Here, we characterize cellular proteotoxic stress responses in the nematode C. elegans by measuring the activation of fluorescent transcriptional reporters and assaying sensitivity to physiological stress.
Organisms are often exposed to fluctuating environments and changes in intracellular homeostasis, which can have detrimental effects on their proteome and physiology. Thus, organisms have evolved targeted and specific stress responses dedicated to repair damage and maintain homeostasis. These mechanisms include the unfolded protein response of the endoplasmic reticulum (UPRER), the unfolded protein response of the mitochondria (UPRMT), the heat shock response (HSR), and the oxidative stress response (OxSR). The protocols presented here describe methods to detect and characterize the activation of these pathways and their physiological consequences in the nematode, C. elegans. First, the use of pathway-specific fluorescent transcriptional reporters is described for rapid cellular characterization, drug screening, or large-scale genetic screening (e.g., RNAi or mutant libraries). In addition, complementary, robust physiological assays are described, which can be used to directly assess sensitivity of animals to specific stressors, serving as functional validation of the transcriptional reporters. Together, these methods allow for rapid characterization of the cellular and physiological effects of internal and external proteotoxic perturbations.
The ability of an organism to respond to changes in the intra- and extracellular environment is crucial for its survival and adaptation. This is accomplished on a cellular level through numerous protective pathways that ensure the integrity of the cell. While numerous cellular components are subject to stress-associated damage, one major involvement of cellular stress responses is to repair and protect the homeostasis of the cellular proteome. However, the compartmentalization of proteins into special structures, called organelles, poses a challenge for the cell, as it cannot rely on one centralized form of protein quality control to ensure that all the proteins within the cell are properly folded and functional. Therefore, to deal with perturbations to their proteins, organelles have evolved dedicated quality control mechanisms, which can sense misfolded proteins and activate a stress response in an attempt to alleviate the stress within that compartment. For example, the cytosol relies on the heat shock response (HSR), while the endoplasmic reticulum (ER) and mitochondria rely on their compartment-specific unfolded protein responses (UPR). The OxSR serves to alleviate the toxic effects of reactive oxygen species (ROS). Each stress response is triggered in the presence of cellular challenges and environmental insults and induces a tailored transcriptional response. The hallmarks of these responses include synthesizing molecules that re-fold misfolded proteins (such as chaperones) targeted to the proper organelle, or alternatively, remove damaged proteins by protein degradation. Failure to activate these stress responses results in accumulation of damaged proteins, cellular dysfunction propagated to systemic failure of tissues, and eventually death of the organism. The function and regulation of the different stress responses are reviewed elsewhere1.
Many insights regarding the regulation and activity of cellular stress responses have been attributed to the nematode, Caenorhabditis elegans, a multicellular model organism in genetic research. Nematodes not only allow studying the activation of stress responses on the cellular level, but also on the organismal level; nematodes have been used to study the effects of genetic perturbations or exposure to drugs and pollutants on their growth and survival. Their quick generation time, isogeny, transparency, genetic tractability, and ease of use during experimentation make them ideal for such studies. Additionally, the relatively quick physiological response to stress (between hours and a few days) and the evolutionary conservation of cellular pathways make nematodes a prominent tool in studying stress resistance.
There are two commonly used E. coli strains used as a food source to grow C. elegans: standard OP50, a B strain in which most experimentation has been historically performed2 and HT115, a K-12 strain that is used for almost all RNAi experiments3,4. It is important to note that there are significant differences between OP50 and HT115 bacterial diets. Growth on these different bacterial sources has been shown to cause major differences in metabolic profile, mitochondrial DNA copy number, and several major phenotypes, including lifespan5. Some of these differences are attributed to Vitamin B12 deficiency associated with growth on OP50 bacteria, which can result in defects in mitochondrial homeostasis and increased sensitivity to pathogens and stresses. All of these phenotypes have been shown to be alleviated by growth on HT115 bacteria, which have higher levels of Vitamin B126. Therefore, it is recommended that all experiments on physiological stress responses be performed on HT115 bacteria, regardless of the necessity of RNAi conditions. However, due to the ease of maintaining animals on OP50, all standard growth (i.e., maintenance and amplification of animals) can be performed on OP50, as significant differences in the experimental paradigms described here were not detected in worms maintained on OP50 as long as they were moved to HT115 post synchronization (i.e., from hatch post-bleaching with or without L1 arresting) until experimentation.
Here, the characterization of the activity of cellular stress responses using two functional methods is described. It should be noted that the protocols presented are primarily focused on cellular stress responses and their impact on protein homeostasis. First, fluorescent transcriptional reporters are utilized, which are regulated by endogenous gene promoters that are specifically activated in response to different cellular stresses. These fluorescent transcriptional reporters are based on the transcriptional induction of specific genes that are natively part of the stress response. For example, HSP-4, a heat shock protein orthologous to the human chaperone HSPA5/BiP, is activated upon ER-stress and localizes to the ER to alleviate the stress. In conditions of ER stress (e.g., exposure to tunicamycin), a green fluorescent protein (GFP), placed under the regulation of the hsp-4 promoter, is synthesized in high levels as can be assessed by fluorescent microscopy or quantitatively measured using large-particle flow cytometry of nematodes7. Similarly, the promoter of a mitochondrial chaperone, hsp-6 (orthologous to mammalian HSPA9), is utilized to monitor the activation of the UPRMT8, and the promoter of the cytosolic chaperone hsp-16.2 (orthologous to the human crystallin alpha genes) is used for assessing the activity of the HSR9. These reporters allow a rapid characterization of the pathways activated in response to various perturbations.
Often, the reporters presented here are imaged using microscopy, which provides a qualitative output of the activation of stress responses. However, while imaging techniques provide both information on intensity and tissue location of the reporters described above, its quantification is not always accurate or robust. While it is possible to quantify fluorescent activation using imaging analysis tools, these methods are relatively low throughput and sample size is small, due to the relatively low number of animals imaged. The ease and ability to obtain large quantities of animals quickly make C. elegans an ideal model system to assay the activation of fluorescent stress reporters through the use of a large particle flow cytometer. A large-particle flow cytometer is capable of recording, analyzing, and sorting based on size and fluorescence from many live animals. Using this method, it is possible to get the fluorescent intensity, size, and also spatial (2D) information for thousands of worms. The system is controlled using FlowPilot, which allows for real-time data acquisition and analysis of the measured parameters. Here, methods for both microscopic imaging and quantitative analysis using a large-particle flow cytometer are offered as methods to measure the activation of stress responses.
Beyond reporter analysis, the sensitivity or resistance of animals to stress can be measured using physiological stress assays. This is achieved by exposing animals to stressful environments that activate specific cellular stress pathways. Here, several methods are provided to measure sensitivity of whole animals to specific types of stressors.
ER stress is applied to C. elegans by using the chemical agent, tunicamycin, which blocks N-linked glycosylation, causing accumulation of misfolded proteins in the ER10. In C. elegans, growth upon exposure to tunicamycin results in major perturbations in ER function, and a significantly decreased lifespan11. By measuring the survival of animals on tunicamycin-containing plates, ER stress sensitivity of animals can be quantified. For example, animals with ectopic UPRER induction and thus increased resistance to protein misfolding stress in the ER have an increased survival upon tunicamycin exposure compared to wild-type animals12.
Oxidative and mitochondrial stress is applied to C. elegans by exposing animals to the chemical agent, paraquat. Paraquat is a commonly used herbicide, which causes superoxide formation specifically in the mitochondria13. Due to the specific localization of mitochondria-derived reactive oxygen species (ROS), paraquat assays are often used as a "mitochondrial" stress assay. However, superoxide is rapidly converted into hydrogen peroxide by mitochondrial superoxide dismutases (SODs)14. Hydrogen peroxide can subsequently diffuse out of the mitochondria and cause oxidative stress in other compartments of the cell. Therefore, we describe paraquat survival assays as measuring sensitivity to both mitochondrial and oxidative stress (other oxidative stress assays can be found15).
Thermotolerance assays are performed in C. elegans by placing animals in elevated temperatures. Ambient temperatures for nematodes are ~15-20 °C and thermal stress is induced at temperatures above 25 °C16,17. Thermotolerance assays are generally performed at temperatures ranging from 30-37 °C, as animals exhibit major cellular defects at this temperature, and survival assays are completed within 24 hours16,18. Here, two alternative methods are provided for performing thermotolerance assays: growth at 34 °C and growth at 37 °C. Together, the protocols presented here can be utilized to perform large-scale screens when combined with standard gene knock-down using RNA interference or chemical drug libraries.
The protocol can be broken into 4 broad procedures- growth of C. elegans and preparation for imaging (sections 1 and 2), imaging of transcriptional reporters using fluorescent microscopy (sections 3-5), quantitative measurements of reporters using a large-particle flow cytometer (section 6), and physiological assays to measure stress sensitivity in C. elegans (section 7).
1. Standard growth conditions of temperatures & OP50 vs HT115
2. Staging/synchronization of worms using bleaching
3. Growth conditions of worms for imaging of transcriptional reporters
4. Induction of stress responses
5. Imaging using a stereo microscope or low-magnification wide-field/compound microscope
6. Quantitative measurements of reporters using a large-particle flow cytometer
NOTE: Growth and preparation of worms for large-particle flow cytometer analysis can follow the same paradigms as sections 1-5 for preparation of worms for fluorescent imaging, with the exception that a larger number of animals are required. Use >500 animals per condition, as some animals are lost during manipulation, not all animals pass the filtering criteria during quantification, and some animals are not properly read by the flow cytometer. Wash animals ready for sorting off plates in 5-10 mL of M9 solution into 15 mL conical tubes for subsequent sorting on the flow cytometer.
7. Physiological assays to measure stress sensitivity in C. elegans
Using transcriptional reporters to measure activation of stress responses
Here, fluorescent transcriptional reporters are used, which serve as robust tools to measure activation of most stress responses in C. elegans. GFP expression is driven under the promoter of canonical targets of master transcriptional regulators involved in responding to compartment-specific stresses. A comprehensive list of commonly used transcriptional reporters is available in Table 3.
Perturbing ER homeostasis via unfolded or misfolded proteins or lipid bilayer stress causes the activation of the unfolded protein response of the ER (UPRER) to restore ER quality and function. The UPRER consists of 3 distinct branches defined by the transmembrane sensors: inositol-requiring protein 1 (IRE1), activating transcription factor 6 (ATF6), and protein kinase RNA (PKR)-like ER kinase (PERK), all of which are conserved in C. elegans7,22,23. The most common tool to monitor activation of the UPRER in the nematode, is the transcriptional reporter strain expressing GFP under the control of the hsp-4 promoter (hsp-4p::GFP)7. The gene hsp-4 encodes an orthologue of mammalian Hsp70, HSPA5 (or BiP/Grp78). In times of ER stress when the UPRER is activated, the hsp-4p::GFP reporter strain expresses GFP. This reporter has minimal basal expression in the absence of stress, but exhibits robust GFP expression when animals are exposed to tunicamycin (Figure 1A). These differences can also be quantified using a large-particle flow cytometer (Figure 1B). Moreover, the induction of hsp-4p::GFP under ER stress can be completely suppressed by RNAi-knockdown of xbp-1, as the activation of this transcriptional reporter is dependent on the transcription factor, XBP-112.
Similar to the UPRER, the mitochondria houses its own protective mechanism against proteotoxic stress. This mechanism, termed the mitochondrial UPR (UPRMT)24, is mainly regulated by the transcription factor, ATFS-1, which fails to enter the mitochondria under stress due to decreased import efficiency, resulting in entry of ATFS-1 into the nucleus25. Interestingly, different perturbations to mitochondrial processes can activate this response, including protein aggregation, knock down of electron transport chain (ETC) complexes subunits, mitochondrial DNA replication stress, and mitochondrial protein translation8,26. The activation of the UPRMT has been monitored by using worms expressing a transgenic construct in which GFP was placed under the regulation of the promoters of the mitochondrial chaperone genes, hsp-6 and hsp-608. Similar to hsp-4p::GFP animals, hsp-6p::GFP animals exhibit minimal basal signal in the absence of stress. The most robust method to induce the UPRMT is through RNAi-knockdown of the following mitochondrial proteins: cox-5B, the cytochrome c oxidase subunit Vb/COX4 (Complex IV)20, nuo-4, the NADH dehydrogenase protein (Complex I)27, or mrps-5, a mitochondrial ribosomal protein28, activated the hsp-6p::GFP reporter. GFP expression through this reporter is robustly activated and can be easily visualized and quantified under these conditions (Figure 2A-B). The UPRMT can also be triggered through chemical inhibition of the electron transport chain (ETC), such as with antimycin A, which inhibits cytochrome c reductase (complex III). Similar to RNAi-knockdown of ETC components, antimycin A treatment causes a robust induction of hsp-6p::GFP (Figure 2C-D).
The ability for organisms to sense and respond to oxidative stress is a conserved process present from bacteria to humans29. In C. elegans, the NRF2 homologue, SKN-1, serves as an important transcription factor, which is sensitive to redox changes due to reactive cysteines throughout the protein. SKN-1 serves as one of the transcriptional activator of the OxSR through binding to conserved consensus sequence highly resembling the antioxidant response elements bound by NRF230. In humans, NRF2 is negatively regulated by KEAP1, which is thought to be sensitive to redox changes due to reactive cysteines throughout the protein31. While there is no direct ortholog of KEAP1 in worms, SKN-1 is negatively regulated by the WD-repeat protein, WDR-23, in a manner that is mechanistically distinct from KEAP1/NRF2 inhibition32. Upon oxidative stress, such as tert-butyl hydroperoxide (TBHP), SKN-1 activates detoxification and antioxidant genes such as gst-4, a Glutathione S-Transferase. To measure oxidative stress, GFP expression is placed under the promoter of gst-4, a glutathione S-transferase33. Unlike the other transcriptional regulators presented here, gst-4p::GFP has high basal expression. However, this expression can still be robustly activated under conditions of oxidative stress, which can be performed both genetically and chemically. To genetically induce oxidative stress, we knockdown wdr-23, which encodes a protein that plays a role in proteasomal degradation of SKN-134. wdr-23 knockdown results in robust activation of gst-4p::GFP. Moreover, treatment of worms with the chemical oxidant, TBHP, results in a milder, but still significant, activation of gst-4p::GFP (Figure 3). Both chemical and genetic activation of gst-4p::GFP can be almost completely suppressed by RNAi knockdown of the skn-1, the gene encoding the master transcriptional regulator of the OxSR.
Most cellular proteins are translated in the cytoplasm and reside there, even if only temporarily before being targeted elsewhere. Thus, the cytoplasm hosts a diverse array of chaperones that promote proper protein folding and function, as well as enzymes and proteins responsible for degrading damaged, dysfunctional, or excess proteins. To protect this complex protein landscape of the cytoplasm, the cell has evolved several cytoplasmic stress response pathways, including the heat-shock response (HSR)35,36. The HSR is a pathway dedicated to promoting protein homeostasis under conditions of heat stress and is modulated by the master transcriptional regulator, HSF-137. Under steady state conditions, HSF-1 is bound by cytoplasmic chaperones, HSP90 and HSP70/40, which keeps it locked in a monomeric, inactive state. Under conditions of heat or similar stress, an increase in misfolded proteins results in titration of chaperones away from HSF-1, allowing it to trimerize and translocate to the nucleus to activate the HSR38,39. Perhaps the most-studied downstream targets of HSF-1 under HSR activation are the heat-shock proteins (HSPs), such as HSP70, HSP90, DNAJ, and HSP6017,40. In C. elegans, transcriptional reporters for HSR have been synthesized by driving the expression of GFP under the promoters of canonical HSPs, hsp-16.2 and hsp-709,41. Like their UPRMT and UPRER counterparts, hsp-16.2p::GFP and hsp-70p::GFP show minimal basal expression in the absence of stress. However, both reporters are robustly induced under conditions of heat stress, which can be easily visualized by microscopy or quantified using a large particle flow cytometer (Figure 4). Both reporters have large dynamic range, and induction is completely dependent on hsf-1, as RNAi-knockdown of hsf-1 fully suppresses induction of hsp-16.2p::GFP and hsp-70p::GFP. While these reporters can be used interchangeably for most situations, there may be differences in expression levels and expression across tissues.
Physiological assays to measure stress sensitivity in C. elegans
C. elegans are a great model organism to measure stress sensitivity due to the low cost in maintenance and experimentation and ease of genome editing or genetic knockdown using RNAi, which provides the capacity to perform large-scale experiments in a whole organism. To assay stress tolerance to ER stress, we expose C. elegans to the chemical agent, tunicamycin, which causes accumulation of damaged proteins in the ER by blocking N-linked glycosylation10. Animals are exposed to tunicamycin post-development, as the drug causes developmental defects. When exposed to tunicamycin, adult worms exhibit a marked decline in lifespan. Moreover, knockdown of the gene, xbp-1, which encodes one of the primary transcription factors involved in UPRER induction, results in a significant increase in sensitivity to tunicamycin (Figure 5A)12. Thus, this serves as a robust assay to measure ER stress sensitivity in adult worms.
To measure oxidative stress and mitochondrial stress, we expose animals to the chemical agent, paraquat. Paraquat causes mitochondrial stress by synthesis of ROS within the mitochondrial matrix, which can then be converted into hydrogen peroxide and diffuse out of the mitochondria to cause whole-cell oxidative damage13. Similar to ER stress assays, we expose animals to paraquat at adulthood. However, we perform paraquat assays in liquid to reduce cost and manual labor and agar plate-based assays would be difficult for most labs. Here, we show that animals exposed to paraquat in liquid show median survival of approximately 5 hours (Figure 5B). Moreover, knockdown of the insulin receptor, daf-2, results in an increased resistance to paraquat as activation of DAF-16/FOXO results in increased expression of involved in clearance of ROS, such as sod-342,43. Paraquat survival assays are short, lasting up to 14 hours, and thus serve as an efficient method to interrogate mitochondrial and oxidative stress responses.
Finally, survival at elevated temperatures is used to interrogate the physiological response to heat stress. These assays can be performed both in liquid or solid agar, and there exist numerous different protocols outlined21. It is recommended to standardize a single assay in the lab to decrease variability, which is exceptionally high in this assay. Thermotolerance should be performed in day 1 adult animals on standard agar plates, either at 34 °C or 37 °C. At 37 °C, a majority of death occurs between 7-11 hours, making this a simple single-day assay, whereas 12-16 hour experiments at 34 °C are most easily performed overnight (Figure 5C-E). Mutation in the gene, ttx-3, results in failure of specification of the AIY interneurons responsible for the thermosensory neural circuit, and causes a significant increase in thermosensitivity44. While thermotolerance data can be plotted as a survival curve (Figure 5C), these assays should be performed at least 4-6 times and all replicates should be plotted against each other (Figure 5D-E), as thermotolerance shows incredibly high variability in comparison to other stress assays. This is due to the many caveats that exist in setting up these experiments, including variability in strains of interest, unequal cycling of air in incubators, uneven agar plates, etc.21. At 34 °C, median survival occurs at approximately 14 hours, and similar to 37 °C, ttx-3 mutants exhibit decreased survival at 34 °C (Figure 5E).
Figure 1: Using hsp-4p::GFP as a reporter for UPRER induction. (A) Representative fluorescent micrographs of hsp-4p::GFP expressing animals grown on control empty vector (EV) or xbp-1 RNAi. Animals were grown on RNAi from hatch until L4 at 20 °C, then treated with 25 ng/µL tunicamycin or 1% DMSO floating in M9 at 20 °C for 4 hours, and recovered on an OP50 plate for 16 hours at 20 °C prior to imaging. Animals were paralyzed in 100 µM sodium azide on an NGM agar plate and imaged using a stereomicroscope. (B) Quantitative analysis of (A) using a large particle biosorter. Data is represented as integrated fluorescence intensity across the entire animal where each dot represents a single animal; DMSO control is in grey and tunicamycin treated animals are in red. Central line represents the median, and whiskers represent the interquartile range. n = 123-291 animals per strain. ***p < 0.001 using non-parametric Mann-Whitney testing. Please click here to view a larger version of this figure.
Figure 2: Using hsp-6p::GFP as a reporter for UPRMT induction. (A) Representative fluorescent micrographs of hsp-6p::GFP expressing animals grown on control empty vector (EV), cco-1, mrps-5, or nuo-4 RNAi. Animals were grown on RNAi from hatch and imaged on day 1 of adulthood at 20 °C. Animals were paralyzed in 100 µM sodium azide on an NGM agar plate and imaged using a compound microscope. (B) Quantitative analysis of (A) using a large particle biosorter. Data is represented as integrated fluorescence intensity across the entire animal where each dot represents a single animal; EV control is in grey RNAi-treated animals are in red. Central line represents the median, and whiskers represent the interquartile range. n = 303-384 animals per strain. ***p < 0.001 compared to EV control using non-parametric Mann-Whitney testing. (C) Representative images of hsp-6p::GFP animals treated with DMSO or Antimycin A. Animals were grown from hatch on 0.2% DMSO plates and transferred to plates containing 0.2% DMSO or 3 mM antimycin A for 16 hours prior to imaging on a Revolve ECHO R4 compound microscope. All growth was performed at 20 °C. (D) Quantitative analysis of (C) using a large particle biosorter similar to (B). DMSO controls are in great, and Antimycin A-treated animals are in red. n = 495 for DMSO and 219 for Antimycin A. ***p < 0.001 compared to EV control using non-parametric Mann-Whitney testing. Please click here to view a larger version of this figure.
Figure 3: Using gst-4p::GFP as a reporter for the OxSR. (A) Representative fluorescent micrographs of gst-4p::GFP expressing animals grown on control empty vector (EV), skn-1, or wdr-23 RNAi. Animals were grown on RNAi from hatch until L4 stage at 20 °C. Animals were grown on RNAi from hatch until L4 at 20 °C, then treated with 2 mM TBHP in M9 or only M9 for "untreated" control at 20 °C for 4 hours, and recovered on an EV plate for 16 hours at 20 °C prior to imaging. Animals were paralyzed in 100 µM sodium azide on an NGM agar plate and imaged using a compound microscope. (B) Quantitative analysis of (A) using a large particle biosorter. Data is represented as integrated fluorescence intensity across the entire animal where each dot represents a single animal; untreated control is in grey and TBHP-treated animals are in red. Central line represents the median, and whiskers represent the interquartile range. n = 101-204 animals per strain. ***p < 0.001 compared to respective EV control using non-parametric Mann-Whitney testing. Please click here to view a larger version of this figure.
Figure 4: Using hsp16.2p::GFP and hsp-70p::GFP as reporters for the heat-shock response. (A) Representative fluorescent micrographs of hsp16.2p::GFP expressing animals grown on control empty vector (EV) or hsf-1 RNAi. Animals were grown on RNAi from hatch at 20 °C until day 1. Day 1 animals were either left at 20 °C (untreated) or exposed to 2 hours of heat stress at 34 °C, then recovered for 2 hours at 20 °C. Animals were paralyzed in 100 µM sodium azide on an NGM agar plate and imaged using a stereomicroscope. (B) Quantitative analysis of (A) using a large particle biosorter. Data is represented as integrated fluorescence intensity across the entire animal where each dot represents a single animal; untreated control is in grey and heat-shocked animals are in red. Central line represents the median, and whiskers represent the interquartile range. n = 320-364 animals per strain. ***p < 0.001 using non-parametric Mann-Whitney testing. (C) Representative fluorescent micrographs of hsp-70p::GFP expressing animals grown on control EV and hsf-1 RNAi and treated as described in (A). (D) Quantitative analysis of (C) as described in (B). n = 773-941 animals per strain. Please click here to view a larger version of this figure.
Figure 5: Physiological survival assays under stress in C. elegans. (A) Lifespans of nematodes grown on 1% DMSO containing 25 ng/µL tunicamycin (TM) plates. Animals were grown on 1% DMSO plates from hatch until day 1, and transferred to respective TM plates at day 1. Animals were kept on control empty vector (EV) or xbp-1 RNAi from hatch until the end of the assay at 20 °C. Adult animals are manually moved away from progeny every day until ~ day 7-8 when progeny were no longer detected, then scored every 2 days until all animals were recorded as dead or censored. Animals with bagging, vulval protrusions/explosions, or those that crawled up the sides of plates were considered censored. (B) Survival curve of nematodes in 100 mM paraquat (PQ) dissolved in M9 solution. Animals were grown on EV or daf-2 RNAi from hatch until day 1 of adulthood at 20 °C. Animals were placed into 50 µL of M9 + PQ solution in a 96 well-plate at 20 °C and visualized every 2 hours until all animals were motionless. (C) Survival curve of nematodes at 37 °C. Wild-type (N2), ttx-3(KS5), and sur-5p::hsf-1 animals were grown on EV plates from hatch until day 1 at 20 °C. At day 1, animals were moved to 37 °C and scored every 2 hours until all animals were scored as dead or censored. (D) Pooled data of all thermotolerance assays performed at 37 °C. Data are represented as percent alive at hour 9 of a thermotolerance assay, with each line representing a matched experiment performed on the same day. (E) Pooled data of all thermotolerance assays performed at 34 °C. Data are represented as percent alive at hour 14 of a thermotolerance assay, with each line representing a matched experiment performed on the same day. All statistics for A-C were performed using Log-Rank (Mantel-Cox) testing and can be found in Table 5. Please click here to view a larger version of this figure.
Reagent | Recipe |
Lysogeny Broth (LB) | In this protocol, commercial LB was used (see Materials), but all standard LB home-made recipes using Bacto-tryptone, yeast extract, and NaCl are sufficient. |
Nematode Growth Media (NGM) | 1 mM CaCl2, 5 µg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl |
Bleach solution | 1.8% (v/v) sodium hypochlorite, 0.375 M KOH |
M9 solution | 22 mM KH2PO4 monobasic, 42.3 mM Na2HPO4, 85.6 mM NaCl, 1 mM MgSO4 |
NGM RNAi plates | 1 mM CaCl2, 5 µg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 µg/mL carbenicillin/ampicillin. Store at 4 ° C in dark for up to 3 months |
Tetracycline | 10 mg/mL stock solution (500x) in 100% ethanol. Store at -20 °C |
Carbenicillin | 100 mg/mL stock solution (1000x) in water. Store at 4 °C for up to 6 months or -20 °C for long-term storage |
Sodium azide | 1 M stock (~6.5%) stock solution of sodium azide in water. Store in the dark at 4 °C. This is a 10x solution and is diluted to a 100 mM working stock for most imaging experiments |
Tunicamycin | 2.5 mg/mL stock solution in 100% DMSO. Store at -80 °C for long-term storage. This is a 100x solution (25 ng/µL working solution) |
Antimycin A | 15 mM antimycin A stock solution in 100% DMSO. Store at -20 °C. This is a 5000x solution (3 µM working stock) |
Paraquat | 50 µM solution in water – should be prepared fresh |
Tert-butyl hydroperoxide (TBHP) | 7.7 M solution in water. This is a 3850x solution (2 mM working stock) |
NGM RNAi + DMSO0.2 | 1 mM CaCl2, 5 µg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 µg/mL carbenicillin/ampicillin, 0.2% DMSO |
(control for antimycin A) | |
NGM RNAi + antimycin A | 1 mM CaCl2, 5 µg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 µg/mL carbenicillin/ampicillin, 0.2% DMSO, 3 mM antimycin A |
NGM RNAi DMSO | 1 mM CaCl2, 5 µg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 µg/mL carbenicillin/ampicillin; 1% DMSO |
(control for tunicamycin) | |
NGM RNAi TM | 1 mM CaCl2, 5 µg/mL cholesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (w/v) agar, 0.25% (w/v) Bacto-Peptone, 51.3 mM NaCl, 1 mM IPTG, 100 µg/mL carbenicillin/ampicillin; 1% DMSO, 25 ng/µL tunicamycin |
IPTG | 1 M solution in water. |
Table 1: Recommended recipes for reagents used. All the exact recipes of the reagents used in this protocol are outlined here. Specific companies where reagents were purchased are also available in the Table of Materials. Many different sources of chemicals were tested, and those listed in the Table of Materials are those that exhibited the most robust and reproducible results.
Plate Size | Bacteria Type | # of animals to reach day 1 adulthood | # of animals to reach L4 stage |
60 mm | OP50 | 100-150 | 150-300 |
60 mm | HT115 | 70-100 | 120-200 |
100 mm | OP50 | 600-1000 | 1500-2000 |
100 mm | HT115 | 350-600 | 700-1300 |
Table 2: Recommended number of animals to plate post-synchronization to avoid starvation. To avoid starvation, we recommend plating a specific number of animals per condition. Since OP50 grows denser than HT115, more animals can be plated. All numbers listed here are the guidelines used in our lab, and numbers may be slightly different due to several variables and differences between laboratory conditions. Therefore, or recommended numbers are on the lower side in bold font. Max numbers are what could be plated in optimal conditions in our lab without reaching starvation, but it is not recommended to use these values without first titrating your conditions. All numbers are determined with the assumption that bacteria are seeded onto plates and allowed to grow for ~24 hours at ambient temperature (~22 °C) on plates prior to worms being placed on them. Although there is no major difference in starvation rates when plating eggs or L1s, we recommend plating ~10% higher numbers when plating eggs, since not all eggs will hatch post-bleaching.
Strain name | Transgene | Purpose | Recommended application(s) of stress | Source |
SJ4005 | hsp-4p::GFP | UPRER | 25 µg/mL tunicamycin | CGC |
SJ4100 | hsp-6p::GFP | UPRMT | 3 µM antimycin A; | CGC |
RNAi against ETC or mitochondrial ribosome | ||||
SJ4058 | hsp-60p::GFP | UPRMT | 3 µM antimycin A; | CGC |
RNAi against ETC or mitochondrial ribosome | ||||
CL2070 | hsp-16.2p::GFP | heat-shock response | 34 °C 2 hours | CGC |
AM446 | hsp-70p::GFP | heat-shock response | 34 °C 2 hours | Morimoto Lab |
CL2166 | gst-4p::GFP | OxSR | 50 mM paraquat; | CGC |
2 mM tert-butyl hydroperoxide | ||||
CF1553 | sod-3p::GFP | OxSR & insulin signaling | RNAi against daf-2 (insulin receptor) | CGC |
AU78 | T24B8.5p::GFP | innate immune response | pathogen exposure (e.g. P. aeruginosa) | CGC |
Table 3: Transcriptional reporters for assessing activation of cellular stress responses. The strains listed here are all available through CGC or through special requests to laboratories for use in both qualitative and quantitative imaging methods described in this manuscript. These strains are all derived from the Bristol N2 background. Recommended methods to apply stress to activate the reporters are also provided. All reporters, with the exception of sod-3p::GFP45 and T24B8.5p::GFP46 are described in the text.
Transgene | Recommended application(s) of stress | Exposure time using a Leica M2250FA stereo microscope | Exposure time using a Revolve ECHO microscope | PMT values using a Union Biometrica COPAS biosorter |
hsp-4p::GFP | 25 µg/mL tunicamycin (~4 hours with overnight recovery) | 200 ms | 275 ms | 450 |
hsp-6p::GFP | 3 µM antimycin A (~16 hours); | 100ms | 50 ms | 350 |
RNAi against ETC or mitochondrial ribosome (from hatch) | ||||
hsp-60p::GFP | 3 µM antimycin A (~16 hours); | 200 ms | 100 ms | 450 |
RNAi against ETC or mitochondrial ribosome (from hatch) | ||||
hsp-16.2p::GFP | 34 °C 2 hours | 400 ms | 200 ms | 500 |
hsp-70p::GFP | 34 °C 2 hours | 400 ms | 300 ms | 500 |
gst-4p::GFP | 50 mM paraquat (~2 hours); | 100 ms | 50 ms | 350 |
2 mM tert-butyl hydroperoxide (~4 hours with overnight recovery) | ||||
sod-3p::GFP | RNAi against daf-2 (insulin receptor) | 300 ms | 300 ms | 475 |
T24B8.5p::GFP | pathogen exposure (e.g. P. aeruginosa) | 100 ms | 50 ms | 350 |
Table 4: Recommended settings for fluorescent microscopy and quantification using a large particle biosorter. This table serves as guideline for recommended exposure times for fluorescent microscopy or PMT values for the large particle biosorter. These will serve as good starting points, but the exposure time and PMT value should be adjusted for every experiment to ensure that no saturation occurs and that fluorescent values are over the detection limit of background signal. If the sample with the brightest signal for an experiment is known (e.g., positive controls for stress induction), those samples can be used to determine the highest exposure time or PMT that can be used without saturating signal. If the brightest samples are not known, then the control can be used and an exposure time or PMT at the center of the dynamic range of your system can be used.
Corresponding Figure | Strain, Treatment | Median Lifespan | # Deaths/# Total | % change in median lifespan | p-value (Log-Rank; Mantel-Cox) |
5A | N2, vector RNAi, 1% DMSO | 22 days | 95/120 | — | — |
N2, xbp-1 RNAi, 1% DMSO | 14 days | 92/120 | -36.4 | < 0.001 | |
N2, vector RNAi, 25 ng/µL TM | 14 days | 97/120 | -36.4 | < 0.001 | |
N2, xbp-1 RNAi, 25 ng/µL TM | 12 days | 98/120 | -45.4 | < 0.001 | |
5B | N2, vector RNAi, 100 mM PQ | 5 hours | 73/73 | — | — |
N2, daf-2 RNAi, 100 mM PQ | 6.5 hours | 74/74 | 30 | < 0.001 | |
5C | N2, vector RNAi, 37 °C | 8 hours | 59/60 | — | — |
ttx-3(KS5), vector RNAi, 37 °C | 7 hours | 60/60 | -12.5 | 0.002 | |
sur-5p::hsf-1, vector RNAi, 37 °C | 9 hours | 59/60 | 12.5 | 0.012 |
Table 5: Statistics for lifespans and stress survival assays. All sample sizes, statistics, and censorship rates for Figure 5 are available here.
Stress Response | Target Gene | Forward Primer | Reverse Primer |
UPRER | hsp-3 | TCGCTGGATTGAACGTTGTTCG | GTTGCGTTCTCCGTCCTTCTTG |
UPRER | hsp-4 | GAACAACCTACTCGTGCGTTGG | GAACAACCTACTCGTGCGTTGG |
UPRER | sel-11 | TTGATCTCCGGAAAACGCAACG | TTGATCTCCGGAAAACGCAACG |
UPRER | ire-1 | TCCTCAACCGCTCCATCAACAT | TCCTCAACCGCTCCATCAACAT |
UPRER | xbp-1 | GGACTTCTTCGGCTTCTGGAGT | GGACTTCTTCGGCTTCTGGAGT |
UPRER | xbp-1 (spliced) | GGTGGATGGAGGGAGAAGATT | GGTGGATGGAGGGAGAAGATT |
UPRER | crt-1 | GAAGTAATAGCCGAGGGAAGC | GAAGTAATAGCCGAGGGAAGC |
UPRER | T14G8.3 | CACCTCCATCAACAACAACAT | CACCTCCATCAACAACAACAT |
HSR | hsp-17 | TCGTTTTCCACCATTCTCCCCA | TGTTTGATCGGCCCAGTATGGT |
HSR | hsp-70 | TGTTTGATCGGCCCAGTATGGT | TTCGCAATGAGAAGGGACGACT |
HSR | F44E5.4 | TTCGCAATGAGAAGGGACGACT | CGTTGTGCTGCGTCTTCTCTTT |
HSR | hsp-16.2 | TCCATCTGAGTCTTCTGAGATT GTTA |
TGGTTTAAACTGTGAGACGTTGA |
HSR | hsf-1 | TTTGCATTTTCTCGTCTCTGTC | TCTATTTCCAGCACACCTCGT |
UPRMT | hsp-6 | GAGATCGTGGAACCGGAAAGGA | CGGCATTCTTTTCGGCTTCCTT |
UPRMT | hsp-60 | CGGCATTCTTTTCGGCTTCCTT | CGTCGTTGCAGAGCTCAAGAAG |
UPRMT | ymel-1 | CAAAACCTGATCTCGCTGGG | TTCTCAATGTCGGCTCCAGT |
UPRMT | clpp-1 | TGATAAGTGCACCAGTGTCCA | TGATTCTGGAGTTCGGGAGA |
UPRMT | lonp-1 | CGATGATGGCCATTGTGCAG | CGCTTTGAAACATCAATTTCAT CCA |
OxSR | gst-4 | GATGCTCGTGCTCTTGCTG | CCGAATTGTTCTCCATCGAC |
OxSR | gst-6 | CCGAATTGTTCTCCATCGAC | TTTGGCAGTTGTTGAGGAG |
OxSR | gst-7 | TTTGGCAGTTGTTGAGGAG | TGGGTAATCTGGACGGTTTG |
OxSR | gcs-1 | TGGGTAATCTGGACGGTTTG | ATGTTTGCCTCGACAATGTT |
OxSR | skn-1 | GGACAACAGAATCCCAAAGG | TCAGGACGTCAACAGCAGAC |
OxSR | sod-3 | GTAACGGGCGATAGCATGAG | GCGAGAGCACATTGATGAC |
OxSR | ptps-1 | AATCGATTCCTTTGGAGACC | CAATCTACTGCTCGCACTGCTT CAAAGC |
reference | pmp-3 | TGGCCGGATGATGGTGTCGC | ACGAACAATGCCAAAGGCCAGC |
reference | Y45F10.4 | CGAGAACCCGCGAAATGTCGGA | CGGTTGCCAGGGAAGATGAGGC |
reference | sap-49 | TGGCGGATCGTCGTGCTTCC | ACGAGTCTCCTCGTTCGTCCCA |
reference | tba-1 | TCAACACTGCCATCGCCGCC | TCCAAGCGAGACCAGGCTTCAG |
Table 6: Recommended gene targets and primer pairs for measuring transcriptional upregulation of stress response genes.
Here, methods to interrogate cellular stress responses in C. elegans, using fluorescent transcriptional reporters and physiological stress survival assays are described. The reporters all utilize GFP expression driven under the promoter of a downstream transcriptional target of the transcription factors involved in mounting cellular stress responses. The use of hsp-4p::GFP modulated by XBP-1s-mediated UPRER, hsp-6p::GFP controlled by ATFS-1-mediated UPRMT, gst-4p::GFP under SKN-1-mediated OxSR, and hsp16.2p::GFP and hsp-70p::GFP under HSF-1-mediated heat-shock response are explained. Other standardized transcriptional reporters can be found in Table 3. All the transcriptional reporters presented here have a wide dynamic range and can be robustly activated by applying stress either through genetic perturbations or exposure to stress-inducing chemicals. Moreover, these reporters can all be suppressed by knockdown of the transcription factors upstream of the promoters employed. Finally, each transcriptional reporter is paired to a specific physiological stress survival assay to provide a physiological readout of the impact of either activating or repressing a specific stress response.
To successfully employ the use of transcriptional reporters, it is essential to determine the dynamic range of each reporter. Due to major lab-to-lab variability caused by differences in media, agar, ambient environment, etc., it is recommended to titrate each drug or stress induction paradigm for concentrations and timing using our recommendations as a baseline. Next, it is critical to ensure the animals are healthy and properly synchronized. Animals that have experienced some sort of stress (e.g., starvation, long-term exposure to light, exposure to elevated temperature, etc.) should be recovered for several generations prior to experimentation. Proper synchronization can be achieved by using the methods outlined in section 2, which is essential as several stress responses have different levels of activation during the aging process. Finally, imaging protocols are essential to standardize, as there are various things that can affect image and data quality. For example, duration of animals in sodium azide should be minimized, as this causes stress to animals and can affect reporter signal. Moreover, microscope and biosorter specifications should be properly set to maximize signal-to-noise ratio and dynamic range, without causing saturation. Saturated pixels can cause major issues in quantitative analysis of samples, as maximum fluorescent signal can be severely underestimated.
While the transcriptional reporters described here provide a robust and efficient means to measure activation of stress responses, it is critical to understand that it is a single gene target of a known transcription factor. Therefore, while it serves as a reliable method for large-scale screens or first-pass tests of strains of interest, proper validations should be performed. We recommend performing qPCR to measure several canonical target genes activated upon induction of each stress response being assayed. A list of suggested gene targets can be found in Table 6. In addition, transcriptome profiling through RNA-seq is another alternative for a broader look at effects on multiple transcriptional targets at once. Of particular note, the imaging of fluorescent reporters provides spatial information regarding tissues that are affected by the perturbations. Such information cannot be obtained from qRT-PCR or RNA-seq, as it uses whole-worm extracts, except by scRNA-seq, FISH, and tissue-specific RNAseq protocols47. Finally, these stress reporters are generally characterized as being specific to their stress response machinery. However, it is important to remember that not all stress response paradigms are unique and distinct. For example, ER stress can activate OxSR and vice versa48, and overlaps between heat-shock response and ER stress responses have been commonly found49. These are just a few of the many examples in the literature of cross-communication and overlap between stress responses, and thus it is important to understand that all assays should also be tested for specificity to derive final conclusions.
Another limitation of the methods described are that imaging and quantification through a biosorter has limited throughput. While biosorter quantification can be performed in 96-well plates for higher throughput, it is still limited by the necessity to transfer worms into solution, whereas imaging is limited by the investigator's capacity to prepare worms and perform microscopy. Therefore, large-scale screens will most likely involve only a visual screening of fluorescent reporter signal, with only hits being imaged and quantified.
An important caveat with using these fluorescent reporters is that activation or suppression of stress responses do not always contribute to physiologically meaningful phenotypes, or may reflect other global effects (e.g., decrease in protein synthesis). Therefore, every transcriptional reporter is paired to a method to assay stress survival. It is recommended to perform tunicamycin survival assays for the UPRER, paraquat survival assays for the UPRMT and the OxSR, and survival in elevated temperatures for the heat-shock response. While these are generally robust, fast, and simple assays, they require intensive manual labor, and thus are severely limited in scalability. Moreover, almost all thermotolerance assays published to date have major variability, making a large number of replicates almost essential21. While the tunicamycin and paraquat survival assays do not suffer from this lack of reproducibility, they have their own challenges, including extensive hands-on labor and duration of the protocol. As new technologies are born in automating lifespan and survival assays, it is likely that these stress survival assays can also become high-throughput50. However, until these automated assays become standard, survival assays are currently limited to validation of physiological consequences in altering dynamics of stress response activity.
Beyond the stress survival assays described here, there are a number of other methods to measure physiology in animals. For example, a commercially available Seahorse XFp Analyzer can allow monitoring of cellular respiration, which provides additional mechanistic insight51. Another alternative to transcriptional reporters is the use of nuclear localization of fluorescently labelled transcription factors. There are numerous variants of this technique, but of particular interest to the methods described here include: HSF-1::GFP for the heat-shock response52, DVE-1::GFP for the UPRMT53, and DAF-16::GFP and SKN-1::GFP for the OxSR54,55. Finally, direct interrogation of morphology of specific organelles of interest can be performed. For example, mitochondrial morphology can be visualized by utilizing a fluorophore targeted to the mitochondrial matrix using a mitochondrial-localization sequence56. ER morphology can be visualized by utilizing a fluorophore targeted to the ER through a signal-sequence fused to the N-terminus and HDEL fused to the C-terminus57 or GFP fused to an ER membrane protein58. Finally, actin cytoskeletal integrity can be used as a proxy for thermal stress sensitivity downstream of HSF-1. The actin cytoskeleton is regulated by transcriptional targets of HSF-1, specifically during aging and heat-stress, and thus actin organization can be visualized to determine functional readout of HSF-1 and heat-related stress59,60.
All of the methods described here can be used independently or in combination with each other for a comprehensive analysis of genes or drugs of interest and their impact on stress response. Large-scale screens can be performed using high-throughput transcriptional reporter assays, and secondary screens can be performed using quantitative analyses of these reporters. Once more manageable candidate gene/drug lists are identified, physiological assays can be performed to identify those candidates that have direct impact on whole animal physiology. The other methods suggested above can also be used as validation or further investigation.
The authors have nothing to disclose.
R.BZ. is supported by the EMBO long term fellowship and The Larry L. Hillblom Foundation. R.H.S is supported by grant 5F32AG032023-02 through the National Institute of Aging (NIA) and the Glenn Foundation for Medical Research Postdoctoral Fellowship. A.F. is supported by grant F32AG051355 through the NIA. H.K.G. is supported by grant DGE1752814 through the National Science Foundation Graduate Research Fellowship Program. M.G.M. is supported by 1F31AG060660-01 through NIA. A.D. is supported by the Thomas and Stacey Siebel Foundation, the Howard Hughes Medical Institute, and 4R01AG042679-04 and 5R01AG055891-02 from NIA, and 5R01ES021667-09 from NIEHS. We thank Larry Joe, Melissa Sanchez, Naame Kelet, and Anel Esquivel for significant technical assistance. We thank the Morimoto lab and the CGC (funded by NIH Office of Research Infrastructure Program P40 OD010440) for strains.
Antimycin A | Sigma-Aldrich | A8674 | for mitochondrial stress |
Bacto Peptone | Fisher Scientific | DF0118072 | for NGM plates |
BD Difco granulated agar | VWR | 90000-782 | for NGM plates |
Calcium chloride dihydrate | VWR | 97061-904 | for NGM plates |
Carbenicillin | BioPioneer | C0051-25 | for RNAi |
Cholesterol | Sigma-Aldrich | 57-88-5 | for NGM plates |
COPAS Biosorter | Union Biometrica | 350-5000-000 | equipped with a 488 nm light source. |
COPAS Cleaning Solution | Union Biometrica | 300-5072-000 | to use with COPAS |
COPAS Sheath Solution | Union Biometrica | 300-5070-100 | to use with COPAS |
DMSO | Sigma-Aldrich | 472301 | solvent for drugs |
IPTG dioxane free | Denville Scientific | CI8280-4 | for RNAi |
LB Broth Miller | Fisher Scientific | BP1426500 | for LB |
M205FA stereoscope | Leica | 10450040 | equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software |
Magnesium sulfate heptahydrate | VWR | EM-MX0070-3 | for NGM plates, M9 |
Paraquat | Sigma-Aldrich | 36541 | for oxidative/mitochondrial stress |
Potassium Chloride | Fisher | P217-500 | for bleach soluton |
Potassium phosphate dibasic | VWR | EM-PX1570-2 | for NGM plates |
Potassium phosphate monobasic | VWR | EM-PX1565-5 | for M9 |
Revolve | ECHO | 75990-514 | equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software |
Sodium Azide | Sigma-Aldrich | 71289-50G | for imaging |
Sodium Chloride | EMD Millipore | SX0420-5 | for NGM plates, M9 |
Sodium phosphate dibasic | VWR | 71003-472 | for M9 |
Tert-butyl hydroperoxide | Sigma-Aldrich | 458139 | for oxidative stress |
Tetracycline hydrochloride | Sigma-Aldrich | T7660-5G | for RNAi |
Tunicamycin | Sigma-Aldrich | T7765-50MG | for ER stress |