Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

חיטוט mRNA קינטיקה בחלל וזמן ב Escherichia קולי באמצעות שני צבעים פלואורסצנטיות מולקולה אחת ב סיטו הכלאה

doi: 10.3791/61520 Published: July 30, 2020

Summary

פרוטוקול זה מתאר יישום של פלואורסצנטיות מולקולה אחת בהכלאה situ (smFISH) כדי למדוד את הקינטיות vivo של סינתזה mRNA והשפלה.

Abstract

פלואורסץ מולקולה אחת בהכלאה סיטו (smFISH) מאפשר לספור את המספר המוחלט של mRNAs בתאים בודדים. כאן, אנו מתארים יישום של smFISH כדי למדוד את שיעורי שעתוק והשפלה mRNA ב Escherichia קולי. כמו SmFISH מבוסס על תאים קבועים, אנו מבצעים smFISH בנקודות זמן מרובות במהלך ניסוי קורס זמן, כלומר, כאשר תאים עוברים שינויים מסונכרנים על אינדוקציה או דיכוי של ביטוי גנים. בכל נקודת זמן, תת-אזורים של mRNA הם ייחודיים ספקטרלית כדי לחקור את ההתארגה תמלול וסיום מוקדם. התוצאה של פרוטוקול זה מאפשרת גם ניתוח התאמה מקומית תאית של mRNAs והטרוגניות במספרי עותק mRNA בין תאים. באמצעות פרוטוקול זה דגימות רבות (~ 50) ניתן לעבד בתוך 8 שעות, כמו משך הזמן הדרוש רק כמה דגימות. אנו דנים כיצד להחיל פרוטוקול זה כדי ללמוד את התמלול והשפלה קינטיקה של mRNAs שונים בתאים חיידקיים.

Introduction

זרימת המידע הגנטי מ-DNA ל-mRNA וחלבון היא אחד התהליכים הסלולריים הבסיסיים ביותר, שהרגולציה שלהם חשובה לכושר תאי1. מספר mRNAs בתא נקבע על-ידי שני תהליכים דינמיים, שעתוק והשפלה של mRNA. עם זאת, איך שעתוק והשפלה mRNA מוסדרים בזמן ובמרחב של תא אחד נשאר לא לגמרי מובן, בעיקר בשל המחסור בשיטות ניסיוניות כדי למדוד כמותית הקינטיקה שלהם vivo.

שיטות המבוססות על mRNAs הכולל שחולצו מאוכלוסייה של תאים, כגון כתם צפוני, RT-PCR, רצף RNA, ומיקרו-מערך ביטוי גנים, יכול למדוד את ההבדל היחסי ברמות mRNA והיה בשימוש נרחב כדי לנתח את קצב התאווותשעתוק 2,3,,4,5 או שיעורהשפלהmRNA 6,7., עם זאת, הם אינם מספקים את המספר המוחלט של mRNAs לכל תא, ולכן, הם אינם מתאימים לתביעת קצב אתחול שעתוק8. כמו כן, מאחר mRNAs מופקים מאוכלוסייה של תאים, התפלגות מרחבית של mRNAs בתוך תא יחיד ואת השונות של מספרי עותק mRNA בין תאים אין אפשרות למדוד.

רצף RNA מהדור הבא בתאים בודדים (scRNAseq) יכול לכמת את מספר mRNAs לכל תא בקנה מידה גנומי9. עם זאת, קשה להשתמש בטכניקה זו כדי למדוד קינטיקה שעתוק, בשל אתגרים עם הכנת מדגם ועלות גבוהה. בפרט, היישום של scRNAseq לחיידקים היה קשה מבחינה טכנית בשל שפע mRNA נמוך10,11.

פלואורסצנטיות מולקולה אחת ב- situ hybridization (smFISH) מבוססת על הכלאה של גשושים בעלי תווית פלורסנטית חד-גדילית אשר רצפיהם משלימים את mRNA היעד שלעניין 12,13. הרעיון של הכלאה ספציפית לרצף דומה לזה המשמש כתם צפוני או RT-PCR, אבל הכלאה נעשית ב- situ בתוך תאים קבועים, כדי לשמר את התיור המקומי של mRNAs. האות של mRNA יחיד מוגבר באמצעות גששים רבים, ~ 20 נוקלאוטידים (nt) באורך, הכלאה לחלקים שונים של mRNA (איור 1A)13. בגישה זו "ריצוף" גשושית, מספר הגששים הדרושים כדי לזהות mRNA יחיד קובע מגבלה נמוכה יותר על אורך mRNA שניתן לומר. לחלופין, mRNA של עניין עשוי להיות תעתיק התמזגו למערך שאינו קידוד של רצפי מפעיל Lac טנדם, כך עותקים מרובים של בדיקה lacO תיוגנתנת להכלאה mRNA יחיד (איור 1B)14.

SmFISH שימש לכמת את מספר mRNAs לכל תא במצב יציב (כלומר, כאשר סינתזה וריקבון נמצאים באיזון) ולנתח את ממוצע ושונות של mRNAs בקרב תאיםחיידקיים 15,16,17. לאחרונה, SmFISH הוחל לכמת מספרי mRNA במצב לא יציב, מיד לאחר אינדוקציה או דיכוי של ביטוי גנים ב E. coli18,19,20. השינויים הזמניים במספרי עותק mRNA המוחלט שימשו לאחר מכן לחישוב קצב אתחול שעתוק, ההתארה, וסיום, כמו גם את קצב ההשפלה mRNA. עבור יישום זה, הליכי SmFISH קונבנציונליים יכולים להיות מסורבלים כי ישנן דגימות רבות, כל אחד מייצג נקודת זמן אחת, כי צריך לעבור שלבים חילופי מאגר מרובים (כלומר, צנטריפוגציה ושטיפה). כאן, אנו מתארים פרוטוקול smFISH, שבו שלבי טיפול מדגם הם פשטו באופן דרמטי על ידי כך שיש תאים דבוקים על פני השטח של כיסוי ועל ידי שאיפה נוזלים עם מערכת סינון ואקום14,19. באמצעות הביטוי lacZ ב- E. coli כדוגמה, זרימתהעבודה המלאה (איור 2)מדגימה, כולל ניתוח תמונה ( איור 3 ) המניב את הקינטיקה vivo של שעתוק(אתחול,התאווה וסיום) והשפלה mRNA, השתנות מתא לתא בביטוי mRNA, ומיקום mRNA. אנו צופים כי הפרוטוקול ישים באופן נרחב לבדיקה בקינטיות vivo ויציקה של mRNAs אחרים במין חיידקים שונים.

Protocol

1. הכנת גשושי SMFISH

הערה: כדי לתייג בדיקות smFISH עם פלואורופור יחיד, בצע פרוטוקול סטנדרטי לסימון חומצה נוכי אוליגונוקליידים המבוסס על הכימיה אסתר NHS21.

  1. תכנן גשושי SMFISH. החלט אם להשתמש בבדיקות "ריצוף" או בבדיקות "מערך"(איור 1)עבור גן העניין. עיין בסעיף דיון כיצד לקבל את ההחלטה.
    1. עבור בדיקות "ריצוף"(איור 1A),השתמש בכלי מעצב בדיקה מקוון (לדוגמה, ראה טבלת חומרים).
    2. עבור גשושי "מערך"(איור 1B),לבצע חיפוש רצף BLAST כדי לוודא כי רצף הגשוש אינו משלים כל רצפי mRNA אחרים.
    3. כדי ללמוד לקז mRNA תעתיק והשפלה קינטיקה, להשתמש בשני סטים של 24 בדיקות, כל קבוצה מכסה הראשון והאחרון 1 kb אזורים של lacZ (3,072 bp)19.
      הערה: ערכות בדיקה אלה נקראות להלן "גשושית mRNA של 5 אינם" ו-"3' mRNA", בהתאמה. רצפים של גששים אלה מפורטים בטבלת החומרים.
  2. סדר רצפי בדיקה כמו oligonucleotides DNA עם מקשר אמינו C6 בקצה 5 '. להמיס גששים בודדים במים ל-1 מ"מ.
  3. שלב כמויות שיווי משקל של גשושים עבור ערכות "5' mRNA" ו-"3' mRNA probe". לדוגמה, עבור הגשושית mRNA 5 ' להגדיר lacZ, לשלב 20 μL של כל בדיקה (בסך הכל 24 סוגים של בדיקות בסט).
  4. לבצע משקעיםאתנול 22 של בדיקות משולבות כדי להסיר את כל הזיהמים של אמין ראשוני ומשני (כגון Tris, גלצין, מלחי אמוניום) שיכול לעכב את תגובת ההתייחדות. בסופו של דבר, להמיס את כדור ה-DNA ב 100 μL של מים (מניב ~ 4.5 mM של DNA ב סט בדיקה).
    הערה: שלב זה מומלץ גם אם הגששים עברו טיהור התפלה סטנדרטי על ידי היצרן. טיהור מבוסס מסנן סטנדרטי עשוי לעבוד במקום ובנוסף למשקעים אתנול.
  5. בחר שני פלואורופורים שונים ספקטרליים עם moiety NHS אסטר חד תכליתי, כך 5 ' ו 3' mRNA ערכות בדיקה ניתן לתייג באופן דיפרנציאלי. לדוגמה, הכן את Cy5 NHS אסתר עבור בדיקות mRNA של 5 אינץ' ו-Cy3B NHS אסתר עבור בדיקות mRNA של 3 אינץ'. להמיס כל סוג של פלואורופורים ב DMSO anhydrous עד הסופי 20 מ"ג / מ"ל (~ 25 מ"מ).
  6. הכן 0.1 M נתרן ביקרבונט (pH 8.5) ממש לפני כל תגובת תיוג. חשיפה לאוויר במשך זמן רב תוריד את ה-pH שלה ותפחית את יעילות התיוג.
  7. לתגובת ההתייחדות, שלבו את הדברים הבאים: 15 μL של מלאי הפלואורופור Cy5 (משלב 1.5), 4 μL של 5' mRNA גשושית להגדיר (משלב 1.4), 75 μL של נתרן ביקרבונט (משלב 1.6), ו 7 μL של מים. עוטפים את הצינור בנייר אלומיניום ומנערים בטמפרטורת החדר במשך 3-6 שעות.
    הערה: דגירה ארוכה יותר אינה בהכרח לגרום ליעילות תיוג גדולה יותר. כמו כן, ניתן לשנות את קנה המידה של התגובה למעלה או למטה אם ריכוזי הרכיבים נשמרים.
  8. חזור על השלב לעיל עבור 3 ' mRNA גשוש להגדיר ואת הפלואורופור המתאים (כלומר, Cy3B NHS-אסתר).
  9. לבצע משקעיםאתנול 22 כדי להסיר מולקולות צבע שלא הגיבו. המס את הגלולה ב- ~ 50 μL של מאגר TE (10m Tris-HCl pH 8.0 עם EDTA 1m).
  10. להעריך את הריכוזים של DNA ופלואורופור באמצעות ספקטרומטר UV-Vis.
    1. מדוד את הספיגה ב- 260 דפים לאמצעים ו- 559 דפים לאמצע (Cy3B) או 649 דפים לאמצע (Cy5). אם המדגם מרוכז מדי כדי להניב מדידה מדויקת, לדלל 1 μL של המדגם כדי 10 μL.
    2. המר את הספיגה לריכוז:
      Equation 1
      Equation 2
      Equation 3
      εDNA = 0.2 μM-1 (עבור 20-nt DNA חד-גדיל), εCy5 = 0.25 μM-1, ו εCy3B = 0.13 μM-1
      הערה: [DNA] הוא הריכוז של בדיקות סה"כ בתוך הפתרון. הריכוז של גששים בודדים הוא כ 24x נמוך יותר. הריכוז של הגששים הכולל ישמש כ"ריכוזי גשושים" מנוקודה זו. אם היחס בין [DNA] לבין [dye] הוא 1, ניתן לדלג על שלב HPLC הבא23, ויש לדלל את הדגימה ל- 4-5 μM הסופי במאגר TE.
  11. (מומלץ) מומלץ) טהר את הגששים המסויגים מבדיקות ללא תווית וצבעים חופשיים באמצעות HPLC.
    הערה: למרות שצעד טיהור נוסף זה יוביל לאובדן מדגם, הוא מועיל עבור יישומים במורד הזרם. הסרת בדיקות דנ"א ללא תייגת תג תגביר את אות הפלואורסץ ממטרות mRNA והסרת צבעים לא מצונזרים תפחית את פלואורסץ הרקע.
    1. הכן את HPLC עם עמודת C18 אנליטית סטנדרטית, טריאתילמוניום אצטט ב- 0.1 M (TEAA) כמאגר A, ואצטוניטריל כמאגר B.
    2. הוסף 1 M TEAA לדגימה (מ שלב 1.9) כדי להפוך 0.1 M TEAA.
    3. הגדר את תוכנית מעבר הצבע כדלקמן: 0-5 דקות עם 0% B, 5-35 דקות עם מעבר צבע ליניארי של 0-30% של B, 35-37 דקות עם מעבר צבע ליניארי של B, ו- 37-40 דקות עם 0% B. שמור על קצב הזרימה של 0.1 מ"ל/דקה וכרומטוג כרומטוגרם ב- 260 ו- 649 מילימטרים (עבור דגימות עם תוויות Cy5) או ב- 260 ו- 559 מילימטרים (עבור דוגמאות עם תוויות Cy3B).
    4. לאסוף את הדגימה המצומקת כאשר הספיגה גדלה הן ב-DNA והן בערוצים פלואורופור.
    5. רכזו את הדגימה המצומקת באמצעות ריכוז ואקום והשעו מחדש את הגלולה במאגר μL TE של 50-100.
  12. בדוק את הריכוז של DNA ופלואורופור באמצעות ספקטרומטר UV-Vis (ראה שלב 1.10). דילטו, במידת הצורך, כדי לבצע ריכוז סופי סביב 4-5 μM. לאחסן את הגששים ב -20 ° C

2. הכנת פתרונות

  1. הכן נפח גדול של מים ומאגרים שטופלו ב-DEPC(טבלה 1). פתרונות אלה יכולים להימשך יותר משנה בטמפרטורת החדר.
  2. הכנת פתרון תיקון 4x ופתרון כביסה(טבלה 1).
  3. הכן את פתרון טרום-הכלאה ופתרון הכלאה בדיקה(טבלה 1). הכן את פתרון ההיברידיזציה של הגשושית במהלך הדגירה בשלב 5.1 או שלב 6.1 ולאחר מכן שמור את הפתרון בשייקר נגדי של 37°C למשך 20-40 דקות עם כיסוי כדי למזער את החשיפה לאור.
    הערה: הריכוזים של formamide, SSC, ובדיקה היו אופטימיזציה עבור ערכות בדיקה lacZ כדי למזער את פלואורסצנציה ברקע תוך מקסום האות האמיתי. עיין בסעיף דיון לקבלת פרטים אודות אופן שינוי ריכוזים אלה עבור יישומים שונים.

3. הכנת כיסויים ושקופיות זכוכית

  1. כיסויים נקיים ושקופיות זכוכית.
    1. מניחים כיסויים ושקופיות בודדים בצנצנת קופלין באמצעות מפלצות. ודא כי כיסויים ושקופיות מופרדים ולא נוגעים זה בזה.
    2. ממלאים את הצנצנת ב-100% אתנול וסוו את המכסה. מניחים את הצנצנת במנקה אולטראסוניות אמבט מים sonicate במשך 15-20 דקות.
      הערה: עבור sonicator אמבט מים, מומלץ לכבות את פונקציית התנור.
    3. יוצקים אתנול ושוטפים עם מים אולטרה-תוחמים פי 3-4. השתמש במים הזורמים ישירות ממכונה טיהור המים.
    4. יוצקים את המים מהצנצנת וממלאים אותם ב-70% אתנול. סוגרים את המכסה ומבצעים sonication במשך 15-20 דקות ולשטוף עם מים אולטרה פורים.
    5. ממלאים את הצנצנת במים אולטרה-תכליתיים וsonicate במשך 15-20 דקות.
      הערה: ניתן לשמור כיסויים ושקופיות זכוכית למשך הלילה בצנצנת קופלין מלאה במים אולטרה-פורים.
    6. קח מגלשה או כיסוי מתוך צנצנת קופלין באמצעות מפוחיות נקיות ויבש אותה באמצעות גז N2. חזור על פעולה זו עבור השקופיות והכיסויים הנותרים.
  2. מקם את השקופיות המיובשות בתיבת אחסון נקייה עד לשימוש בשלב 7.5. מניחים את כיסויי המיובשים בתיבת קצה ריקה של 1,000 μL pipette, אשר תשמש כ"תא" בהליך הנותר.
  3. באמצעות סמן הידרופובי, צייר עיגולים על הכיסויים בעקבות חורים עגולים בתיבת העצה של פיפטה. עיגולים אלה (קוטר של כ-0.5 ס"מ) ישמשו כ"בארות". המתן לפחות 5-10 דקות כדי שהסמן ייבש לחלוטין.
    הערה: שמור תמיד את המכסה של תיבת העצה סגור.
  4. למרוח ירידה של 20-μL של 0.1% פולי-L-לינזין על כל באר. דגירה במשך 10-50 דקות בטמפרטורת החדר.
    הערה: כוונן אמצעי אחסון זה בהתאם לגודל הבאר. ודא שהפתרון מכסה לחלוטין את אזור הבאר. לצורך דגירה ארוכה יותר, היזהרו להימנע מהתאיידות.
  5. לאחר דגירה aspirate poly-L-לינזין מבלי לגעת על פני השטח כמו זה יהיה לגרד את פולי-L-לינזין את. לאחר מכן להחיל טיפה (~ 20 μL) של מים DEPC על בארות פולי-L-לינזין מטופל. סגור את המכסה של ה"תא" כדי למנוע אידוי עד שלב 5.1.

4. ניסוי בזמן וקבעון מדגם

  1. לגדול תאי E. coli ב ~ 20 מ"ל תרבות נוזלית בקבוקון 250 מ"ל. יש לשמור את הבקבוקון בשייקר אמבט מים (30°C) ולהמשיך לרעוד. עצור את השייקר רק בעת נטילת דגימות.
    הערה: התוצאות המוצגות בנייר זה מתקבלות מ MG1655 תאים גדל M9 בינוני מינימלי בתוספת עם 0.2% גליצטרול, 0.1% חומצות casamino, ו 1 מ"ג / L תיאמין לשלב צמיחה מעריכית (OD600~ 0.2).
  2. להוסיף 250 μL של פתרון תיקון 4x בצינור ריק 1.5 מ"ל. חזור והכן צינורות מרובים, ככל נקודות הזמן שיש לקחת. תייגו את הצינורות עם מספרי נקודות זמן ולשמור אותם בטמפרטורת החדר.
  3. קח 750 μL של תרבות התא (OD600~ 0.2) לפני תחילת ניסוי קורס זמן. הוסף את התרבות לצינור המסומן עבור "זמן אפס" (מתוך שלב 4.2). הפוך את הצינור בעדינות כדי לערבב תאים עם פתרון התיקון.
    הערה: אין לערבב, למערבולת או "להיות קשוח" בתאים. מדגם זה מייצג את המצב מודחק וישמש כפקד לחישוב עוצמת הפלואורסץ של mRNA יחיד (ראה שלב 9.4).
  4. הוסף 0.02-1 mM של isopropyl β-D-1-thiogalactopyranoside (IPTG) לתרבות הנוזלית כדי לגרום ביטוי lacZ. התחל טיימר בשלב זה (t = 0 דקות) וטעום במרווח זמן מסוים (לדוגמה, כל 1 דקות) מאז. לדגום, חזור על שלב 4.3.
  5. הוסף 5 m orthonitropheynl-β-D-fucopyranoside (ONPF) או 500 mM גלוקוז24 בזמן מסוים במהלך הניסוי קורס זמן (למשל ב t = 1.5 דקות) כדי לדכא ביטוי lacZ. לאחר דיכוי מחדש, המשך לדגום את התרבויות (שלב 4.3) כדי לעקוב אחר השפלה של mRNA.
    הערה: הדחקה יכולה להיעשות גם עם ~ 400 μg / mL rifampicin, מעכב חניכהשעתוק 25.
  6. לצורך קיבעון, דגירה את הצינורות המכילים תאים שנדגמו בטמפרטורת החדר במשך 15 דקות, ואחריו דגירה בקרח במשך 30 דקות.
  7. כדי להסיר את התיקון, צנטריפוגה הצינורות ב 4,500 x g עבור 4 דקות בטמפרטורת החדר. הסר את הסופרנטנט עם פיפטה.
    הערה: הקפד להשליך פורמלדהיד במיכל פסולת נפרד תעקב אחר פרוטוקול הבטיחות.
  8. הוסף 1 מ"ל DEPC-PBS ולהשעות מחדש את התאים. חזור על צנטריפוגציה והשעיה מחדש פי 2 יותר.
    הערה: תאים קבועים הם שבריריים וצריכים טיפול עדין. בזהירות להשעות מחדש את הכדור ולהימנע בועות.
  9. לאחר שלב השטיפה הסופי, להשעות מחדש תאים ב ~ μL DEPC-PBS.

5. חריצות של קרום התא

  1. למרוח כל דגימה נקודת זמן על בארות שונות על כיסוי (~ 30 μL לכל באר). המתן 10-30 דקות בטמפרטורת החדר לתאים לדבוק על פני השטח. הימנע ממיזוג של טיפות הנוזל בין בארות.
  2. כדי לשטוף את התאים לא מאוגדים, לשאוף את הנוזל ולהחיל ~ 20 μL DEPC PBS על כל באר. Aspirate DEPC PBS בתוך כמה דקות.
  3. לחלחל את קרום התא על ידי החלת 15 μL של 70% אתנול לכל באר במשך 4 דקות. לשאוף אתנול לאחר 4 דקות, ולוודא כי בארות יבשים לחלוטין.
    הערה: זה קריטי להגביל את הטיפול אתנול במשך 4 דקות. טיפול ארוך יותר יגרום ליציבות יתר.
  4. למרוח 30 μL של פתרון השטיפה על כל באר.

6. הכלאה בדיקה

  1. שאף את תמיסת הכביסה מכל באר. החל 30 μL של פתרון טרום הכלאה לכל באר. מדגירה את התא בתנור 37 °C במשך 30 דקות.
    הערה: הוסף ~ 50 מ"ל של מים לתחתית התא כדי לספק לחות.
  2. שאף את פתרון טרום-הכלאה מכל באר. החל ~ 30 μL של פתרון hybridization בדיקה לכל באר. מכסים את התא בנייר אלומיניום ומדגירה בתנור 37 מעלות צלזיוס במשך 2 שעות.
    הערה: ודא כי פתרון hybridization בדיקה הוא 37 °C countertopr לפני שלב זה. הימנע ממיזוג נוזלים בין בארות. החל נפח קטן יותר של הפתרון על כל באר, במידת הצורך.

7. שטיפה והכנה לאחר הכלאה להדמיה

  1. באמצעות פיפטה רב ערוצית, להחיל ~ 30 μL של פתרון לשטוף על כל באר בבת אחת. לשאוף ולחזור 3-5x פעמים של כביסה. מדגירה את התא בתנור 37°C במשך 15-30 דקות.
  2. חזור על שלב 7.1 פעמיים נוספות.
  3. לשטוף כל באר עם DEPC-PBS 5x פעמים. בצע את השיטה המשמשת בשלב 7.1 אך דלג על תהליך הדגירה.
  4. שאפף את הנוזל מהכיסוי. למרוח 4 μL של DEPC-PBS על כל באר.
  5. בעזרת משקולות, הרם והופך את הכיסוי, והיפץ אותו בעדינות על מגלשת זכוכית (מ- שלב 3.2). להימנע בועות.
  6. אטמו את קצוות הכיסוי עם מסטיק דנטלי מסיליקון.
  7. חכה עד שהמסטיק יתגבש. אפשר להשהות כאן ולאחסן את המגלשה למשך הלילה ב-4°C.
    הערה: פרוטוקולים אחרים smFISH מציעים הוספת חמצן ניקוי reagents (למשל, גלוקוז אוקסידאז / קטלאז) או באמצעות מסחרי נגד עמעום הרכבה בינוני14,26 כדי להגדיל את יכולת הפוטום של פלואורופורים.

8. הדמיה

  1. כדי למצוא תחום עניין, השתמש במצב חי של הדמיית ניגודיות פאזה. שנה את שדה התצוגה בתוך באר על-ידי תמרון ג'ויסטיק הבמה. בחר אזור שבו צפיפות התא אופטימלית (כלומר, ישנם תאים רבים המופרדים ברובם). כוונן את המיקוד כך שתמונות תא עם ניגודיות פאזה נמצאות במוקד.
  2. צלם תמונות בסדר Cy5 (חשיפה של 4 שניות), Cy3 (חשיפה של 2-s) וניגודיות פאזה (חשיפה של 0.2 שניות).
    הערה: מולקולות צבע Cy3B מדמינות בערוץ Cy3, והתמונות נקראות תמונות Cy3.
  3. חזור על שלבים 8.1-8.2 כדי לרכוש תמונות של ~ 10 אזורים שונים בתוך באר.
  4. העבר את המטרה לבאר אחרת וחזור על שלבים 8.1-8.3.
  5. יצא תמונות כקבצי TIFF.
  6. (אופציונלי) כדי ל חרוזים צבעוניים של תמונה adsorbed על פני השטח coverslip בערוצים Cy5 ו- Cy3 כדי לקבוע את המעבר המרחבי בין ערוצי Cy5 ו- Cy3 למטרות רישום תמונה.
    1. החל ~ 10 μL של חרוזי פלורסנט צבעוניים (0.2 μm קוטר) על משטח כיסוי נקי ולחכות 10-30 דקות. לאחר כביסה עם ~ 50 μL של PBS, להחיל ~ 5 μL של PBS וכריך כיסוי עם מגלשת זכוכית. לאטום ולהר על המיקרוסקופ.
    2. חרוזי תמונה הן בערוצים Cy5 והן Cy3.

9. ניתוח תמונה

הערה: קוד Matlab המשמש בשלב זה זמין באתר האינטרנט הבא של GitHub: https://github.com/sjkimlab/Code_Publication/tree/master/JoVE_2020. התיקיה GitHub מכילה את כל הדרוש לניתוח התמונה, כולל ערכי פרמטרים עבור פילוח תאים וזיהוי ספוט. ההליך בשלב זה מוסבר עוד יותר בקובץ ה-script הראשי, הנקרא "FISHworkflow.m".

  1. פתח כלי פילוח תאים, כגון microbeTracker27 או Oufti28, וטען תמונות ניגודיות של שלב. בחרו "מסגרות עצמאיות" ולחץ על לחצן בשם "כל המסגרות" כדי להתחיל בתהליך פילוח, שממנו מזוהים התאים וקווי המתאר שלהם מחושבים (איור 3B,C).
    הערה: פרוטוקולים מפורטים לשימוש בחבילות תוכנה אלה זמינים באופן מקוון (לדוגמה, oufti.org).
  2. טען תמונות פלורסנט Cy5 בפונקציית spotFinder של microbeTracker או Oufti, ולחץ על "הפעל" כפתור כדי להתחיל זיהוי ספוט כימות בהתבסס על התאמה 2D Gaussian(איור 3B,C). חזור על שלב זה עבור תמונות פלורסצית Cy3 לנתח נקודות בערוץ Cy3. שלב זה מפיק רשימה של נקודות בכל תא, כולל העוצמות וקואורדינטות שלהם.
  3. (אופציונלי) כדי ל סנן כתמים עמומים (תוצאות חיוביות שגויות) באמצעות סף, כפי שמוסבר בקובץ FISHworkflow.m.
    הערה: בדוק נקודות פלורסנט בפקד השלילי (למשל MG1655 Mg1655 ThlacZ) ולקבוע את הסף לסינון תוצאות חיוביות שגויות.
  4. כדי להשיג את עוצמת הספוט של mRNA יחיד, השתמש ברשימה של עוצמת ספוט נמדד בזמן אפס (לפני הוספת IPTG), ולהתאים את התפלגות עוצמת ספוט עם מודל תערובת Gaussian עם שני רכיבי תערובת. קחו את מיקום השיא של האוכלוסייה הגאוסית הראשונה (קו שחור באיור 3D,E)כעוצמת ספוט של mRNA יחיד. בצע זאת עבור נקודות Cy5 ונקודות Cy3 בנפרד כדי להשיג את עוצמת הספוט של mRNA יחיד 5 ' ו 3' lacZ.
    הערה: חזור על כך בכל ניסוי במסלול זמן מכיוון שעוצמת הספוט של mRNA יחיד יכולה להשתנות מעט בניסויים שונים.
  5. חלק את עוצמת הפלואורסנס של נקודה בעוצמה של mRNA יחיד (מ- שלב 9.4) כדי להשיג את מספר mRNAs בתוך נקודה. סכום עוצמת ספוט מנורמל בתוך תא כדי לחשב את המספר הכולל של mRNA בתא (איור 3F). בצע חישובים אלה עבור mRNA של 5 ו- 3' בנפרד.
  6. לחשב ולתוות את מספרי mRNA ממוצע לכל תא בכל נקודת זמן (למשל, איור 4B), ולנתחאת הקינטיקה vivo של שעתוק והשפלה mRNA מהשינוי הזמני ברמות mRNA ממוצע(איור 4B).
    1. כדי להשיג את קצב ההתרבות של שעתוק, לבצע התאמה לפחות ריבועים של קו לעלייה הראשונית 5 ' ו 3' mRNA אותות ולזהות יירוטים לרמות בזל(איור 4B). ההבדל בין יירוטים אלה מצביע על הזמן הממוצע עבור RNAPs לנסוע מאזור הגשוש 5' לאזור הגשוש 3' . חלק את המרחק בין שתי ערכות בדיקה (2 kb) עם הזמן הזה כדי להשיג את הקצב הממוצע של תמלול אורך.
    2. כדי להשיג את קצב ההשפלה של mRNA, התאם פונקציית ריקבון מעריכית, y = A·exp(-t/τ) לאזור הריקבון הסופי של אותות mRNA של 5' ו- 3' (לדוגמה, איור 4B). הפרמטר ההולם, τ, הוא אורך החיים הממוצע של ה-mRNA.
  7. (אופציונלי) כדי ל נתח את וריאציית התא לתא בביטוי גנים (לדוגמה, התגובה ברמת התא לאינדוקציה המוצגת באיור 4C),בהתבסס על התפלגות מספרי mRNA בכל תא (מחושב בשלב 9.5).
  8. (אופציונלי) כדי ל שימוש במידע אודות מיקום ספוט לאורך הצירים הראשיים והמינוריים של תא (שהושג בשלב 9.2), נתח את התאמה מחדש של mRNAs(איור 4D,E).
  9. (אופציונלי) כדי ל נתח התאמה מקומית של 5' ו- 3' mRNAs (איור 5) על-ידי השוואת התאמה מקומית של כתמים שזוהו בערוצים Cy5 ו- Cy3.
    1. טען תמונות של חרוזים צבעוניים (שלב 8.6) בפונקציית spotFinderF ב-microbeTracker והשג קואורדינטות של centroids חרוז בערוצים Cy5 ו- Cy3. השתמש ברשימת הקואורדינטות של מרכז תואם כדי לחשב את מטריצת הטרנספורמציה של הזיקה, המודיעה כיצד ערוצי Cy5 ו- Cy3 משתנים ומסתובבים ביחס זהלזה 29.
    2. החל את מטריצת הטרנספורמציה של הזיקה על תמונות Cy5 ו- Cy3 FISH כדי להמיר תמונות Cy3 בנקודות הציון Cy5. סווג אם נקודה מותאמת למיקום אחר עם מקום אחר בערוץ אחר. לדוגמה, נקודה בערוץ Cy5 נחשבת לתואם למקום אחר עם נקודה אחרת בערוץ Cy3 אם המרחק בין הסנטרואידים שלהם הוא פחות מ- 150 נהמ'(איור 5).
    3. נתח כמה נקודות Cy5 מסווגות כ"מקומיות שיתופיות" עם נקודות Cy3 בכל נקודת זמן. כמו כן, לנתח את העוצמה של נקודות מקומיות co(איור 5).

Representative Results

איור 3 מציג תמונות מייצגות מפרוטוקול SmFISH זה. שדה תצוגה מלא (86.7 μm x 66.0 μm באמצעות הגדרת המיקרוסקופ שלנו מפורט בטבלת חומרים)מראה ~ 500 E. תאי coli מפוזרים ברחבי השדה (איור 3A). אם צפיפות התאים גבוהה בהרבה ממה המוצג בתמונה זו, פילוח תאים אוטומטי הופך לקשה מכיוון שאלגוריתמי פילוח אינם מזהים באופן אמין תאים בודדים כאשר תאים נוגעים זה בזה. יש להתאים את ריכוז התאים וזמן הדגירה המשמשים לדבקות פני השטח (שלב 5.1) כדי להשיג את הצפיפות האופטימלית של תאים בשדה התצוגה.

המורפולוגיה של תאים בתמונות ניגודיות שלב צריך להישאר דומה לזה של תאים חיים למטרות פילוח (איור 3A-C). אם התאים הם over-permeabilized, מורפולוגיה התא משתנה (כמו "רוחות רפאים"; דמות משלימה 1. במקרה זה, אחד עשוי להפחית את משך הטיפול 70% אתנול בשלב 5.3.

לפני האינדוקציה רמת הביטוי lacZ הממוצע היה ~ 0.03 mRNAs לכל תא, עולה בקנה אחד עם דוחותקודמים 15,30. כמו כן, התפלגות עוצמת נקודת mRNA lacZ לפני אינדוקציה לא התאימה היטב עם התפלגות רגילה או התפלגות פואסון בשל הנוכחות של כתמים בעוצמות גבוהות(איור 3D,E). זה מצביע על כך שרוב הכתמים שזוהו תחת המצב מודחק מייצגים mRNA lacZ יחיד, אבל אוכלוסייה קטנה של כתמים מכיל יותר מ- mRNA lacZ אחד. כדי לבודד את האוכלוסייה עם mRNA lacZ יחיד, השתמשנו מודל תערובת Gaussian עם שני רכיבי תערובת (insets באיור 3D,E). לאחר מכן, ממוצע הגאוסיאן הראשון נלקח כעוצמה ממוצעת של נקודת mRNA אחת (למשל, שיא העקומה השחורה באיור תלת-מיוד)והשתמש בו כדי להמיר את עוצמת הספוט למספר mRNAs, עבור כל הנקודות שזוהו בניסוי מסלול הזמן. כדי לחשב את המספר הכולל של mRNAs בתוך תא, עוצמת הספוט מנורמל סוכם בכל תא (איור 3F)19.

כאשר רמת הביטוי של mRNA lacZ נמוכה, יש אחד או שניים כתמים mRNA lacZ מוגבל תפליט מופרדים מרחבית בתוך תא. לפיכך, התמונות של כתמים אלה ניתן לנתח על ידי התאמה 2D Gaussian לעוצמה שלהם ו localization.

כאשר רמת הביטוי גבוהה, כך שכתמים חופפים זה עם זה בתוך תא, התאמה 2D Gaussian אינו עושה כימות אמינה. במקרה זה, רמת ה-mRNA צריכה להיות מחושבת על-ידי חלוקת אות הפלואורסצינציה הכולל, המפחית ברקע בתוך תא בעוצמה ממוצעת של mRNA19 יחיד.

כאשר הביטוי של lacZ מושרה, האות של 5' lacZ mRNA גדל ראשון וזה של 3' lacZ mRNA גדל מאוחר יותר(איור 4B). אם הביטוי של lacZ מודחק, אותות mRNA 5' ו-3 אינץ' להקטין עם עיכוב מסוים בין(איור 4B). כדי להשיג את קצב התאוגרות שעתוק, העלייה של 5' ו 3' אותות הם התאימו תחילה עם קווים(איור 4B),ואת ההבדל x-intercepts נלקחים כזמן עבור RNAPs לנסוע את המרחק בין שני אזורי בדיקה (2,000 nt). ניתן למדוד את קצב ההשכמה של שעתוק מכל ניסוי במסלול זמן ותוכל לחשב סטיות תקן מכפילויות ניסיוניות. השיעור הממוצע של תמלול אורך היה 15-30 nt/ s בתנאים הניסיוניים שלנו19.

בנוסף, קצב ההשפלה של mRNA (ההופכי של אורך החיים הממוצע mRNA) הושג על ידי התאמת אזור הריקבון עם פונקציה מעריכית(איור 4B). נתוני קורס הזמן שלנו מכילים השפלה mRNA במהלך ואחרי שעתוק31. אנו מתאימים את נקודות הזמן לאחר mRNA 3' התחיל להירקב (t > 6 דקות) כדי לחקור את ההשפלה של mRNAs שפורסמו. השגנו ~ 90 s כמו חיים ממוצעים של או 5 ' או 3 ' lacZ mRNA19.

ניתן לחשב את קצב אתחול שעתוק מהמדרון של עלייה באות 5' לאחראינדוקציה (איור 4B, כחול), או ממספר mRNA הממוצע במצב יציב (שהוא שיעור החניכה המחולק לפי שיעור ההשפלה). יתר על כן, ניתן להעריך את ההסתברות לסיום שעתוק מוקדם, בין אם על ידי לקיחת היחס בין המדרון של עלייה באות 3' לעומת זה של עלייה באות5' 32 או בין רמות מצב יציב של 3 ' ו 5' mRNAאזורים 19.

מכיוון ש-SmFISH היא טכניקה של תא אחד, אנחנו יכולים לנתח את השתנות התא לתא בתעתוק. לדוגמה, ניתן לנתח את אחוז התאים המבטאים mRNA lacZ לאחר הוספת IPTG (איור 4C). ניתן גם לטפל אם התאמה מקומית mRNA משתנה לאחר אינדוקציה. הבחנו כי כתמים mRNA 5' ו 3' lacZ לנוע מעט כלפי חוץ, הרחק ממרכז התא (איור 4D,E),עולה בקנה אחד עם דו"חקודם 33.

לבסוף, ניתוח התאמה מקומית בין 5' ל-3' נקודות mRNA יכול להיות אינפורמטיבי(איור 5A). לדוגמה, במצב מודחק (זמן אפס), כ- 25% מנקודות mRNA בגודל 5 אינץ' מותאמות למקום אחר עם נקודת mRNA בגודל 3 אינץ'. ב t = 1 דקות, כמו loci גנים רבים יש סינתזה mRNA 5' , אבל עדיין לא 3 ' mRNA סינתזה, רוב 5 ' נקודות mRNA הם בעצמם ללא אות mRNA 3 ' (כלומר, הסתברות נמוכה של לוקליזציה שיתופית). עם זאת, כאשר mRNA 3' מופיע (כלומר, t = 2 דקות), ההסתברות של התאמה מקומית שיתופית גדלה (חץ סגול באיור 5A,B). נקודת זמן זו, כאשר ההתמקמות הליקוטית ההופעת הופכת לתכופה, תלויה בקצב ההתאריה של התמלול. ניתן להשתמש בהתווה הצפיפות הדו--מית-מית-מז'ר של מספרי 4 נק'ו ו-3 אינץ' בכל נקודתהתאמה תוך-תכליתשזוהתה בנקודת זמן זו כדי להסיק את צפיפות ה-RNAPs בגן lacZ (איור 5C). כפי שדווח בעבר19, מספרי mRNA 5 ' בעלילה זו מצביעים על כך שרוב loci lacZ יש פחות מ 10 RNAPs על ה-DNA כאשר ביטוי lacZ מושרה על ידי 1 mM IPTG. בנוסף, מספרי mRNA 3' בחלקה זו קשורים קיבוץ באשכולות של RNAPs34. העובדה שמספר ה-mRNA של 3' קרוב לאחד אומר כי בערך רק RNAP אחד נכנס לאזור הגשוש 3' . הדבר מצביע על כך שרנ"אים בגן lacZ מופרדים מרחבית, במקום ליצור אשכול (או "שיירה").

Figure 1
איור 1: עיצוב של גשושי SMFISH עבור mRNA של עניין. (א)שיטת ריצוף. רצפים של oligonucleotides DNA קצר (~ 20 bp אורך) נבחרים כך שהם יכולים לכסות את mRNA של עניין. בדיקות האוליגונוקלאוטיד מסומנות במולקולה של צבע פלורסנט. (ב)שיטת מערך. מערך שאינו קידוד של רצפי טנדם (לדוגמה,"מערך lacO") מותך באופן שעתי ל- mRNA של עניין. הגשושית המסויגת באופן פלורסנטי משלימה ליחידה החוזרת (לדוגמה, בדיקה lacO באורך 17 סיביות לדם) משמשת להגברת האות של MRNA. לחץ כאן כדי להציג גירסה גדולה יותר של נתון זה.

Figure 2
איור 2: סכמטי של הליך ניסיוני SmFISH ומשך זמן של כל שלב. לחץ כאן כדי להציג גירסה גדולה יותר של נתון זה.

Figure 3
איור 3: ניתוח תמונות SMFISH. (A-C)תמונת מיקרוסקופ SmFISH של 5' lacZ mRNA (אדום) ו 3' lacZ mRNA (ירוק) ב- E. coli מסוג פראי (MG1655) גדל M9 בינוני מינימלי בתוספת עם 0.2% גליצטרול, 0.1% חומצות קזמינו, ו 1 מ"ג / L תיאמין ב 30 ° C. (א) תמונה מייצגת של מדגם מ t = 3 דקות לאחר אינדוקציה עם 0.05 mM IPTG ב t = 0 דקות ודיכוי עם 500 mM גלוקוז ב t = 1.5 דקות. ניגודיות פאזה ושתי תמונות פלואורסצנטיות של Cy5 (עבור 5' lacZ mRNA, אדום) ו Cy3 (עבור 3' lacZ mRNA, ירוק) היו מכוסים בצביעה מדומה. התמונה מציגה שדה שלם של 86.7 μm x 66.0 μm. סרגל קנה מידה, 5 μm. (ב)גירסת זום של אזור קטן (תיבה צהובה) ב( A). קווי מתאר של תאים מוצגים בלבן, וכתמי פלואורסנצט המזוהים מניתוח תמונה מוצגים עם נקודות אדומות. סרגל קנה מידה, 1 μm. (ג)זיהוי קווי מתאר של תאים וכתמי פלורסנט תחת מצב ביטוי גבוה (t = 4 דקות לאחר האינדוקציה עם IPTG של 1 mM). סרגל קנה מידה, 1 μm. (D-E) מה אתה עושה? הפצות של עוצמות נקודת mRNA של 5 אינץ' ו- 3 אינץ' נמדדו לפני הוספת IPTG (המצב מודחק). ההיסטוגרמות מוצגות עם שתי פונקציות גאוס (שחור ואפור) שערכיהן המנוגדיים הם מדגל התערובת הגאוסיאני. Inset מראה עלילת כמות-כמת של מספרים אקראיים שנוצרו ממודלים תערובת Gaussian ועוצמות נקודת mRNA נמדד ניסיוני (n = 1040 עבור 5 ' mRNA ו 680 עבור 3 ' mRNA). (ו)מידע שהושג עבור תא בודד ההצביע בלוח (ב). עבור תא נתון (i), זוהו נקודות בערוצים Cy5 ו-Cy3, ועוצמתם (I) ונקודות הציון לאורך הציר הקצר והארוך של תא(ד' ל') היו מכמתים מהתאם גאוסיאני דו-ממדי. לאחר הנורמליזציה של עוצמת ספוט סוכמו כדי להניב את המספר הכולל של 5' או 3' mRNAs בתא זה. כמו כן, ניתן לנתח התאמה אישית בין נקודות מערוצים שונים כמו בדוגמה המוצגת באיור 5. לחץ כאן כדי להציג גירסה גדולה יותר של נתון זה.

Figure 4
איור 4: ניתוח של vivo קינטיקה של שעתוק והשפלה mRNA. (א)תמונות סכמטיות וייצוגיות של שני צבעים SmFISH ניסויים מדידת שינויים ברמות mRNA lacZ לאורך זמן. קווים מנוקדים באדום וירוק מצביעים על בדיקות Cy5 או Cy3B המסויגות כאוליגונוקלאוטיד המיברידיות לאזורי ה-MRNA של 1 kb-long 5 ו-3' mRNA של lacZ mRNA ב-E. coli, בהתאמה. מוצגות גם שכבות-על של שתי תמונות פלואורסץ עם תמונת ניגודיות של פאזה בנקודות זמן שצוינו לאחר האינדוקציה עם 0.2 mM IPTG ב- t = 0 דקות. שעתוק הודיכוי עם גלוקוז 500 mM ב t = 1.5 דקות. סרגל קנה מידה, 1 μm. הנתון שונה מקיםואח' 19. (ב)מספרי mRNA של 5 ו-3 אינץ' לכל תא לאורך זמן, במהלך הניסוי המתואר בפאנל (A). קווי שגיאה הם סמסים עם מגפיים. לפחות 1,200 תאים נותחו בכל נקודת זמן. העלייה הראשונית של אותות mRNA 5 'ו 3 ' היה מתאים עם קו (כחול). ההפרש ב-x-intercepts היה 1.93 דקות, מה שהניב את קצב ההתנעה הממוצע של 17.3 nt/s. הריקבון הסופי של אותות ה-MRNA של 5 ו-3 אינם היה מתאים לפונקציית ריקבון אקספוננציאלית (אפורה). הפרמטרים המתאימים מצביעים על כך שאורך החיים הממוצע של mRNA הוא 1.52 דקות עבור mRNA של 5 אינם ו- 1.66 דקות עבור mRNA של 3 אינם. (ג)אחוז התאים עם כתמי mRNA lacZ אחד או יותר במהלך הניסוי המתואר ב( A). קווי שגיאה הם סמסים עם מגפיים. (ד)התאמה מקומית של נקודה לאורך ציר קצר של תא. ניתן לכמת את קרבתו של מקום לקרום על ידי חלוקת המיקום לאורך הציר הקצר (ד) עם חצי רוחב שלהתא (w). (ה)שינוי בנקודות mRNA של 5 אינץ' ו-3 אינץ' לאורך הציר הקצר של התאים במהלך הניסוי המתואר ב- (A). לחץ כאן כדי להציג גירסה גדולה יותר של נתון זה.

Figure 5
איור 5: ניתוח התאמה מקומית של נקודות mRNA של 5 אינם ו-3 אינם. (א)סכמטי המציג את ההתיקות ההתיקות ההתיקתית הצפויה בין נקודות MRNA של 5 ל-3 אינצ'יקציה לאחר הגיוס. כאשר MRNA 3' נעשה, ההסתברות של נקודת mRNA 5 ' להיות שיתוף מקומי עם נקודה mRNA 3 ' גדל (חץ סגול). (ב)ההסתברות של התאמה מקומית לאחר אינדוקציה עם 1 mM IPTG. החץ הסגול מציין את נקודת הזמן שבה ההסתברות לתקציה תדיר הופכת תחילה לתכוף בהתאם לסכמטי בחלונית (A). (ג)מספר mRNAs lacZ 5' ו 3' בתוך נקודת התאמה מקומית שיתוף זוהה ב t = 2 דקות לאחר אינדוקציה עם 1 mM IPTG (סה"כ 841 נקודות). נקודות אפורות מייצגות נקודות מותאמות אישית לנקודות מקומיות, בעוד שנקודות אדומות מייצגות את הממוצע של נתונים עם סלים. קווי שגיאה הם SEM. גוון האפור מציין את צפיפות הנקודות באזור נתון בגרף. הקו המקוקד מציין שיפוע של 1. לחץ כאן כדי להציג גירסה גדולה יותר של נתון זה.

Figure 6
איור 6: אופטימיזציה של מצב הכלאה של הגשושית. שני סוגים של דגימות שימשו: תאי MG1655 גדל כמתואר איור 3 ולהישאר מושרה (כחול) או טופלו עם 0.5 mM IPTG במשך 20 דקות (אדום). פתרון הכלאה בדיקה נעשה עם ריכוזים שונים של בדיקות (סה"כ 72 Cy5-התווך גששים ריצוף אזור lacZ כולו) ו של formamide. ריכוזי פורמיד הותאמו גם בתמיסת טרום-הכלאה ובפתרון השטיפה, בהתאם. "אין בדיקה" (קו אפור) מציין את רמת הפלואורסקצנציה של תאי IPTG שנוספו שטופלו ללא בדיקות במהלך שלב הכלאה. עוצמת פלואורסצנה ממוצעת מנורמלת לפי אזור התא (AU) חושבה מ- 300-800 תאים. קווי שגיאה הם סמסים עם מגפיים. לחץ כאן כדי להציג גירסה גדולה יותר של נתון זה.

איור משלים 1: מורפולוגיות תאים מעוותות עקב חירוב יתר. שכבת-על של ניגודיות פאזה (ג'יגה מידה אפור), mRNA lacZ 5' (Cy5, אדום) ו 3' lacZ mRNA (Cy3, ירוק) תמונות של תאי MG1655 5 דקות לאחר האינדוקציה עם 1 mM IPTG. (א)דוגמה המציגה תערובת של תאים רגילים ותאים חודרים מדי חסר מורפולוגיה רגילה (המצוין עם חצים ורודים). (ב)דוגמה המציגה תאים "רפאים" התקבץ יחד. סרגל קנה מידה = 1 μm. אנא לחץ כאן כדי להוריד קובץ זה.

מים DEPC
מוסיפים 0.1% DEPC למים סופר-תכליתיים ומדגרה את הבקבוק (מכוסה) בתנור 37 מעלות צלזיוס למשך הלילה ואת האוטוקלבה למחרת.
די.פי.אס פי.אס (פי 10)
ערבב את הפעולות הבאות:
80 גרם NaCl (גמר 1.37 מ')
2 גר' KCl (27 מיליון דולר אחרון)
14.2 גר' Na2HPO4 (100 מ'-מ' סופיים)
2.7 גר' KH2PO4 (סופי 20 mM)
מים אולטרה-תכליתיים ל-1L
מסנן (0.22 μm) לתוך בקבוק זכוכית.
להוסיף 0.1% DEPC ובצע את ההוראה עבור מים DEPC.
כדי ליצור פתרון 1X, לדלל 10 פעמים עם מים DEPC.
1M מאגר נתרן פוספט DEPC, pH 7.4
ערבב את הפעולות הבאות:
115 גר' Na2HPO4
22.8 גר' נה2ת.פ.4
מים אולטרה-תכליתיים ל-1 ל'
מסנן (0.22 μm) לתוך בקבוק זכוכית.
להוסיף 0.1% DEPC ובצע את ההוראה עבור מים DEPC.
פתרון תיקון פי 4 (16% פורמלדהיד)
5 מ"ל 20% פורמלדהיד
500 μL מים DEPC
750 μL 1M מאגר נתרן פוספט DEPC, pH 7.4
יש לאחסן ב-4°C עד 2-4 שבועות.
זהירות: פורמלדהיד רעיל. ללבוש כפפות ולהשתמש ברדס אדים בעת ביצוע פתרון זה.
פתרון רחצה
ערבב את הפעולות הבאות:
10 מ"ל פורמיד (25% אחרון%)
4 מ"ל 20X SSC (2X הסופי)
מילוי מים DEPC עד 40 מ"ל
מסנן (0.22 μm) ולאחסן ב- 4 °C
אזהרה: פורמיד רעיל. ללבוש כפפות ולהשתמש ברדס אדים בעת ביצוע פתרון זה.
פתרון טרום-הכלאה
200 μL פורמיד (20% אחרון%)
100 μL 20X SSC (2X הסופי)
10 μL VRC 100X (1X הסופי)
25 μL 4% (w/v) BSA (סופי 0.1%)
685 μL מים DEPC
הערה: מערבולת מניית VRC לפני לקיחת 10 μL החוצה.
התראה: פורמיד רעיל וטרטוגן ידוע. תלבש כפפות ותטפל בזה מתחת למכסה מנוע אדים.
פתרון היברידית בדיקה
200 μL פורמיד (20% אחרון%)
100 μL 20X SSC (2X הסופי)
10 μL VRC 100X (1X הסופי)
25 μL 4% (w/v) BSA (סופי 0.1%)
10 μL 40 מ"ג/מ"ל E. coli tRNA (סופי 0.4 מ"ג / מ"ל)
200 μL 50% דקסטרן גופרתי (10% סופיים%)
אני לא יודע מה זה אומר. 5' mRNA גשושית להגדיר (מ שלב 1.12) כדי סופי 4 דפים.
אני לא יודע אם אני יכול לעשות את זה. גשושי mRNA של 3 אינם מוגדרים (מ- שלב 1.12) עד 4 נהל-מ' הסופי.
- מים DEPC כדי להפוך את הנפח הכולל 1 מ"ל
הערה: הוסף את דסטרן גופרתי אחרון. כי זה צמיגי מאוד, לחתוך את הקצה של טיפ פיפטה לפני לוקח 200 μL מתוך 50% מניות. לאחר הוספת דקסטרן גופרתי, פיפטה למעלה ו למטה כדי homogenize הפתרון.

טבלה 1: מתכונים של הפתרונות המשמשים.

Discussion

כאן, אנו הציגו פרוטוקול SMFISH למדידת קינטיקה mRNA ב E. coli. בפרוטוקולים SMFISH שפורסמו בעבר עבורחיידקים 23, תאים נשמרו בצינורות עד סוף הפרוטוקול, כל כך עד שהם מוכנים להדמיה. אמנם יש לו יתרונות רבים, כגון איגוד מינימלי לא ספציפי של בדיקות פלורסנט על משטח כיסוי23, קשה לעקוב אחר פרוטוקולים אלה כאשר יש דגימות רבות מניסוי קורס זמן. ראשית, נפח גדול יחסית של תאים (>1 מ"ל) צריך להיות נדגים ואפילו לקצור לפני קיבעון. שנית, דגימות התא צריך להיות צנטריפוגה מספר פעמים כדי להחליף פתרונות ולשטוף לאחר שלב הכלאה. בפרוטוקול שלנו, נפח קטן (<1 מ"ל) של תרבות מעורב ישירות עם פתרון תיקון בצינור 1.5 מ"ל, עוזר במהירות "להקפיא" את מצב התא ברגע הדגימה. כמו כן, תאים להישאר מחוברים אל פני השטח לאורך כל ההליך, פתרונות שונים ניתן להחליף במהירות על ידי שאף נוזלים עם מערכת סינון ואקום ויישום טיפות פתרון בבת אחת עם פיפטה רב ערוצית. הבדל זה הופך את הפרוטוקול שלנו ליתרון רב כאשר מספר גדול של דגימות צריך להיות מעובד בבת אחת. באמצעות הפרוטוקול שלנו, 12-48 דגימות ניתן לטפל בו זמנית ואת הליך FISH כולו ניתן להשלים בתוך ~ 8 שעות, על כמות דומה של זמן הדרוש עבור כמה דגימות(איור 2). למרות שהשתמשנו בביטוי lacZ ב E. coli כדוגמה, הפרוטוקול ישים באופן נרחב גנים שונים מינים חיידקיים עם שיקולים שנדונו להלן.

עבור גנים שונים, הדבר הראשון שיש לקחת בחשבון הוא גשושי SMFISH. אחד יכול לעצב בדיקות oligonucleotide אריח mRNA של עניין (איור 1A)13. בגישת בדיקה זו "ריצוף", כל בדיקה היא ~ 20 בסיס ארוך מתויג עם פלואורופור ב 5 ' או 3 ' terminus. אסטרטגיה זו נוחה כמו אין צורך מניפולציה גנטית. לחלופין, ניתן להוסיף חזרה דו-צמדית של רצף של כ-20 bp, זר לרצף הגנומי (לדוגמה, מערך של רצף lacO ב-Caulobacter crescentus14),ניתן להכניס לאזור הלא מתורגם של גן עניין, ובדיקה אחת המשלים ליחידה החוזרת משמשת לסימון הגישה mRNA ("מערך"; איור 1B). בשני המקרים, פלואורופורים מרובים לקשט mRNA, נותן אות פלואורסציה מוגבר שניתן להבדיל בקלות מבדיקה אחת שאינה קשורה באופן ספציפי בתוך תא.

אם לבחור גישות "ריצוף" או "מערך" תלוי בפקד השלילי, מדגם שבו איגוד לא ספציפי של בדיקות נבדק כי זה חסר mRNA היעד. עבור בדיקות ריצוף(איור 1A),זן מוטציה ללא גן של עניין או מצב, שבו הגן אינו מתעתק (למשל, דיכוי של lacZ)יכול לשמש שליטה שלילית לבדיקת איגוד לא ספציפי של בדיקות. עבור SmFISH מבוסס מערך (איור 1B), זן מסוג פראי חסר המערך יכול לשמש כפקד שלילי מכיוון שהוא אינו מכיל אתרי איגוד עבור הגששים.

תנאי הכלאה אופטימליים עשויים להיות תלויים רצפי בדיקה ואפילו הבחירה של צבעי פלואורופור. ייעלנו את מצב ההיברידיזציה עבור ערכות בדיקה lacZ על ידי שמירה על טמפרטורת הכלאה ב 37 °C ובדיקת ריכוזים שונים של ערכות בדיקה formamide בפתרון הכלאה. ריכוזים גבוהים יותר של formamide נוטים להפחית הן לא ספציפית וכריכהספציפית 26,35. אנו ממליצים לשנות באופן שיטתי את ההיברידיזציה ואת תנאי השטיפה שלה תוך שמירה על זמן היברידיזציה וטמפרטורה זהה. ככל שהמצב מחמיר יותר, הן לא ספציפית והן ירידה מחייבת ספציפית(איור 6). חשוב למצוא נקודה שבה הכריכה הלא ספציפית מתחילה להגיע מתחת לסף מקובל מבלי להתפשר עוד יותר על כריכה ספציפית. לדוגמה, השתמשנו ברמת האות שהושגה ללא גששים ("אין גששים") בשם סף(איור 6).

שיטת SmFISH בשני צבעים המסויגת שני אזורים נפרדים של mRNA מוגבלת לגנים ארוכים. כדי למדוד את קצב ההתרבות שעתוק, ניצלנו את העובדה כי lacZ הוא ארוך (3075 bp) ואת הביטוי שלה יכול להיות מושרה על ידי IPTG. כאשר גן קצר, קשה לעצב שתי ערכות בדיקה ריצוף (ליד 5' ו 3 ' קצוות) ולפתור את העיכוב בזמן בין הופעות של 5 ' לעומת 3 ' mRNA אזורים. במקרה זה, אפשר לספור mRNAs המתפתח במצב יציב על ידי smFISH ולנתח את התפלגותם עם מודל אנליטי שיש לו את קצב של תמלול תמלולים כפרמטר מתאים 20. כמו כן, כאשר גן של עניין אינו בלתי ניתן לסיבה, ניתן לטפל בתאים עם rifampicin בזמן אפס למדוד את השינוי הזמני באזורים 5 ' ו 3 ' mRNA. העיכוב מהירידה של אות mRNA 5 ' לזה של אות mRNA 3 ' לאחר מכן יכול לשמש כדי לחשב את קצב ההתארה שעתוק כפישנעשה בעבר 31.

לבסוף, פרוטוקול SmFISH הוא רב-תכליתי ותו לא ניתן לשלב אותו עם ערכות תיוג אחרות. בעבר, לוקוס DNA היה חזותי יחד עם mRNAs על ידי שילוב mRNA דגים עם או DNA FISH14 או פלורסנט כתב-מפעילמערכת 20. מוצרי חלבון ניתן לדמיין על ידי ביצוע immunofluorescence יחד עם mRNA FISH14,36. כמו כן, ניתן לשלב אותו עם מיקרוסקופיתסופר-רזולוציה תלת מימדית 37 כדי לדמיין mRNAs בכל שלושת הממדים38,39.

Disclosures

המחברים מצהירים שאין להם אינטרסים כלכליים מתחרים.

Acknowledgments

פרוטוקול זה פותח על ידי ס.ק. במהלך מחקר הפוסט-טוקטורלי שלה במעבדה של ד"ר כריסטין ג'ייקובס-וגנר במכון הרפואי הווארד יוז והמכון למדעי המיקרוביאלית באוניברסיטת ייל. אנו מודים לד"ר ג'ייקובס-וגנר וחברי המעבדה שלה על תשומות שונות במהלך פיתוח השיטה וללורה טרוייר על הקריאה הביקורתית של כתב היד. ס.ק. מכירה בתמיכה מתכנית חוקרי סריל; K.V. מכיר בתמיכתו של ג'יימס מלומד Preble מחקר פרס מאוניברסיטת אילינוי.

Materials

Name Company Catalog Number Comments
Bacterial strain
Escherichia coli MG1655
Chemicals, peptides, and others
Acetonitrile Sigma-Aldrich 34851 UPLC buffer B
Ammonium chloride Fisher Chemical A661-500 To make M9 medium
Bovine serum albumin (BSA) Sigma-Aldrich B2518 Probe hybridization
Calcium chloride Acros Organics 349610250 To make M9 medium
Casamino acid BD Difco 223050 To make M9 medium
Cy3B NHS ester GE Healthcare Life Sciences PA63101 Fluorophore for FISH probes
Cy5 NHS ester GE Healthcare Life Sciences PA15101 Fluorophore for FISH probes
DEPC Sigma-Aldrich D5758
Dextran sulfate Millipore S4030 Probe hybridization
Dextrose Fisher Chemical D16 To repress the expression of lacZ
Dimethyl sulfoxide (DMSO) Sigma-Aldrich D8418 To dissolve fluorophores
E. coli tRNA Sigma-Aldrich R1753 Probe hybridization
Ethanol Decon Laboratories 2701 Used in DNA purification, lysis, and cleaning coverslips
FISH probes Biosearch Technologies Sequences are published in ref#16
Formaldehyde Ladd Research Industries 20295 Fixation
Formamide American Bio AB00600 Probe hybridization, pre-hybridization, and wash
Glycerol Americanbio AB00751-01000 To make M9 medium
Isopropylthio-β-galactoside (IPTG) Invitrogen 15529019 lacZ induction
Magnesium sulfate Fisher Chemical M65-500 To make M9 medium
2-Nitrophenyl β-D-fucopyranoside (ONPF) Santa Cruz Biotechnology sc-216258 lacZ repression
Picodent twinsil 22 Picodent 1300 1000 Sealant
Poly-L-lysine Sigma-Aldrich P8920 To treat the coverslip surface
Potassium chloride Fisher BioReagents BP366-500 To make PBS
Potassium phosphate monobasic Fisher BioReagents BP362-500 To make PBS and M9 medium
Rifampicin Sigma-Aldrich R3501 To stop transcription initiation
Saline-sodium citrate buffer (SSC) Invitrogen AM9763 Probe hybridization, pre-hybridization, and wash
sodium bicarbonate Fisher BioReagents BP328-500 Fluorophore-probe conjugation
Sodium chloride Fisher BioReagents BP358-1 For DNA purification, PBS and M9 medium
Sodium phosphate dibasic Fisher BioReagents BP332-500 To make PBS and M9 medium
Sodium phosphate monobasic Fisher BioReagents BP329-500 To make a sodium phosphate buffer
Super PAP Pen Invitrogen 8899 Hydrophobic marker for coverslips
TetraSpek microspheres Invitrogen T7280 Controls for multi-channel registration
Thiamine Sigma-Aldrich T1270 To make M9 medium
Triethylammonium acetate Sigma-Aldrich 90358 UPLC buffer A
Vanadyl ribonucleoside complex (VRC) Sigma-Aldrich 94742 Probe hybridization and pre-hybridization
Equipment
C18 column Waters Acquity BEH C18 column
Countertop centrifuge Eppendorf 5425
Countertop incubator Eppendorf Thermomixer F1.5
Incubator (Oven) Thermo Scientific 51030514 Gravity convection
Water purification system Millipore Milli-Q Reference
Nanodrop Thermo Scientific 2000C
Nitrogen gas Building For blow-drying coverslips and glass slides
UPLC Waters Acquity UPLC system
Vacuum and aspirator Building Aspirator is made of a filtration flask with a side arm.
Vacuum concentrator Labconco 7810010 Centrivap; to dry samples collected from UPLC.
Vortexer Scientific Industries Genie-2 SI-0236
Water bath shaker New Brunswick Innova 3100 Critical for time-course experiments
Water bath sonicator VWR 97043-960 To clean coverslips and glass slides
Tools
1.5-mL tubes Eppendorf 22431021 DNA lobind tubes
1000-uL pipette tip box Denville Scientific P1126 An empty box after using all the tips
Coplin jar SPI 01240-AB To clean coverslips and glass slides
Coverslip Fisher Scientific 22-050-230 24x60 No1
Filtered pipette tips Denville Scientific P1121,P1122,P1126 SHARP® Precision Barrier Tips
Forceps SPI K35a To handle clean coverslips and glass slides
Glass slide Fisher Scientific 12-544-1
Gloves Microflex MK-296-M
Multichannel pipetter Eppendorf 2231300045 To use in the washing step (#7)
Pipette Gilson P1000, P200, P20
Reagent reservoir MTC Bio P8025-1S To use in the washing step (#7)
Syringe filter (0.22 um) Millipore SLGS033SS
Timer VWR 62344-641
Software and algorithms
MATLAB Mathworks R2013 and up https://www.mathworks.com
MicrobeTracker or Oufti https://www.github.com/JacobsWagnerLab/MicrobeTracker
https://oufti.org/
Stellaris Probe Designer Biosearch Technologies https://www.biosearchtech.com/support/tools/design-software/stellaris-probe-designer
Microscope
CCD camera Hamamatsu Photonics Orca-II-ER
Cy3 filter set Chroma 49004
Cy5 filter set Chroma 49006
Epi-fluorescence microscope Nikon Eclipse Ti For phase-contrast and epi fluorescence
Fluorescence excitation source Lumencor SOLA-E
Nikon Elements software Nikon software that controls the microscope setup
Phase-contrast 100x objective Nikon Plan Apochromat (NA 1.45)
Probe sequence
DNA oligos with C6 amino modification at the 5' end Biosearch Technologies Inc
lacZ1 GTGAATCCGTAATCATGGTC 5' mRNA
lacZ2 TCACGACGTTGTAAAACGAC 5' mRNA
lacZ3 ATTAAGTTGGGTAACGCCAG 5' mRNA
lacZ4 TATTACGCCAGCTGGCGAAA 5' mRNA
lacZ5 ATTCAGGCTGCGCAACTGTT 5' mRNA
lacZ6 AAACCAGGCAAAGCGCCATT 5' mRNA
lacZ7 AGTATCGGCCTCAGGAAGAT 5' mRNA
lacZ8 AACCGTGCATCTGCCAGTTT 5' mRNA
lacZ9 TAGGTCACGTTGGTGTAGAT 5' mRNA
lacZ10 AATGTGAGCGAGTAACAACC 5' mRNA
lacZ11 GTAGCCAGCTTTCATCAACA 5' mRNA
lacZ12 AATAATTCGCGTCTGGCCTT 5' mRNA
lacZ13 AGATGAAACGCCGAGTTAAC 5' mRNA
lacZ14 AATTCAGACGGCAAACGACT 5' mRNA
lacZ15 TTTCTCCGGCGCGTAAAAAT 5' mRNA
lacZ16 ATCTTCCAGATAACTGCCGT 5' mRNA
lacZ17 AACGAGACGTCACGGAAAAT 5' mRNA
lacZ18 GCTGATTTGTGTAGTCGGTT 5' mRNA
lacZ19 TTAAAGCGAGTGGCAACATG 5' mRNA
lacZ20 AACTGTTACCCGTAGGTAGT 5' mRNA
lacZ21 ATAATTTCACCGCCGAAAGG 5' mRNA
lacZ22 TTTCGACGTTCAGACGTAGT 5' mRNA
lacZ23 ATAGAGATTCGGGATTTCGG 5' mRNA
lacZ24 TTCTGCTTCAATCAGCGTGC 5' mRNA
lacZ25 ACCATTTTCAATCCGCACCT
lacZ26 TTAACGCCTCGAATCAGCAA
lacZ27 ATGCAGAGGATGATGCTCGT
lacZ28 TCTGCTCATCCATGACCTGA
lacZ29 TTCATCAGCAGGATATCCTG
lacZ30 CACGGCGTTAAAGTTGTTCT
lacZ31 TGGTTCGGATAATGCGAACA
lacZ32 TTCATCCACCACATACAGGC
lacZ33 TGCCGTGGGTTTCAATATTG
lacZ34 ATCGGTCAGACGATTCATTG
lacZ35 TGATCACACTCGGGTGATTA
lacZ36 ATACAGCGCGTCGTGATTAG
lacZ37 GATCGACAGATTTGATCCAG
lacZ38 AAATAATATCGGTGGCCGTG
lacZ39 TTTGATGGACCATTTCGGCA
lacZ40 TATTCGCAAAGGATCAGCGG
lacZ41 AAGACTGTTACCCATCGCGT
lacZ42 TGCCAGTATTTAGCGAAACC
lacZ43 AAACGGGGATACTGACGAAA
lacZ44 TAATCAGCGACTGATCCACC
lacZ45 GGGTTGCCGTTTTCATCATA
lacZ46 TCGGCGTATCGCCAAAATCA
lacZ47 TTCATACAGAACTGGCGATC
lacZ48 TGGTGTTTTGCTTCCGTCAG
lacZ49 ACGGAACTGGAAAAACTGCT 3' mRNA
lacZ50 TATTCGCTGGTCACTTCGAT 3' mRNA
lacZ51 GTTATCGCTATGACGGAACA 3' mRNA
lacZ52 TTTACCTTGTGGAGCGACAT 3' mRNA
lacZ53 GTTCAGGCAGTTCAATCAAC 3' mRNA
lacZ54 TTGCACTACGCGTACTGTGA 3' mRNA
lacZ55 AGCGTCACACTGAGGTTTTC 3' mRNA
lacZ56 ATTTCGCTGGTGGTCAGATG 3' mRNA
lacZ57 ACCCAGCTCGATGCAAAAAT 3' mRNA
lacZ58 CGGTTAAATTGCCAACGCTT 3' mRNA
lacZ59 CTGTGAAAGAAAGCCTGACT 3' mRNA
lacZ60 GGCGTCAGCAGTTGTTTTTT 3' mRNA
lacZ61 TACGCCAATGTCGTTATCCA 3' mRNA
lacZ62 TAAGGTTTTCCCCTGATGCT 3' mRNA
lacZ63 ATCAATCCGGTAGGTTTTCC 3' mRNA
lacZ64 GTAATCGCCATTTGACCACT 3' mRNA
lacZ65 AGTTTTCTTGCGGCCCTAAT 3' mRNA
lacZ66 ATGTCTGACAATGGCAGATC 3' mRNA
lacZ67 ATAATTCAATTCGCGCGTCC 3' mRNA
lacZ68 TGATGTTGAACTGGAAGTCG 3' mRNA
lacZ69 TCAGTTGCTGTTGACTGTAG 3' mRNA
lacZ70 ATTCAGCCATGTGCCTTCTT 3' mRNA
lacZ71 AATCCCCATATGGAAACCGT 3' mRNA
lacZ72 AGACCAACTGGTAATGGTAG 3' mRNA

DOWNLOAD MATERIALS LIST

References

  1. Bervoets, I., Charlier, D. Diversity, versatility and complexity of bacterial gene regulation mechanisms: opportunities and drawbacks for applications in synthetic biology. FEMS Microbiology Reviews. 43, (3), 304-339 (2019).
  2. Epshtein, V., Nudler, E. Cooperation between RNA polymerase molecules in transcription elongation. Science. 300, (5620), 801-805 (2003).
  3. Vogel, U., Jensen, K. F. The RNA chain elongation rate in Escherichia coli depends on the growth rate. Journal of Bacteriology. 176, (10), 2807-2813 (1994).
  4. Tennyson, C. N., Klamut, H. J., Worton, R. G. The human dystrophin gene requires 16 hours to be transcribed and is cotranscriptionally spliced. Nature Genetics. 9, 184 (1995).
  5. Singh, J., Padgett, R. A. Rates of in situ transcription and splicing in large human genes. Nature Structural & Molecular Biology. 16, 1128 (2009).
  6. Selinger, D. W., Saxena, R. M., Cheung, K. J., Church, G. M., Rosenow, C. Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. Genome Research. 13, (2), 216-223 (2003).
  7. Bernstein, J. A., Khodursky, A. B., Lin, P. -H., Lin-Chao, S., Cohen, S. N. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proceedings of the National Academy of Sciences. 99, (15), 9697-9702 (2002).
  8. Pérez-Ortín, J. E., Medina, D. A., Chávez, S., Moreno, J. What do you mean by transcription rate. BioEssays. 35, (12), 1056-1062 (2013).
  9. Tang, F., et al. mRNA-Seq whole-transcriptome analysis of a single cell. Nature Methods. 6, (5), 377-382 (2009).
  10. Kuchina, A., et al. Microbial single-cell RNA sequencing by split-pool barcoding. BioRxiv. 869248 (2019).
  11. Blattman, S. B., Jiang, W., Oikonomou, P., Tavazoie, S. Prokaryotic single-cell RNA sequencing by in situ combinatorial indexing. Nature Microbiology. (2020).
  12. Femino, A., Fay, F., Fogarty, K., Singer, R. Visualization of single RNA transcripts in situ. Science. 280, (5363), 585-590 (1998).
  13. Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. Imaging individual mRNA molecules using multiple singly labeled probes. Nature Methods. 5, (10), 877-879 (2008).
  14. Montero Llopis, P., et al. Spatial organization of the flow of genetic information in bacteria. Nature. 466, (7302), 77-81 (2010).
  15. So, L. -h, et al. General properties of transcriptional time series in Escherichia coli. Nature Genetics. 43, (6), 554-560 (2011).
  16. Taniguchi, Y., et al. Quantifying E. coli proteome and transcriptome with single-molecule sensitivity in single cells. Science. 329, (5991), 533-538 (2010).
  17. Jones, D. L., Brewster, R. C., Phillips, R. Promoter architecture dictates cell-to-cell variability in gene expression. Science. 346, (6216), 1533-1536 (2014).
  18. Iyer, S., Park, B. R., Kim, M. Absolute quantitative measurement of transcriptional kinetic parameters in vivo. Nucleic Acids Research. 44, (18), 142 (2016).
  19. Kim, S., Beltran, B., Irnov, I., Jacobs-Wagner, C. Long-Distance Cooperative and Antagonistic RNA Polymerase Dynamics via DNA Supercoiling. Cell. 179, (1), 106-119 (2019).
  20. Wang, M., Zhang, J., Xu, H., Golding, I. Measuring transcription at a single gene copy reveals hidden drivers of bacterial individuality. Nature Microbiology. 4, (12), 2118-2127 (2019).
  21. Joo, C., Ha, T. Labeling DNA (or RNA) for single-molecule FRET. 2012, (9), Cold Spring Harbor. 1005-1008 (2012).
  22. Sambrook, J., Russell, D. W. Standard Ethanol Precipitation of DNA in Microcentrifuge Tubes. 2006, (1), Cold Spring Harbor Protocols. 4456 (2006).
  23. Skinner, S. O., Sepúlveda, L. A., Xu, H., Golding, I. Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization. Nature Protocols. 8, (6), 1100-1113 (2013).
  24. Adesnik, M., Levinthal, C. The synthesis and degradation of lactose operon messenger RNA in E. coli. Cold Spring Harbor Symposia on Quantitative Biology. 35, 451-459 (1970).
  25. Campbell, E. A., et al. Structural mechanism for rifampicin inhibition of bacterial RNA polymerase. Cell. 104, (6), 901-912 (2001).
  26. Raj, A., Tyagi, S. Methods in Enzymology. Walter, N. G. 472, Academic Press. 365-386 (2010).
  27. Sliusarenko, O., Heinritz, J., Emonet, T., Jacobs-Wagner, C. High-throughput, subpixel precision analysis of bacterial morphogenesis and intracellular spatio-temporal dynamics. Molecular Microbiology. 80, (3), 612-627 (2011).
  28. Paintdakhi, A., et al. Oufti: an integrated software package for high-accuracy, high-throughput quantitative microscopy analysis. Molecular Microbiology. 99, (4), 767-777 (2016).
  29. Moffitt, J. R., Zhuang, X. Methods in Enzymology. Filonov, G. S., Jaffrey, S. R. 572, Academic Press. 1-49 (2016).
  30. Yu, J., Xiao, J., Ren, X., Lao, K., Xie, X. S. Probing gene expression in live cells, one protein molecule at a time. Science. 311, (5767), 1600-1603 (2006).
  31. Chen, H., Shiroguchi, K., Ge, H., Xie, X. S. Genome-wide study of mRNA degradation and transcript elongation in Escherichia coli. Molecular Systems Biology. 11, (1), 781 (2015).
  32. Vogel, U., Sørensen, M., Pedersen, S., Jensen, K. F., Kilstrup, M. Decreasing transcription elongation rate in Escherichia Coli exposed to amino acid starvation. Molecular Microbiology. 6, (15), 2191-2200 (1992).
  33. Yang, S., et al. Transcription and translation contribute to gene locus relocation to the nucleoid periphery in E. coli. Nature Communications. 10, (1), 5131 (2019).
  34. Zenklusen, D., Larson, D. R., Singer, R. H. Single-RNA counting reveals alternative modes of gene expression in yeast. Nature Structural & Molecular Biology. 15, (12), 1263-1271 (2008).
  35. Fontenete, S., Guimarães, N., Wengel, J., Azevedo, N. F. Prediction of melting temperatures in fluorescence in situ hybridization (FISH) procedures using thermodynamic models. Critical Reviews in Biotechnology. 36, (3), 566-577 (2016).
  36. Sepúlveda, L. A., Xu, H., Zhang, J., Wang, M., Golding, I. Measurement of gene regulation in individual cells reveals rapid switching between promoter states. Science. 351, (6278), 1218-1222 (2016).
  37. Huang, B., Wang, W., Bates, M., Zhuang, X. Three-Dimensional Super-Resolution Imaging by Stochastic Optical Reconstruction Microscopy. Science. 319, (5864), 810-813 (2008).
  38. Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. Spatial organization shapes the turnover of a bacterial transcriptome. eLife. 5, 13065 (2016).
  39. Fei, J., et al. Determination of in vivo target search kinetics of regulatory noncoding RNA. Science. 347, (6228), 1371-1374 (2015).
חיטוט mRNA קינטיקה בחלל וזמן <em>ב Escherichia קולי באמצעות שני</em> צבעים פלואורסצנטיות מולקולה אחת ב סיטו הכלאה
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, S., Vaidya, K. Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization. J. Vis. Exp. (161), e61520, doi:10.3791/61520 (2020).More

Kim, S., Vaidya, K. Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization. J. Vis. Exp. (161), e61520, doi:10.3791/61520 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter