법에 대한 벌레의 준비
    1. 표준 NGM 플레이트 위에 100 mM 나트륨 아지드의 피펫 5-10 μL (즉, 박테리아 없음).
      참고: 아지드 나트륨 농도는 10 mMM까지 낮아질 수 있지만, 가장 강력한 고정화는 형광 신호에 대한 검출 가능한 영향없이 100 mM 나트륨 아지드에서 관찰되었습니다.
    2. 해부 현미경으로 실험 판에서 10-20 마리의 동물을 선택하고 아지드 나트륨 자리로 옮김을 옮김하십시오. 동물은 아지드 나트륨에 착륙 한 직후 이동을 중단해야하며, 아지드 나트륨 자체는 몇 초 이내에 증발합니다.
    3. 나트륨 아지드가 증발하면, 원하는 이미징 설정에 동물을 줄. 모든 동물에 대해 동일한 방향으로 전방 및 후방 측면으로 동물을 나란히 이동합니다. 이미지 동물즉시.
      참고: 나트륨 아지드에서 마비된 후 최대 15분 동안 표 3의 전사 리포터에 대해 리포터 신호의 변화가 관찰되지 않았다.
  2. 입체 현미경을 사용한 이미지 수집
    참고: 이 프로토콜의 경우 라이카 DFC3000G 단색 CCD 카메라, 표준 라이카 GFP 필터(예: 395-455, EM 480 LP) 및 LAS X 소프트웨어가 장착된 라이카 M205FA 현미경이 사용되었습니다. 노출 시간에 대한 권장 설정은 표 4에서찾을 수 있습니다.
    1. LAS X 프로그램을 시작합니다.
    2. 새 프로젝트 시작: 획득 탭을 열고 프로젝트 열기를 클릭하고 폴더를 클릭하여 새 프로젝트를 엽니다. 이 프로젝트의 이름을 마우스 오른쪽 단추로 클릭하고 아래로 스크롤하여 이름을 바꾸거나 F2를클릭하여 이름을 바꿀 수 있습니다. 수집 탭에는 노출 시간을 조정하고 원하는 설정으로 확대할 수 있는 옵션도 있습니다.
    3. 현미경 목표 아래에 웜 샘플을 배치하고 형광 표백을 최소화하기 위해 밝은 필드 설정을 사용하여 웜의 올바른 초점을 찾습니다. 샘플의 중심은 계란의 라인이 명확하게 볼 수 있고 흐릿하지 않은 곳입니다. 노출 시간, 확대/축소, 초점 및 밝은 필드 응축기를 원하는 설정으로 설정합니다.
    4. 이미지 캡처 단추를 사용하여 이미지를 수집합니다.
    5. 모든 원시 이미지와 메타데이터를 저장하기 때문에 .lif(라이카 이미지 파일) 형식으로 이미지를 저장합니다. 이미지(또는 프로젝트)를 마우스 오른쪽 단추로 클릭하여 TIFF를 내보낼 수도 있고 옵션으로 저장 에서 TIFF를클릭합니다. 이렇게 하면 모든 채널(예: 밝은 필드 및 GFP)이 모든 수정 사항(예: 대비가 조정된 경우 TIFF에 저장됨)을 저장합니다.
  3. 형광 이미지의 정량적 분석
    1. 정량적 분석이 수행될 경우 3D 이미지를 가져가 십시오. 이 옵션은 오른쪽 상단에 "z"로 레이블이 지정된 z-섹션 옵션을 클릭하여 수행됩니다. 이 상자가 빨간색이면 Z 섹션이 활성화됩니다.
    2. 조정 가능한 옵션의 왼쪽 하단에 있는 범위와 슬라이스 두께를 선택하여 z 단면을 최적화합니다. 가능하면 최적의 설정을 위해 시스템 최적화 버튼을 사용하십시오.
    3. 5.2절에 설명된 대로 이미지를 캡처하고 저장합니다. 웜을 둘 사이에 공백을 두어 측정을 쉽게 할 수 있습니다.
    4. TIFF 이미지를 선택한 이미징 소프트웨어(예: ImageJ)로 가져옵니다.
    5. ImageJ의 경우 분석 메뉴에서 측정 설정 을 선택합니다. 다음을 확인합니다: 면적, 평균 회색 값, 통합 밀도, 디스플레이 레이블.
    6. ROI(관심 지역) 도구를 사용하여 ROI를 그립니다. 각 웜을 개별적으로 측정합니다. 분석 메뉴에서 측정값을 선택하거나 M을누릅니다. 웜이 없는 백그라운드에서 ROI를 그린 다음 동일한 방식으로 배경을 측정합니다. 결과 창에 나타나는 측정값을 복사하거나 저장합니다.
    7. 측정된 각 ROI의 통합 밀도에서 배경 통합 밀도를 뺍니다. ROI의 배경 강도는 배경의 곱이 회색 값과 그려진 ROI 영역으로 정의됩니다.
  4. 화합물/광시야 현미경을 사용한 이미지 수집
    참고 : 화합물 / 광시야 현미경을 사용하여 전사 기자의 이미징을 위해,이 프로토콜은 올림푸스 4x 계획 불소 NA 0.13 대물 렌즈, 표준 올림푸스 FITC 필터 (예 : 470 / 40; em 525 / 50)가 장착 된 회전 ECHO R4 현미경을 사용합니다. DM 560) 및 카메라및 ECHO 소프트웨어를 구동하기위한 iPad 프로. 노출 시간에 대한 권장 설정은 표 4에서찾을 수 있습니다.
    1. 터치 패드를 사용하여 제어 프로그램을 시작합니다. 새 앨범 및 파일 이름을 만듭니다.
    2. 대물 렌즈 아래에 플레이트를 배치합니다. 기준선(EV/제어 처리) 및 포지티브 컨트롤을 사용하여 노출 시간 및 형광 강도를 설정하여 신호가 표시되지만 포화되지 않도록 합니다.
    3. 밝은 필드 이미지와 GFP/FITC 이미지를 저장합니다.

6. 대입자 유동 세포계를 사용하여 기자의 정량적 측정

참고: 큰 입자 유동 세포계 분석을 위한 벌레의 성장 및 준비는 형광 화상 진찰을 위한 벌레의 준비를 위한 단면도 1-5와 같은 패러다임을 따를 수 있습니다, 동물의 더 많은 수가 요구되는 것을 제외하고는. 사용 >500 조건 당 동물, 일부 동물은 조작 하는 동안 손실, 모든 동물 정량화 하는 동안 필터링 기준을 통과 하 고 일부 동물 은 유세포계에 의해 제대로 판독 되지 않습니다. 5-10 mL의 M9 용액으로 플레이트를 15 mL 원엽 튜브로 분류하여 유동 세포계에서 후속 선별할 준비가 된 동물을 세척합니다.

  1. 큰 입자 유량 세포계를 사용하여 설정 정렬
    1. 유량 세포계를 켜기 전에
      1. 칼집 액체 병이 비어 있지 않은지 확인하십시오. 선별기를 사용하기 전에 적어도 몇 시간 전에 250x 스톡에서 시스 액체를 준비하십시오.
      2. 모든 폐기물 용기가 가득 차 있지 않은지 확인합니다.
    2. 유량 세포계 켜기
      1. 공기 압축기를 켭니다. 자동으로설정합니다. 압력 게이지를 확인 - 그것은 약 30 psi이어야한다.
      2. 악기를 켭니다. 기기 왼쪽의 전원 코드 옆에 있는 전원 스위치를 사용합니다.
      3. 레이저를 켭니다. 488 nm 광원은 일반적으로 대부분의 실험에 충분하지만 적색 형광에 대해 더 높은 여기가 필요한 경우 561 nm 광원을 사용해야 합니다.
      4. 플로우파일럿 소프트웨어 열기; 계측기는 여러 밸브에서 일련의 클릭스위칭을 해야 합니다.
      5. 시작을클릭하여 소프트웨어 창에서 레이저를 켭니다. 실행을클릭하여 아르곤 레이저 제어 팝업 창에서 레이저를 시작합니다. 이렇게 하면 레이저가 켜지고 약 12mW에 도달합니다. 488 광원 수준은 약 12까지 올라갈 것입니다.
      6. 완료를 클릭하여 창을 닫습니다.
    3. 진행하기 전에 소프트웨어 확인
      1. 압력 게이지 확인 -창 하단에 표시된 4개의 압력 값을 확인합니다. 값은 원래 설정(Sheath 5.5-5.7) 주위에 있어야 합니다. 샘플 5.7-6.0; 선별기 3.1-3.3; 청소 8.5-8.7). 비슷해 보이는 경우 압력 확인옆의 확인란을 선택합니다.
      2. 유체 검사 - 유동 셀을 통해 칼집 / 샘플의 흐름을 차단하는 기포와 파편이 없는지 확인하려면 여러 번 청소를 클릭하십시오.
      3. 칼집 유량 확인 -이를 위해 60초 동안 Off Sort덮개를 수집한 다음 수동 컨트롤에서 Sheath를 켜서 칼집의 흐름을 시작합니다. 60 s에 대 한 15 mL 튜브에 수집; 유량은 ~9-10 mL /min이어야합니다.
    4. 유량 세포계 사용 전 세척
      1. 컬렉션 '컵'에 10 % 표백제 용액의 ~ 3-5 mL을 넣고 취득을클릭합니다. ~ 30 s를 실행하자, 중단을클릭하고, 진공으로 초과를 제거합니다.
      2. 탈이온수로 컬렉션 '컵'을 헹구고 진공청소기로 제거합니다. 2x를 반복합니다.
      3. 컬렉션 '컵'에 COPAS 청소 용액의 ~ 3-5 mL을 넣고 취득을클릭합니다. ~ 30 s를 실행하자, 중단을클릭하고, 진공 과잉 청소 솔루션을 제거합니다.
      4. 탈이온수로 컬렉션 '컵'을 헹구고 진공청소기로 제거합니다. 2x를 반복합니다.
      5. 컬렉션 '컵'에 M9 용액의 ~ 3-5 mL을 넣고 취득을클릭합니다. ~ 30 s를 실행하자, 중지를클릭하고 진공 과잉 M9 용액을 제거합니다.
  2. 선별기에서 샘플 실행
    1. 관심 있는 전사 리포터의 가장 밝은 활성화를 유발하는 조건에 따라 레이저 PMT 전력 및 크기 게이팅을 조정합니다. 권장 설정은 표 4에서찾을 수 있습니다.
    2. 준비된 벌레를 '컵'에 넣습니다. 획득을 클릭합니다. 모든 액체가 기계에 들어가지 않았는지 확인하십시오. 이로 인해 유세포계가 공기에 유입되어 검출기의 기포가 생성됩니다.
    3. 샘플이 낮거나 충분한 동물이 수집되었을 때 중단을 클릭합니다.
    4. 설치를 클릭합니다 | 데이터 스토리지 | 게이트 전용. 이렇게 하면 크기 제약 조건에 따라 데이터만 저장됩니다. 게이트 저장을 클릭하고 게이트 데이터를 저장합니다. 지우기를 클릭하여 데이터를 지웁습니다.
    5. 탈이온수로 컬렉션 '컵'을 헹구고 진공청소기로 제거합니다. 2x를 반복합니다.
    6. 나머지 샘플과 함께 6.2.1-6.2.5 단계를 반복합니다.
  3. 교정/ 품질 관리 - 필요한 경우
    참고: 이를 위해서는 488 레이저를 교정하기 위해 제공된 42 μM GYR 형광 입자를 실행해야 합니다.
    1. 샘플 컵 상단의 금속 립을 눌러 공기 튜브를 제거합니다. 캡을 풀고 주사기를 사용하여 샘플 컵에서 액체를 제거합니다.
    2. 사용하기 전에 제어 입자의 병을 잘 혼합하고 샘플 컵에 몇 밀리리터를 추가합니다. 캡을 닫고 제자리에 딸깍 소리가 나을 때까지 눌러 공기를 다시 닫습니다.
    3. 소프트웨어에서 도구 옵션으로 이동하여 파티클 제어 실행을클릭합니다.
    4. 제어 파티클의 경우 PMT 값을 녹색 - 325로 재설정합니다. 노란색 - 365; 레드 - 575.
    5. 획득을 클릭합니다. 칼집은 샘플 다음에 켜야합니다. 구슬이 유동 셀을 통과하기 시작하면 화면 하단에 유량이 표시됩니다. 최적으로 유량은 5/s에서 15/s 사이여야 합니다. 유량이 너무 낮거나 0이면 샘플 밸브를 시계 방향으로 물리적으로 돌려 유량을 늘립니다. 유량이 너무 높으면 샘플 밸브를 시계 반대 방향으로 물리적으로 돌려 유량을 줄입니다.
      참고: 일반적으로 비드 세이버 모드에서는 500개의 비드가 꺼지기 전에 읽습니다. 데이터를 지우고 구슬을 다시 읽을 수 있습니다.
    6. 판독이 완료되면 CV 값뿐만 아니라 5개의 매개 변수에 대한 깨끗한 단일 피크를 확인합니다. 분산 계수(CV)는 <15%여야 합니다. 또한 세 가지 다른 형광 채널에 대한 CV 값이 서로 가까이 있는지 확인합니다.
    7. QC 검사 기록 만들기: 파일 탭 아래에서 화면 이미지로 저장을클릭합니다.
  4. 청소 및 종료
    1. 진공을 사용하여 샘플 컵에서 샘플을 제거하고 섹션 4.1.4을 반복합니다.
    2. 수집 '컵'에 탈이온 물의 ~ 3-5 mL을 넣고 획득을클릭 , ~ 30 s를 실행하자, 다음 중단을클릭합니다 . 샘플 컵에 증류수를 남겨 둡니다.
    3. 샘플 회수 컵과 폐병을 비웁습니다.
    4. 소프트웨어를 끕니다. 파일 탭에서 종료를 클릭합니다. 팝업 메뉴에서 제거 하지 않고 끄기클릭 합니다.
    5. 레이저를 끄고 기기를 끄고 공기 압축기를 끕니다. 해치를 닫아 악기를 덮습니다.

7. C. 예쁜꼬마선충의 스트레스 민감도를 측정하는 생리학적 측정

  1. 튜니카마이신 노출을 이용한 ER 응력 민감도 측정
    1. 섹션 3에서와 같이 관심 있는 유전자를 표적으로 하는 RNAi 박테리아로 발견된 NGM RNAi DMSO 플레이트를 준비합니다. RNAi 녹다운을 포함하지 않는 실험에서도 HT115 박테리아를 사용하십시오 (섹션 1 참조). 또한 NGM RNAi TM 플레이트를 시드하는 것을 기억하십시오 (표 1참조). 접시의 충분한 양을 씨앗 : NGM RNAi DMSO 플레이트 ~ 5-7 세트와 NGM RNAi TM 플레이트 ~ 2-3 세트에 대한 계획.
    2. 섹션 2에 설명된 방법을 사용하여 선택한 동물을 동기화합니다.
    3. 접시 계란을 NGM RNAi DMSO 종자 접시에 표 2에서권장하는 기준을 사용하여 선택합니다. 샘플의 절반이 NGM RNAi TM 플레이트로 이송될 때 필요한 플레이트 수를 2배 로 준비해야 합니다.
    4. 20°C에서 약 3-4일(~65-96시간)에 계란을 인큐베이션하여 성인기 1일째에 배양한다.
    5. 첫날에는 동물을 별도의 접시에 옮겨 수명을 준비하십시오. 플레이트를 보존하려면(TM 비용이 높기 때문에) 조건당 15마리의 8개의 접시를 사용하십시오. 이를 통해 점수 매기기 위해 플레이트당 관리 가능한 수의 동물을 허용하고 일부 검열을 통해도 통계 분석을 위해 충분한 양의 동물을 허용합니다.
    6. 처음 5-7 일 동안, 자손을 더 이상 볼 수 없을 때까지 새로운 접시에 매일 자손에서 멀리 성인 동물을 이동합니다. 이 단계에서, 검거된 동물을 검열하거나, 외음부 돌출부/폭발을 나타내거나, 판의 측면을 기어 오르는 것은 ER 응력 민감도와 관련된 사망이 아니기 때문에. TM 처리는 동물에서 체포를 일으키는 원인이 되고, 따라서 이 동물의 단지 1-2 이동은 TM 함유 격판덮개 생성과 관련되었던 비용을 최소화하기위하여 충분합니다 2-3 일마다. 야생형 동물은 DMSO에서 ~15-17일, 투니캄시인에서 12-14일의 평균 생존시간을 가진다.
    7. 동물이 자손 생산을 중단 한 후, 모든 동물이 죽은 또는 검열로 득점 될 때까지 매 1-2 일마다 수명을 점수. TM-치료 동물 매일 하루 동안 6-14 더 높은 해상도 대 한 성인의.
  2. 파라쿼트에 노출을 사용하여 미토콘드리아 및 산화 스트레스 민감도 측정
    1. 섹션 3에서와 같이 관심 있는 유전자를 표적으로 하는 RNAi 박테리아로 발견된 플레이트를 준비합니다. RNAi 녹다운을 포함하지 않는 실험에서도 HT115 박테리아를 사용하십시오 (소개 참조).
    2. 섹션 2에 설명된 방법을 사용하여 선택한 동물을 동기화합니다.
    3. 접시 계란을 NGM RNAi 종자 접시에 표 1에서권장하는 기준을 사용하여 선택합니다. 이 분석에서는 조건당 ~60-100마리의 동물을 요구하므로 그에 따라 준비하십시오.
    4. 20°C에서 약 3-4일(~65-96시간)에 계란을 인큐베이션하여 성인기 1일째에 배양한다.
    5. M9 용액에서 100mMMM 파라쿼트의 신선한 바이알을 준비합니다.
    6. M9+파라쿼트의 피펫 50-75 μL을 원하는 대로 평평한 바닥 96-well 플레이트의 많은 우물로 넣습니다. 일반적으로 웰당 ~8-10 마리의 동물을 포함하는 조건당 ~8-10 개의 우물을 가지는 것이 좋습니다. 이것은 균주 당 ~ 80 동물과 잘 당 동물의 쉽게 눈에 띄는 수를 허용한다.
    7. 조건당 8-10마리의 동물을 골라 M9+파라쿼트(paraquat)를 함유한 각 우물로 옮김을 옮김을 넣습니다. 피펫팅 대신 우물로 동물을 옮기기 위해 픽을 사용하여 부피의 차이와 파라쿼트 농도의 의도하지 않은 변화를 방지합니다.
    8. 모든 2 시간, 각 우물에서 동물의 죽음에 대한 점수. 접시를 부드럽게 누르면 살아있는 동물이 쓰러지거나 구부러집니다. 살아있는 동물이 죽은 것으로 득점 될 만큼 오랫동안 마비 될 수 있습니다. 따라서 살아있는 동물의 수가 이전 시점의 살아있는 동물의 수를 초과하는 경우 동물이 살아 있고 점수를 매기지 않아야 할 가능성이 높습니다 (예 : 시간 4, 2/10 동물이 죽은 것으로 점수가 매겨진 경우, 6 시에는 1/10 동물만 죽었으며 시간 4는 죽은 동물1/10마리로 다시 점수를 매겨야 합니다).
  3. 높은 온도에 노출을 사용하여 열 감도 측정
    1. 섹션 3에서와 같이 관심 있는 유전자를 표적으로 하는 RNAi 박테리아로 발견된 플레이트를 준비합니다. RNAi 녹다운을 포함하지 않는 실험에서도 HT115 박테리아를 사용하십시오 (섹션 1 참조).
    2. 섹션 2에 설명된 방법을 사용하여 선택한 동물을 동기화합니다.
    3. 접시 계란을 종자 접시에 따라 선택한 기준을 사용하여 표 1에서권장합니다. 열내성 검사에 대한 조건 당 60-100 마리의 동물을 가지고 있습니다. 열내성 분석의 경우, 분석법에서 동물의 나이에 따라 주요 가변성이 있기 때문에 L1 체포 또는 계란 누워 분석법으로 최상의 동기화를 사용하십시오.
    4. 20°C에서 동물을 약 3-4일 동안 배양(~65-96시간)하여 성인기 1일째에 실험을 수행하였다. 열 충격 실험을 위해 15 °C에서 벌레를 성장시키지 마십시오.
    5. 1일째에는 동물을 별도의 접시에 옮겨 준비합니다. 일반적으로 총 60 마리의 동물을 위해 4-6 접시가있는 접시 당 ~ 10-15 마리의 동물을 두는 것이 좋습니다. 이를 통해 점수를 매기기 위해 플레이트당 동물 수를 관리할 수 있으며, 동물이 높은 온도에서 끌어낼 수 있는 최소한의 시간을 허용합니다.
    6. 동물을 37°C 인큐베이터에 넣고 2시간마다 점수를 매기고, 5시간 전에 거의 또는 전혀 사망하지 않는 경우 37°C에서 열내성에 대한 점수를 매기기 시작합니다. 중간 열내성은 ~ 9 시간에서 수행되므로 시간 7, 9 및 11은 중요한 시간지점이지만 인큐베이터 및 실험실 간 변동성으로 인해 실험실당 적정해야 할 수도 있습니다. 더욱이, 가변성을 감소시키는 모든 방법은 도움이 될 것입니다 (예를 들어, 플레이트를 스태킹하지 않고, 단일 인큐베이터 내에서 동일한 영역에 플레이트를 배치하고, 인큐베이터가 열리거나 닫혀있는 시간을 최소화하고, 동물이 37 °C 밖에서 보내는 시간을 최소화하기 위해 한 번에 인큐베이터에서 적은 플레이트를 복용하는 등) 도움이 될 것입니다. 전체 가이드는21)을참조하십시오.
    7. 7.3.6단계에 대한 대안으로, 동물을 37°C 대신 34°C에 놓는다. 34°C에서의 평균 열내성은 14시간 이상이므로 시간점 12, 14 및 16은 34°C 열내성 검정검에 매우 중요합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

전사 리포터를 사용하여 스트레스 반응 의 활성화를 측정
여기에서, 형광 전사 기자는 C. elegans에있는 대부분의 긴장 반응의 활성화를 측정하는 강력한 공구로 봉사하는 이용됩니다. GFP 발현은 구획별 응력에 반응하는 데 관여하는 마스터 전사 조절제의 정식 표적의 프로모터에 의해 구동된다. 일반적으로 사용되는 전사 기자의 포괄적인 목록은 표 3에서확인할 수 있습니다.

전개 되거나 잘못 접힌 단백질 또는 지질 이중층 스트레스를 통해 ER 항상성을 교란하면 ER(UPRER)의전개된 단백질 반응의 활성화를 일으켜 ER 의 품질 및 기능을 회복시킨다. UPRER은 막간 센서에 의해 정의된 3개의 별개의 가지로 구성되어 있습니다: 이노시톨 요구 단백질 1 (IRE1), 전사 인자 활성화 6 (ATF6), 및 단백질 키나아제 RNA (PKR)와 같은 ER 키나아제 (PERK), 모두 C. elegans7,22,,23.22 선충에서 UPRER의 활성화를 모니터링하는 가장 일반적인 도구는, hsp-4 프로모터의 제어하에 GFP를 발현하는 전사 리포터 균주(hsp-4p::GFP)7이다.hsp-4p::GFP7 유전자 hsp-4포유류 Hsp70, HSPA5 (또는 BiP/Grp78)의 정형고를 인코딩합니다. UPRER이 활성화될 때 ER 스트레스의 경우, hsp-4p::GFP 리포터 스트레인은 GFP를 표현합니다. 이 리포터는 스트레스가 없는 상태에서 최소한의 기저 표현을 가지고 있지만, 동물이 튜니카마이신에 노출될 때 강력한 GFP 표현을나타낸다(그림 1A). 이러한 차이는 또한 큰 입자 유동 세포계(도1B)를사용하여 정량화될 수 있다. 더욱이, HSP-4p::GFP는 ER 스트레스 하에서 XBP-1의RNAi-knockdown에 의해 완전히 억제될 수 있으며, 이 전사 리포터의 활성화는 전사 인자, XBP-112에의존한다.

UPRER과유사하게, 미토콘드리아는 프로테오독성 스트레스에 대한 자체 보호 메커니즘을 가지고 있습니다. 미토콘드리아 UPR(UPRMT)24라고불리는 이 메커니즘은 주로 전사 인자, ATFS-1에 의해 조절되며, 이는 수입 효율 감소로 인해 스트레스를 받고 미토콘드리아에 진입하지 못하여, ATFS-1이핵25로진입하는 것을 초래한다. 흥미롭게도, 미토콘드리아 과정에 대한 상이한 교란은 단백질 응집, 전자 수송 사슬(ETC) 복합체 의 소단위, 미토콘드리아 DNA 복제 스트레스 및 미토콘드리아 단백질 번역8,,26을포함하는 이러한 반응을 활성화시킬 수 있다. UPRMT의 활성화는 GFP가 미토콘드리아 샤페론 유전자, hsp-6hsp-608의프로모터의 조절하에 배치된 형질전환 구조를 발현하는 웜을 사용하여 모니터링되었다. hsp-4p:::GFP 동물, hsp-6p::GFP 동물은 스트레스가 없는 상태에서 최소한의 기저 신호를 나타낸다. UPRMT를 유도하는 가장 강력한 방법은 다음과 같은 미토콘드리아 단백질의 RNAi-녹다운을 통해입니다: cox-5B,시토크롬 c 산화아제 소단위 Vb/COX4 (복합 IV)20, nuo-4,NADH 탈수소 효소 단백질 (복합체 I)27,또는 mrps-5,미토콘드리아 리보소말 단백질28, hsp-6p를 활성화::GFP 리포터. 이러한 리포터를 통한 GFP 발현은 강력하게 활성화되고 이러한 조건하에서 쉽게 시각화및 정량화될 수있다(도 2A-B). UPRMT는 또한 세포크롬 c 환원효소 (복합 III)를 억제하는 항마이신 A와 같은 전자 수송 사슬 (ETC)의 화학적 억제를 통해 트리거될 수 있습니다. ETC 성분의 RNAi-녹다운과 유사하게, 항마이신 A 치료는 hsp-6p::GFP(그림 2C-D)의강력한 유도를 일으킨다.

유기체가 산화 스트레스를 감지하고 반응하는 능력은 박테리아로부터인간에게존재하는 보존된 과정(29)이다. C. elegans에서,NRF2 homologue, SKN-1는, 단백질을 통하여 반응성 시스테인 때문에 산화환원 변경에 민감한 중요한 전사 인자 역할을 합니다. SKN-1은 NRF230에의해 결합된 항산화 반응 요소와 매우 유사한 보존된 합의 서열을 결합하여 OxSR의 전사 활성제 중 하나로 서한다. 인간에서, NRF2는 KEAP1에 의해 부정적으로 조절되며, 이는 단백질31전반에 걸쳐 반응성 시스테인으로 인해 산화환원 변화에 민감하다고 생각된다. 웜에서 KEAP1의 직접적인 직교는 없지만, SKN-1은 WD-반복 단백질인 WDR-23에 의해 부정적으로 조절되며, KEAP1/NRF2 억제32와기계적으로 구별되는 방식으로 조절된다. 테르트 부틸 하이드로퍼옥사이드(TBHP)와 같은 산화 스트레스시, SKN-1은 글루타티온 S-트랜스퍼라제인 gst-4와같은 해독 및 항산화 유전자를 활성화합니다. 산화 스트레스를 측정하기 위해, GFP 발현은 gst-4,글루타티온 S-트랜스퍼라제33의프로모터 아래에 배치된다. 여기에 제시 된 다른 전사 조절제와는 달리, gst-4p ::GFP는 높은 기저 발현을 가지고 있다. 그러나, 이 표현은 아직도 유전적으로 그리고 화학적으로 둘 다 수행될 수 있는 산화 긴장의 조건 하에서 강력하게 활성화될 수 있습니다. 유전적으로 산화 스트레스를 유도하기 위해, 우리는 SKN-134의프로테아소솜 분해에 역할을 하는 단백질을 인코딩하는 wdr-23을무너뜨립니다. wdr-23 녹다운 gst-4p의 강력한 활성화 결과::GFP. 더욱이, 화학 산화제, TBHP를 가진 벌레의 처리는, 온화한 귀착되, 그러나 아직도 중요한, gst-4p의 활성화::GFP (그림 3). GST-4p::GFP의 화학적 및 유전적 활성화는 옥스R의 마스터 전사 조절제를 코딩하는 유전자인 skn-1의RNAi 녹다운에 의해 거의 완전히 억제될 수 있다.

대부분의 세포 단백질은 세포질에서 번역되고 거기, 다른 곳에 표적으로 되기 전에 일시적으로 만 있더라도, 거기 상주합니다. 따라서, 세포질은 적당한 단백질 접기 및 기능을 승진시키는 chaperones의 다양한 배열을 호스트합니다, 뿐만 아니라 손상되, 역기능, 또는 과잉 단백질을 분해에 책임 있는 효소 및 단백질. 세포질의 이 복잡한 단백질 경관을 보호하기 위해, 세포질 응력 반응 경로는 열충격 반응(HSR)35,,36을포함하는 여러 세포질 응력 반응 경로를 진화시켰습니다. HSR은 열 스트레스 조건하에서 단백질 항상성을 촉진하는 데 전념하는 통로이며 마스터 전사 조절기인 HSF-137에의해 변조됩니다. 정상 상태 조건에서 HSF-1은 세포질 샤페론, HSP90 및 HSP70/40에 의해 구속되어 단조로움, 비활성 상태로 고정됩니다. 열 또는 유사한 스트레스의 조건에서, 잘못 접힌 단백질의 증가는 HSF-1에서 멀리 샤페론의 적정을 초래, HSR을 활성화하기 위해 핵으로 삼각및 전이 할 수 있도록38,,39. 아마도 HSR 활성화하에서 HSF-1의 가장 많이 연구된 다운스트림 표적은 HSP70, HSP90, DNAJ 및 HSP6017,40과같은 열 충격 단백질(HSP)이다., C. elegans에서,HSR에 대한 전사 기자는 정식 HSP, hsp-16.2hsp-709,,41의프로모터하에서 GFP의 발현을 구동함으로써 합성되었다. 그들의 UPRMT 및 UPRER 대응 처럼, hsp-16.2p:::GFPhsp-70p::GFP 스트레스의 부재에서 최소한의 기저 표현을 보여줍니다. 그러나, 두 기자모두 열응력조건하에서 강력하게 유도되며, 이는 현미경으로 쉽게 가시화하거나 큰 입자 유동 세포계를 사용하여 정량화될 수있다(도 4). 두 기자 는 큰 동적 범위를 가지고 있으며, 유도는 hsf-1의RNAi-녹다운이 hsp-16.2p의 유도를 완전히 억제하기 때문에 hsf-1에 완전히 의존합니다::GFP 및 hsp-70p::GFP. 이러한 리포터는 대부분의 상황에서 상호 교환적으로 사용할 수 있지만 조직 전체의 발현 수준과 발현에 차이가 있을 수 있습니다.

C. 예쁜꼬마선충의 스트레스 민감도를 측정하는 생리학적 측정
C. 예쁜꼬마선충은 RNAi를 사용하여 유지 보수 및 실험비용이 낮고 게놈 편집 또는 유전적 녹다운의 용이성으로 인해 스트레스 감도를 측정할 수 있는 훌륭한 모델 유기체로, 전체 유기체에서 대규모 실험을 수행할 수 있는 능력을 제공한다. ER 스트레스에 대한 응력 내성을 분석하기 위해, 우리는 C. 예쁜꼬마선충을 화학약제인 튜니카마이신에 노출시켜, 이는 N-연결된 글리코실화를 차단하여 ER에서 손상된 단백질의 축적을 일으킨다10. 동물은 약물이 발달 결함을 일으키기 때문에 투니카마이신 후 개발에 노출됩니다. 튜니카마이신에 노출되면 성인 벌레는 수명이 현저히 감소합니다. 더욱이, UPRER 유도에 관여하는 1차 전사 인자 중 하나를 인코딩하는 유전자의녹다운은 튜니카마이신에 대한 민감도의 현저한 증가를 초래한다(도5A)12. 따라서, 이것은 성인 벌레에 있는 ER 긴장 감도를 측정하는 강력한 분석의 역.

산화 스트레스와 미토콘드리아 스트레스를 측정하기 위해 동물을 화학 약제인 파라쿼트에 노출시다. 파라쿼트는 미토콘드리아 매트릭스 내에서 ROS의 합성에 의해 미토콘드리아 스트레스를 유발하며, 이는 과산화수소로 전환되고 미토콘드리아에서 확산되어 전세포 산화 손상을 유발할 수 있다13. ER 스트레스 측정결과와 마찬가지로, 우리는 동물을 성인기에 파라쿼트에 노출시다. 그러나, 우리는 비용 및 수동 노동을 감소시키기 위하여 액체에 있는 paraquat assays를 능력을 발휘하고 한천 격판덮개 기지를 둔 공아는 대부분의 실험실을 위해 어려울 것입니다. 여기서, 우리는 액체에서 파라쿼트에 노출된 동물이 약 5시간의 평균 생존을보여준다(도 5B). 더욱이, 인슐린 수용체의 녹다운, daf-2는,DAF-16/FOXO의 활성화로서 파라쿼트에 대한 저항성을 증가시키는 결과를 초래하며, sod-342,,43과같은 ROS의 클리어런스에 관여하는 증가된 발현을 초래한다. 파라쿼트 생존 측정법은 짧고, 최대 14시간 지속되며, 따라서 미토콘드리아 및 산화 스트레스 반응을 심문하는 효율적인 방법으로 작용한다.

마지막으로, 높은 온도에서 생존은 열 스트레스에 대한 생리적 반응을 심문하는 데 사용됩니다. 이러한 분석제는 액체 또는 고체 한천 모두에서 수행될 수 있으며,21에설명된 수많은 상이한 프로토콜이 존재한다. 이 분석에서 예외적으로 높은 가변성을 감소시키기 위하여 실험실에 있는 단 하나 분석분석판을 표준화하는 것이 좋습니다. 열내성은 표준 한천 플레이트에서 성인 1일째에 34°C 또는 37°C에서 수행되어야 합니다. 37°C에서, 죽음의 대다수는 7-11 시간 사이에서 발생합니다, 34°C에서 12-16시간 실험이 밤새 가장 쉽게 수행되는 반면, 이것은 간단한 일일 분석입니다(그림 5C-E). 유전자의 돌연변이, ttx-3은,열감각 신경 회로를 담당하는 AIY 인터뉴런의 명세서의 실패를 초래하고, 열민감성44의현저한 증가를 야기한다. 열내성 데이터는 생존 곡선으로 플롯될 수 있는 동안(그림 5C),이 분석은 적어도 4-6 번 능력을 발휘해야 하고 모든 복제는 서로에 대하여 플롯되어야 합니다(그림 5D-E),열내성은 그밖 긴장 분석과 비교하여 믿을 수 없을만큼 높은 가변성을 보여줍니다. 이는 관심 균주의 가변성, 인큐베이터에서의 공기의 불평등 한 사이클링, 고르지 않은 한천 플레이트 등21을포함하여 이러한 실험을 설정하는 데 존재하는 많은 주의 사항 때문입니다. 34°C에서, 중앙생존은 약 14시간에서 발생하며, 37°C와 유사하며, ttx-3 돌연변이체는 34°C에서 생존율이 감소하였다(도5E).

Figure 1
그림 1: HSP-4p::GFP를 UPRER 유도 기자로 사용. (A)hsp-4p의 대표적인 형광 현미경 사진::GFP는 제어 빈 벡터(EV) 또는 xbp-1 RNAi에서 자란 동물을 발현한다. 동물은 20°C에서 L4까지 RNAi에서 성장한 다음, 25 ng/μL 튜니카마이신 또는 1% DMSO를 M9에서 4시간 동안 20°C에서 부유하여 처리한 다음, 이미징 전에 20°C에서 16시간 동안 OP50 플레이트상에서 회수하였다. 동물은 NGM 한천 플레이트 상에서 100 μM 나트륨 아지드에서 마비시키고 입체 현미경을 사용하여 이미지화시켰다. (B)(A)의정량적 분석은 큰 입자 바이오소처를 사용한다. 데이터는 각 점이 단일 동물을 나타내는 전체 동물에 걸쳐 통합 형광 강도로 표시됩니다. DMSO 대조군은 회색이고 튜니카마이신 처리된 동물은 빨간색이다. 중앙선은 중앙선을 나타내고 수염은 사분면 범위를 나타냅니다. n = 균주 당 123-291 동물. p p< 0.001 비파라메트릭 Mann-휘트니 테스트를 사용. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 2
그림 2: HSP-6p::GFP를 UPRMT 유도 기자로 사용. (A) hsp-6p의 대표적인 형광 현미경 사진::GFP는 제어 빈 벡터(EV),cco-1, mrps-5,또는 누오-4 RNAi에서 자란 동물을 발현한다. 동물은 부화로부터 RNAi에서 자랐고 성인의 1일째에 20°C에서 이미지화되었다. 동물은 NGM 한천 플레이트 상에서 100 μM 나트륨 아지드에서 마비시키고 복합 현미경을 사용하여 이미지화시켰다. (B)(A)의정량적 분석은 큰 입자 바이오소처를 사용한다. 데이터는 각 점이 단일 동물을 나타내는 전체 동물에 걸쳐 통합 형광 강도로 표시됩니다. EV 대조군은 회색 RNAi 처리된 동물이 빨간색으로 되어 있다. 중앙선은 중앙선을 나타내고 수염은 사분면 범위를 나타냅니다. n = 균주 당 303-384 동물. p p< 0.001 비파라메트릭 Mann-휘트니 테스트를 사용하는 EV 제어에 비해. (c) hsp-6p::GFP 동물을 DMSO 또는 Antimycin A. 동물로 처리한 동물은 0.2% DMSO 플레이트상에서 해치로부터 재배하고 회전 ECHO R4 화합물 현미경상에서 이미징하기 전 16시간 동안 0.2% DMSO 또는 3 mM antimycin A를 함유하는 플레이트로 옮겼다. 모든 성장을 20°C에서 수행하였다. (D)(C)의정량적 분석은(B)와유사한 큰 입자 바이오소처를 사용한다. DMSO 컨트롤은 훌륭하고, 안티마이신 A-처리 동물은 빨간색입니다. n = 비파라메트릭 Mann-휘트니 테스트를 사용하는 EV 제어에 비해 DMSO의 경우 495, 안티마이신 A. *** p&0.001에 대해 219입니다.p 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 3
그림 3: Gst-4p 사용::GFP를 OxSR 의 리포터로 사용. (A)GST-4p의 대표적인 형광 현미경 사진::GFP는 제어 빈 벡터(EV), skn-1,또는 wdr-23 RNAi에서 자란 동물을 표현한다. 동물은 20°C에서 L4 단계까지 해치로부터 RNAi에서 성장하였다. 동물은 20°C에서 L4까지 RNAi에서 성장한 다음, M9에서 2 mM TBHP또는 20°C에서 "치료되지 않은" 대조군을 위해 M9만으로 처리한 후, 이미징 전에 20°C에서 16시간 동안 EV 플레이트상에서 회수하였다. 동물은 NGM 한천 플레이트 상에서 100 μM 나트륨 아지드에서 마비시키고 복합 현미경을 사용하여 이미지화시켰다. (B)(A)의정량적 분석은 큰 입자 바이오소처를 사용한다. 데이터는 각 점이 단일 동물을 나타내는 전체 동물에 걸쳐 통합 형광 강도로 표시됩니다. 처리되지 않은 통제는 회색이고 TBHP 처리한 동물은 빨간색입니다. 중앙선은 중앙선을 나타내고 수염은 사분면 범위를 나타냅니다. n = 균주 당 101-204 동물. p p< 0.001 비파라메트릭 Mann-휘트니 테스트를 사용하여 각 EV 컨트롤에 비해. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 4
그림 4: hsp16.2p 사용::GFPhsp-70p::GFP를 열 충격 응답을 위한 리포터로 사용. (A) hsp16.2p::GFP의 대표적인 형광 현미경 사진은 제어 빈 벡터(EV) 또는 hsf-1 RNAi에서 자란 동물을 발현한다. 동물은 1일째까지 20°C에서 부화로부터 RNAi에서 성장하였다. 1일째 동물은 20°C(미처리)에 방치하거나 34°C에서 2시간의 열 스트레스에 노출된 후 20°C에서 2시간 동안 회수하였다. 동물은 NGM 한천 플레이트 상에서 100 μM 나트륨 아지드에서 마비시키고 입체 현미경을 사용하여 이미지화시켰다. (B)(A)의정량적 분석은 큰 입자 바이오소처를 사용한다. 데이터는 각 점이 단일 동물을 나타내는 전체 동물에 걸쳐 통합 형광 강도로 표시됩니다. 처리되지 않은 통제는 회색이고 열 충격동물은 빨간색입니다. 중앙선은 중앙선을 나타내고 수염은 사분면 범위를 나타냅니다. n = 균주 당 320-364 동물. p p< 0.001 비파라메트릭 Mann-휘트니 테스트를 사용. (C) hsp-70p의 대표적인 형광 현미경 사진::GFP는 대조군 EV 및 hsf-1 RNAi에서 자란 동물을 발기하고(A)에기재된 바와 같이 처리하였다. (D)(B)에기재된 바와 같이(C)의정량적 분석. n = 균주 당 773-941 동물. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 5
그림 5: C. 예쁜꼬마선충의스트레스를 받는 생리생존측정결과. (A)선충의 수명은 25 ng/μl 튜니카마이신(TM) 플레이트를 함유하는 1% DMSO에서 재배됩니다. 동물은 해치로부터 1일째까지 1% DMSO 플레이트에서 재배하였고, 1일째에 각각의 TM 플레이트로 옮겼다. 동물은 20°C에서 분석의 끝까지 해치로부터 제어 빈 벡터(EV) 또는 xbp-1 RNAi에 보관하였다. 성인 동물은 자손을 더 이상 검출하지 않을 때 ~ 7-8일까지 매일 자손으로부터 수동으로 이동한 다음 모든 동물이 죽거나 검열된 것으로 기록될 때까지 2일마다 점수를 매씩 매 점수가 매어집니다. 배깅, 외음부 돌출부/폭발을 가진 동물 또는 판의 측면을 기어 다니는 동물은 검열된 것으로 간주되었습니다. (B)선충의 생존 곡선을 100 mM 파라쿼트(PQ)에서 M9 용액에 용해하였다. 동물은 20°C에서 성인의 1일째까지 해치로부터 EV 또는 daf-2 RNAi에서 성장하였다. 동물을 20°C에서 96개의 웰플레이트에 M9+ PQ 용액의 50 μL에 넣고 모든 동물이 움직이지 않는 때까지 2시간마다 시각화하였다. (C)선충의 생존 곡선은 37 °C. 야생형(N2), ttx-3(KS5)sur-5p:hsf-1 동물을 해치로부터 1일째부터 20°C에서 1일째까지 성장시켰다. 1일째에, 동물은 37°C로 이동하고 모든 동물이 죽거나 검열된 것으로 채점될 때까지 2시간마다 점수를 매받았다. (D)37°C에서 수행된 모든 열내성 분석법의 풀화 데이터. 데이터는 열내성 분석의 시간 9에서 살아있는 백분율로 표현되며, 각 라인은 같은 날에 수행된 일치하는 실험을 나타냅니다. (e)34°C에서 수행된 모든 열내성 분석법의 풀화 데이터. 데이터는 열내성 분석의 시간 14에서 살아있는 백분율로 표현되고, 각 선은 같은 날에 수행된 일치하는 실험을 나타냅니다. A-C에 대한 모든 통계는 로그 랭크(Mantel-Cox) 테스트를 사용하여 수행되었으며 표 5에서찾을 수 있습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

시약 제조 법
리소제니 국물 (LB) 이 프로토콜에서는 상업용 LB가 사용되었지만(재료 참조), 바토 트립톤, 효모 추출물 및 NaCl을 사용하는 모든 표준 LB 홈메이드 레시피는 충분합니다.
선충 성장 미디어 (NGM) 1 mM CaCl2, 5 μg/mL 콜레스테롤, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) 한천, 0.25% (v) 박토 펩톤, 51.3 mM NaCl
표백제 용액 1.8% (v/v) 하이포아염소산나트륨, 0.375 M KOH
M9 솔루션 22 mM KH2PO4 모노 베이직, 42.3 mM Na2HPO4, 85.6 mM NaCl, 1 mM MgSO4
NGM RNAi 플레이트 1 mM CaCl2, 5 μg/mL 콜레스테롤, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) 한천, 0.25% (w/v) 박토-펩톤, 51.3 mM NaCl, 1mMIPTG, 100 μg/mL 카베니실린/암포. 최대 3개월 동안 어두운 4 °C에서 보관
테트라 사이클린 100% 에탄올에 10 mg/mL 재고 용액(500x). -20 °C에서 보관
카르베니실린 물에서 100 mg / mL 재고 용액 (1000x). 최대 6개월 동안 4°C또는 -20°C에서 장기간 보관하십시오.
아지드 나트륨 1 M 스톡 (~6.5%) 물에 아지드 나트륨의 스톡 솔루션. 4 °C에서 어둠 속에서 저장합니다. 이것은 10x 용액이며 대부분의 이미징 실험을 위해 100 mM 작업 재고로 희석됩니다.
튜니카마이신 100% DMSO의 2.5 mg/mL 재고 솔루션. 장기 보관을 위해 -80°C에서 보관하십시오. 이것은 100x 솔루션입니다 (25 ng / μL 작업 솔루션)
안티마이신 A 15 mM 안티 마이신 100 % DMSO의 재고 솔루션. -20 °C에서 보관하십시오. 이것은 5000x 솔루션 (3 μM 작업 재고)
파라쿼트 (주) 50 μM 용액을 물에 담가서 신선하 게 준비해야 합니다.
테르트 부틸 하이드로 페폭사이드 (TBHP) 7.7 M 용액을 물에서. 이것은 3850x 솔루션 (2mM 작업 재고)
NGM RNAi + DMSO0.2 1 mM CaCl2, 5 μg/mL 콜레스테롤, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) 한천, 0.25% (w/v) 박토-펩톤, 51.3 mM NaCl, 1mMIPTG, 100 μg/mL 카베니킬린/암페어
(항마이신 A에 대한 제어)
NGM RNAi + 항마이신 A 1 mM CaCl2, 5 μg/mL 콜레스테롤, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) 한천, 0.25% (w/v) 박토 펩톤, 51.3 mM NaCl, 1 mM IPTG, 100 μg/mL 카베니실린/암피실린, 0.2% MSO
NGM RNAi DMSO 1 mM CaCl2, 5 μg/mL 콜레스테롤, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) 한천, 0.25% (w/v) 박토-펩톤, 51.3 mM NaCl, 1mMIPTG, 100 μg/mL 카베니실린/암포 1% DMSO
(튜니카마이신 제어)
NGM RNAi TM 1 mM CaCl2, 5 μg/mL 콜레스테롤, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) 한천, 0.25% (w/v) 박토-펩톤, 51.3 mM NaCl, 1mMIPTG, 100 μg/mL 카베니실린/암포 1% DMSO, 25 ng/μL 튜니카마이신
IPTG 물에 1 M 용액.

표 1: 사용되는 시약에 권장하는 레시피. 이 프로토콜에 사용된 시약의 모든 정확한 조리법은 여기에 설명되어 있습니다. 시약을 구입한 특정 회사도 재료 표에서확인할 수 있습니다. 화학 물질의 많은 다른 소스는 테스트, 재료의 표에 나열된 그 가장 강력하고 재현 가능한 결과를 전시하는 것들이다.

플레이트 크기 박테리아 유형 # 동물의 1 일째 성인기에 도달 L4 단계에 도달하는 동물의 #
60 mm OP50 100-150 150-300
60 mm HT115 70-100 120-200
100 mm OP50 600-1000 1500-2000
100 mm HT115 350-600 700-1300

표 2: 기아를 피하기 위해 동기화 후 플레이트에 권장된 동물 수. 기아를 피하기 위해, 우리는 조건 당 동물의 특정 수를 도금하는 것이 좋습니다. OP50은 HT115보다 밀도가 높기 때문에 더 많은 동물을 도금할 수 있습니다. 여기에 나열된 모든 숫자는 실험실에서 사용되는 지침이며, 숫자는 여러 가지 변수와 실험실 조건 간의 차이로 인해 약간 다를 수 있습니다. 따라서 권장 된 숫자는 굵은 글꼴로 아래쪽에 있습니다. 최대 숫자는 기아에 도달하지 않고 실험실에서 최적의 조건에서 도금 될 수있는 것입니다, 하지만 먼저 조건을 적정하지 않고 이러한 값을 사용하지 않는 것이 좋습니다. 모든 숫자는 박테리아가 접시에 씨를 뿌리고 벌레가 그 위에 놓이기 전에 플레이트에서 주변 온도 (~22 °C)에서 ~ 24 시간 동안 자랄 수 있다는 가정하에 결정됩니다. 계란이나 L1을 도금할 때 기아율에는 큰 차이가 없지만, 모든 계란이 표백 후 부화하지 는 않기 때문에 계란을 도금 할 때 ~ 10 % 더 높은 숫자를 도금하는 것이 좋습니다.

스트레인 이름 이식 유전자 목적 스트레스의 권장 어플리케이션 소스
SJ4005 HSP-4p ::GFP UPRER 25 μg/mL 튜니카마이신 CGC
SJ4100 HSP-6p ::GFP UPRMT 3 μM 항마이신 A; CGC
ETC 또는 미토콘드리아 리보솜에 대한 RNAI
SJ4058 HSP-60p ::GFP UPRMT 3 μM 항마이신 A; CGC
ETC 또는 미토콘드리아 리보솜에 대한 RNAI
CL2070 HSP-16.2p::GFP 열 충격 반응 34 °C 2시간 CGC
AM446 HSP-70p ::GFP 열 충격 반응 34 °C 2시간 모리모토 랩
CL2166 GST-4p::GFP 옥스R 50 mM 파라쿼트; CGC
2mM테르트-부틸 하이드로퍼옥사이드
CF1553 소드 -3p ::GFP OxSR 및 인슐린 신호 daf-2에 대한 RNAi (인슐린 수용체) CGC
AU78 T24B8.5p::GFP 타고난 면역 반응 병원체 노출 (예를 들면 P. aeruginosa) CGC

표 3: 세포 스트레스 반응의 활성화를 평가하기 위한 전사 기자. 여기에 나열된 균주는 모두 CGC를 통해 또는이 원고에 설명 된 정성적 및 정량적 이미징 방법 모두에서 사용하기 위해 실험실에 특별한 요청을 통해 사용할 수 있습니다. 이러한 균주는 모두 브리스톨 N2 배경에서 파생됩니다. 리포터 활성화를 위해 스트레스를 가하는 권장 방법도 제공됩니다. 모든 기자, sod-3p제외::GFP45T24B8.5p:::GFP46 텍스트에 설명되어 있습니다.

이식 유전자 스트레스의 권장 어플리케이션 라이카 M2250FA 스테레오 현미경을 이용한 노출 시간 회전 에코 현미경을 사용한 노출 시간 유니온 생체 인식 COPAS 바이오소터를 사용한 PMT 값
HSP-4p ::GFP 25 μg/mL 튜니카마이신 (야간 회복시~4시간) 200 ms 275 ms 450
HSP-6p ::GFP 3 μM 항마이신 A (~16 시간); 100ms 50 ms 350
ETC 또는 미토콘드리아 리보솜에 대한 RNAI (해치에서)
HSP-60p ::GFP 3 μM 항마이신 A (~16 시간); 200 ms 100 ms 450
ETC 또는 미토콘드리아 리보솜에 대한 RNAI (해치에서)
HSP-16.2p::GFP 34 °C 2시간 400 ms 200 ms 500
HSP-70p ::GFP 34 °C 2시간 400 ms 300 ms 500
GST-4p::GFP 50 mM 파라쿼트 (~2 시간); 100 ms 50 ms 350
2mM 테르트-부틸 하이드로퍼옥사이드(야간 회복 시~4시간)
소드 -3p ::GFP daf-2에 대한 RNAi (인슐린 수용체) 300 ms 300 ms 475
T24B8.5p::GFP 병원체 노출 (예를 들면 P. aeruginosa) 100 ms 50 ms 350

표 4: 대형 입자 바이오소처를 사용한 형광 현미경 및 정량화에 권장되는 설정. 이 표는 대형 입자 바이오소처에 대한 형광 현미경 또는 PMT 값에 대한 권장 노출 시간에 대한 지침역할을 합니다. 이러한 값은 좋은 시작점으로 사용되지만, 모든 실험에 대해 노출 시간과 PMT 값을 조정하여 채도가 발생하지 않고 형광 값이 배경 신호의 검출 한계를 초과하도록 해야 합니다. 실험에 대해 가장 밝은 신호가 있는 샘플이 알려진 경우(예: 응력 유도에 대한 포지티브 컨트롤), 이러한 샘플을 사용하여 신호를 포화하지 않고 사용할 수 있는 가장 높은 노출 시간 또는 PMT를 결정할 수 있습니다. 가장 밝은 샘플을 알 수 없는 경우 컨트롤을 사용할 수 있으며 시스템의 동적 범위 중심에 노출 시간 또는 PMT를 사용할 수 있습니다.

해당 그림 변형, 치료 평균 수명 # 사망자/# 합계 중앙값 수명 변화 % p-값(로그 랭크; 맨텔 콕스)
5a N2, 벡터 RNAi, 1% DMSO 22일 95/120 -- --
N2, xbp-1 RNAi, 1% DMSO 14일 92/120 -36.4 < 0.001
N2, 벡터 RNAi, 25 ng/μL TM 14일 97/120 -36.4 < 0.001
N2, xbp-1 RNAi, 25 ng/μL TM 12일 98/120 -45.4 < 0.001
5B N2, 벡터 RNAi, 100 mM PQ 5시간 73/73 -- --
N2, daf-2 RNAi, 100 mM PQ 6.5시간 74/74 30 < 0.001
5C N2, 벡터 RNAi, 37 °C 8시간 59/60 -- --
ttx-3 (KS5), 벡터 RNAi, 37 °C 7시간 60/60 -12.5 0.002
sur-5p ::hsf-1,벡터 RNAi, 37 °C 9시간 59/60 12.5 0.012

표 5: 수명 및 스트레스 생존 측정에 대한 통계. 그림 5에 대한 모든 샘플 크기, 통계 및 검열 요금은 여기에서 확인할 수 있습니다.

스트레스 반응 표적 유전자 포워드 프라이머 리버스 프라이머
UPRER hsp-3 TCGCTG가트가가아트GTTCG GTTGCTTTTTTTG
UPRER hsp-4 가아카아크택트GCGTGG 가아카아크택트GCGTGG
UPRER 셀-11 TTGATCCG가아아아아아커카아그 TTGATCCG가아아아아아커카아그
UPRER 아이레 1 TCCCAACCGCTCCATCAACAT TCCCAACCGCTCCATCAACAT
UPRER xbp-1 GGACTTTCGGCTTGGAGT GGACTTTCGGCTTGGAGT
UPRER xbp-1(접합) GGGG가트가가가가가가 GGGG가트가가가가가가
UPRER crt-1 개그타타그가가가아GC 개그타타그가가가아GC
UPRER T14G8.3 카카트카아카아카아카카트 카카트카아카아카아카카트
Hsr hsp-17 TCGTTTTCCACCATCTCCCCA TGTTT가트CGGC카그그그
Hsr hsp-70 TGTTT가트CGGC카그그그 TTCGCAATGAGA아가그락트
Hsr F44E5.4 TTCGCAATGAGA아가그락트 CGTTGTGCGCCTCTCTCTCTTT
Hsr hsp-16.2 TCCCTCTCTCT가트가트가트가트가트가트가트가트
GTTA
TGGTTAACTGTGT가가가가가가
Hsr hsf-1 TTTGCATTCTCTCTCTCTCTGTC TCTATTTCCAGCACACCTCGT
UPRMT hsp-6 가가트그가아가가 CGGCATTTTTGCGCTT
UPRMT hsp-60 CGGCATTTTTGCGCTT CGTCGTTGCAGAGCTCAAGAAG
UPRMT 이멜-1 CAAAACCTGCTCTGGG TTCTCAATGTCGGCTCCAGT
UPRMT 클렙-1 T가타아그GCACCGCGCCA 트가트그가그게그가가가가
UPRMT 론프-1 CGATATGGCCATTGCAG CGCTTTGAAACatCAATTTCAT
Cca
옥스R gst-4 가트GCTGCTGCTGcTG CCGAATTTCTCTATCCAC
옥스R gst-6 CCGAATTTCTCTATCCAC TTTGGCAGTGTTGAGGAG
옥스R gst-7 TTTGGCAGTGTTGAGGAG TGGGTACTG가GTTTG
옥스R gcs-1 TGGGTACTG가GTTTG ATGTTTGCCTCGACAATGTT
옥스R skn-1 가아카카가트카아그 TCAGGACGT카카카카카카카카카카가악
옥스R 소드 3 GTAACGGGCGATAGCATGAG GCGAGAGATT가크
옥스R ptps-1 아츠가트트가가CC 카카트액트GCCGCACTGCTT
CAAAGC
참조 pmp-3 TGGGG가가트GTCGC 아가아카카트GC카아그카그
참조 Y45F10.4 크가아크CGAATGTCGGA CGGTGCCAGGAGAGAGAGC
참조 수액-49 TGGGG가트CGTGCGCCC ACGAGTCTTCGTCCCCCCCCCCCCCCCCCC
참조 tba-1 TCAACACTGCCATCCCCCC TCCAGC가가가가가가가가가가가가가가가

표 6: 스트레스 반응 유전자의 전사 상승 조절을 측정하기 위한 권장 유전자 표적 및 프라이머 쌍.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

여기서, C. elegans에서세포 스트레스 반응을 심문하는 방법, 형광 전사 리포터 및 생리적 스트레스 생존 측정법을 사용하여 설명된다. 기자들은 모두 세포 스트레스 반응 장착에 관여하는 전사 인자의 다운스트림 전사 표적의 프로모터 하에 구동되는 GFP 발현을 이용한다. hsp-4p의 사용 ::GFP는 XBP-1s 매개 UPRER에의해 변조, hsp-6p ::GFP ATFS-1 중재 UPRMT에의해 제어, GST-4p::GFP SKN-1 중재 OxSR에서, hsp16.2p::GFPhsp-70p::HSF-1 매개 열 충격 응답에서 GFP설명. 다른 표준화된 전사 기자는 표 3에서찾을 수 있습니다. 여기에 제시된 모든 전사 기자는 넓은 동적 범위를 가지고 있으며 유전 적 교란 또는 스트레스 유발 화학 물질에 대한 노출을 통해 스트레스를 적용하여 강력하게 활성화 할 수 있습니다. 더욱이, 이들 기자들은 모두 고용된 프로모터의 상류에 전사 인자를 녹다운시킴으로써 억제될 수 있다. 마지막으로, 각 전사 리포터는 특정 생리적 스트레스 생존 분석법과 짝을 이루어 특정 스트레스 반응을 활성화 또는 억압하는 것의 영향에 대한 생리학적 판독을 제공한다.

전사 기자의 사용을 성공적으로 활용하려면 각 기자의 동적 범위를 결정하는 것이 필수적입니다. 매체, 한천, 주변 환경 등의 차이로 인한 주요 실험실 간 변동성으로 인해, 우리의 권고사항을 기준선으로 사용하여 집중력과 타이밍에 대한 각 약물 또는 응력 유도 패러다임을 적정화하는 것이 좋습니다. 다음으로, 동물이 건강하고 적절하게 동기화되도록 하는 것이 중요합니다. 일종의 스트레스(예: 기아, 빛에 장기간 노출, 고온에 의한 노출 등)를 경험한 동물은 실험 전에 여러 세대에 걸쳐 회복되어야 합니다. 적절한 동기화는 섹션 2에 설명된 방법을 사용하여 수행할 수 있으며, 이는 여러 응력 반응이 노화 과정에서 서로 다른 수준의 활성화를 갖기 때문에 필수적입니다. 마지막으로 이미징 프로토콜은 이미지 및 데이터 품질에 영향을 줄 수 있는 다양한 사항이 있기 때문에 표준화하는 데 필수적입니다. 예를 들어, 아지드 나트륨에 있는 동물의 지속 기간은 동물에게 스트레스를 일으키고 리포터 신호에 영향을 미칠 수 있기 때문에 최소화되어야 합니다. 또한, 현미경 및 바이오소터 사양은 포화를 일으키지 않으면서 신호 대 잡음 비 및 동적 범위를 최대화하도록 적절하게 설정되어야 합니다. 최대 형광 신호가 심각하게 과소 평가될 수 있으므로 포화 픽셀은 샘플의 정량 적 분석에 주요 문제를 일으킬 수 있습니다.

여기에서 기술된 전사 기자는 스트레스 반응의 활성화를 측정하는 강력하고 효율적인 수단을 제공하지만, 알려진 전사 인자의 단일 유전자 표적임을 이해하는 것이 중요합니다. 따라서, 그것은 대규모 스크린 또는 관심의 긴장의 첫 번째 패스 테스트에 대 한 신뢰할 수 있는 방법으로 사용 하는 동안, 적절 한 유효성 검사를 수행 해야 합니다. 우리는 분석되는 각 스트레스 반응의 유도시 활성화 된 여러 정식 표적 유전자를 측정하기 위해 qPCR을 수행하는 것이 좋습니다. 제안된 유전자 표적의 목록은 표 6에서찾을 수 있다. 또한, RNA-seq를 통한 전사체 프로파일링은 한 번에 다중 전사 표적에 대한 광범위한 효과를 보기 위한 또 다른 대안이다. 특히, 형광 기자의 이미징은 섭동에 의해 영향을받는 조직에 관한 공간 정보를 제공합니다. 이러한 정보는 scRNA-seq, FISH 및 조직 특이적 RNAeq 프로토콜47을제외하고, 전체 웜 추출물을 사용하기 때문에 qRT-PCR 또는 RNA-seq로부터 얻을 수 없다. 마지막으로, 이러한 응력 리포터는 일반적으로 스트레스 응답 기계에 특정되는 것으로 특징지습니다. 그러나 모든 스트레스 응답 패러다임이 독특하고 구별되는 것은 아니라는 점을 기억하는 것이 중요합니다. 예를 들어, ER 응력은 OxSR을 활성화할 수 있고 그 반대의 경우도마찬가지48이며,열 충격 반응과 ER 응력 반응 사이의 중첩은 일반적으로49로발견되었습니다. 이들은 교차 커뮤니케이션의 문헌에 있는 많은 보기의 단지 몇몇이고 응력 반응 사이 겹치기, 따라서 모든 실험은 또한 최종 결론을 도출하기 위하여 특이성을 위해 시험되어야 한다는 것을 이해하는 것이 중요합니다.

설명된 방법의 또 다른 한계는 바이오선별기를 통한 이미징 및 정량화가 처리량을 제한했다는 것입니다. 바이오선별기 정량화는 더 높은 처리량을 위해 96웰 플레이트에서 수행될 수 있지만, 이미징은 웜을 준비하고 현미경 검사를 수행하는 조사자의 능력에 의해 제한되는 반면, 웜을 솔루션으로 옮길 필요성에 의해 여전히 제한됩니다. 따라서 대형 스크린은 형광 리포터 신호의 시각적 스크리닝만 포함할 가능성이 높으며, 조회만 이수되고 정량화됩니다.

이러한 형광 리포터를 사용하는 중요한 주의 사항은 스트레스 반응의 활성화 또는 억제가 항상 생리학적으로 의미 있는 표현형에 기여하지 않거나 다른 글로벌 효과(예: 단백질 합성 감소)를 반영할 수 있다는 것입니다. 따라서, 모든 전사 리포터는 스트레스 생존을 분석하는 방법에 짝을 이룬다. UPRER에대한 튜니카마이신 생존 성애, UPRMT 및 OxSR에 대한 파라쿼트 생존 성 애서를 수행하고, 열 충격 반응을 위한 높은 온도에서 생존을 수행하는 것이 좋습니다. 이들은 일반적으로 견고하고 빠르며 간단한 어설슬이지만 집중적인 수동 노동이 필요하므로 확장성이 심각하게 제한됩니다. 더욱이, 현재까지 간행된 거의 모든 열내성 분석은 거의 필수적인21의복제의 다수를 만드는, 중요한 가변성을 가지고 있습니다. tunicamycin 및 paraquat 생존 분석은 재현성의 이 부족 때문에 손해를 입지 않는 동안, 그(것)들은 프로토콜의 광범위한 실습 노동 및 기간을 포함하여 그들의 자신의 도전이 있습니다. 수명 및 생존 측정을 자동화하는 새로운 기술이 태어나면서 이러한 스트레스 생존 측정결과도 높은처리량(50)이될 수 있습니다. 그러나, 이 자동화된 측정이 표준이 될 때까지, 생존 측정은 현재 스트레스 반응 활동의 역학을 바꾸는 생리적인 결과의 검증으로 제한됩니다.

여기에 기술된 스트레스 생존 법제 외에도 동물에서 생리학을 측정하는 여러 가지 다른 방법이 있습니다. 예를 들어, 시판시XFp 분석기는 세포 호흡의 모니터링을 허용할 수 있으며, 이는 추가적인 기계적통찰력(51)을제공한다. 전사 기자에 대한 또 다른 대안은 형광 표지 된 전사 인자의 핵 국소화의 사용이다. 이 기술의 수많은 변종이 있지만, 여기에 설명 된 방법에 특히 관심이 포함 : 열 충격 응답 에 대한 HSF-1 : : GFP52,DVE-1 : : GFP UPRMT53,및 DAF-16 ::::GFP와 SKN-1 : GFP OxSR54,55. 마지막으로, 관심있는 특정 세포기관의 형태에 대한 직접적인 심문이 수행 될 수 있습니다. 예를 들어, 미토콘드리아 형태는 미토콘드리아 국소화 서열56을사용하여 미토콘드리아 매트릭스를 표적으로 하는 형광피를 이용하여 가시화될 수 있다. ER 형태는 Er 막단백질(58)에융합된 C-말단 HDEL에 융합된 N-말단 및 HDEL에 융합된 신호 서열을 통해 ER을 표적으로 하는 형광단을 이용하여 가시화될 수 있다. 마지막으로, 액틴 시토스켈레탈 무결성은 HSF-1의 열 응력 민감도 하류의 프록시로 사용될 수 있다. 액틴 세포골격은 HSF-1의 전사 표적에 의해 조절되며, 특히 노화 및 열 스트레스 동안, 따라서 액틴 조직은 HSF-1 및 열 관련 스트레스59,,60의기능적 판독을 결정하기 위해 가시화될 수 있다.

여기에 기술된 모든 방법은 독립적으로 또는 서로 조합하여 관심 있는 유전자 또는 약물의 포괄적인 분석과 스트레스 반응에 미치는 영향에 대해 사용될 수 있다. 대규모 스크린은 고처리량 전사 리포터 분석을 사용하여 수행될 수 있고, 이차 스크린은 이 기자의 정량적인 분석을 사용하여 수행될 수 있습니다. 일단 더 관리 가능한 후보 유전자/약 목록이 확인되면, 생리학적 인 실험은 전체 동물 생리학에 직접적인 영향을 미치는 그 후보를 확인하기 위하여 수행될 수 있습니다. 위에서 제안한 다른 방법은 유효성 검사 또는 추가 조사로도 사용할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없다.

Acknowledgments

R.BZ. EMBO 장기 펠로우십과 래리 L. 힐블롬 재단의 지원을 받고 있습니다. R.H.S는 국립 노화 연구소 (NIA)와 의학 연구 박사 후 펠로우십을위한 글렌 재단을 통해 보조금 5F32AG032023-02에 의해 지원됩니다. A.F.는 NIA를 통해 F32AG051355를 지원합니다. 에이치케이지는 국립과학재단 대학원 연구동호회 프로그램을 통해 DGE1752814를 지원하고 있습니다. M.G.M.은 NIA를 통해 1F31AG060660-01에 의해 지원됩니다. A.D.는 토마스와 스테이시 시벨 재단, 하워드 휴즈 의학 연구소, 4R01AG042679-04 및 NIA의 5R01AG055891-02, 그리고 NIEHS의 5R01ES021667-09에 의해 지원됩니다. 래리 조, 멜리사 산체스, 나메 켈렛, 아넬 에스퀴벨에게 상당한 기술적 지원을 부탁드립니다. 우리는 모리모토 연구소와 CGC (연구 인프라 프로그램 P40 OD010440의 NIH 사무실에 의해 투자) 균주에 감사드립니다.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).
<em>C. Elegans의</em> 생리적 스트레스 반응 측정
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).More

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter