Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Sondeo de mRNA cinética en el espacio y el tiempo en Escherichia coli usando hibridación de fluorescencia de una sola molécula de dos colores

doi: 10.3791/61520 Published: July 30, 2020

Summary

Este protocolo describe una aplicación de hibridación in situ de fluorescencia de una sola molécula (smFISH) para medir la cinética in vivo de la síntesis y degradación del ARNm.

Abstract

La hibridación in situ de fluorescencia de una sola molécula (smFISH) permite contar el número absoluto de mRNAs en células individuales. Aquí, describimos una aplicación de smFISH para medir las tasas de transcripción y degradación del ARNm en Escherichia coli. Como smFISH se basa en células fijas, realizamos smFISH en múltiples puntos de tiempo durante un experimento de curso de tiempo, es decir, cuando las células están experimentando cambios sincronizados tras la inducción o la represión de la expresión génica. En cada punto de tiempo, las subregiones de un ARNm se distinguen espectralmente para sondear el alargamiento de transcripción y la terminación prematura. El resultado de este protocolo también permite analizar la localización intracelular de los ARNm y la heterogeneidad en los números de copia de ARNm entre las células. Usando este protocolo muchas muestras (50) se pueden procesar dentro de 8 h, como la cantidad de tiempo necesaria para sólo unas pocas muestras. Discutimos cómo aplicar este protocolo para estudiar la cinética de transcripción y degradación de diferentes mRNAs en células bacterianas.

Introduction

El flujo de información genética del ADN al ARNm y a las proteínas es uno de los procesos celulares más fundamentales, cuya regulación es importante para la aptitud celular1. El número de ARN en una célula está determinado por dos procesos dinámicos, la transcripción y la degradación del ARNm. Sin embargo, la forma en que la transcripción y la degradación del ARNm se regulan en el tiempo y el espacio de una sola célula sigue sin entenderse completamente, en gran parte debido a la escasez de métodos experimentales para medir cuantitativamente su cinética in vivo.

Los métodos basados en los mRNA totales extraídos de una población de células, tales como Northern blot, RT-PCR, secuenciación de ARN y microarrays de expresión génica, pueden medir la diferencia relativa en los niveles de ARNm y se han utilizado ampliamente para analizar la tasa de alargamiento de transcripción2,3,4,5 o la tasa de degradación del ARNm6,,7. Sin embargo, no proporcionan el número absoluto de mRNAs por célula, y por lo tanto, no son adecuados para sondear la tasa de iniciación de transcripción8. Además, debido a que los ARN se extraen de una población de células, no se puede medir la distribución espacial de los ARN dentro de una sola célula y la variabilidad de los números de copia de ARNm entre las células.

La secuenciación de ARN de próxima generación en células individuales (scRNAseq) puede cuantificar el número de ARNm por célula en una escala genómica9. Sin embargo, sigue siendo difícil utilizar esta técnica para medir la cinética de transcripción, debido a los desafíos con la preparación de la muestra y el alto costo. En particular, la aplicación de scRNAseq a las bacterias ha sido técnicamente difícil debido a la baja abundancia de ARNM10,11.

La hibridación in situ de fluorescencia de una sola molécula (smFISH) se basa en la hibridación de sondas de una sola cadena etiquetadas fluorescentemente cuyas secuencias son complementarias al ARNm objetivo de interés12,,13. El concepto de hibridación específica de la secuencia es similar al utilizado en Northern blot o RT-PCR, pero la hibridación se realiza in situ dentro de celdas fijas, para preservar la localización nativa de los mRNAs. La señal de un solo ARNm se amplifica utilizando muchas sondas, de longitud de 20 nucleótidos (nt), hibridando en diferentes partes de un ARNm (Figura 1A)13. En este enfoque de sonda de "mosaico", el número de sondas necesarias para detectar un solo ARNm establece un límite inferior en la longitud del ARNm que se puede ensayar. Alternativamente, el ARNm de interés puede fusionarse transcripcionalmente con una matriz no codificatoria de secuencias de operadores Lac en tándem, de modo que varias copias de una sonda lacO etiquetada fluorescentemente se hibridan en un solo ARNm (Figura 1B)14.

smFISH se ha utilizado para cuantificar el número de mRNAs por célula en estado estacionario (es decir, cuando la síntesis y la descomposición están en equilibrio) y para analizar la media y variabilidad de los MRNAs entre las células bacterianas15,,16,,17. Recientemente, smFISH se ha aplicado para cuantificar los números de ARNm en estado no estable, inmediatamente después de la inducción o represión de la expresión génica en E. coli18,19,20. Los cambios temporales en los números absolutos de copia de ARNm se utilizaron para calcular la tasa de iniciación de transcripción, elongación y terminación, así como la tasa de degradación del ARNm. Para esta aplicación, los procedimientos smFISH convencionales pueden ser engorrosos porque hay muchas muestras, cada una representando un punto de tiempo, que necesitan pasar por múltiples pasos de intercambio de búferes (es decir, centrifugación y lavado). Aquí, describimos un protocolo smFISH, en el que los pasos de manipulación de muestras se simplifican drásticamente al tener células adheridas a la superficie de un cubreobjetos y aspirando líquidos con un sistema de filtración al vacío14,,19. Utilizando la expresión de lacZ en E. coli como ejemplo, se demuestra el flujo de trabajo completo (Figura 2), incluido el análisis de imágenes (Figura 3) que produce la cinética in vivo de transcripción (iniciación, alargamiento y terminación) y degradación de ARNm, variabilidad de celda a célula en la expresión de ARNm y localización de ARNm. Anticipamos que el protocolo es ampliamente aplicable a la poliética in vivo de la sonda y la localización de otros MRNAs en varias especies de bacterias.

Protocol

1. Preparación de sondas smFISH

NOTA: Para etiquetar las sondas smFISH con un solo fluoróforo, siga un protocolo estándar para etiquetar oligonucleótidos de ácido nucleico basado en la química del éster del NHS21.

  1. Diseñar sondas smFISH. Decida si desea utilizar sondas de "tiling" o sondas "array"(Figura 1) para el gen de interés. Consulte la sección Discusión sobre cómo tomar la decisión.
    1. Para sondeos de "tiling" (Figura 1A), utilice una herramienta de diseñador de sondas en línea (por ejemplo, consulte Tabla de materiales).
    2. Para sondeos "array"(Figura 1B), realice una búsqueda de secuencia BLAST para asegurarse de que la secuencia de sondeo no es complementaria a ninguna otra secuencia de ARNm.
    3. Para estudiar la cinética de la transcripción y degradación del ARNm de lacZ, utilice dos conjuntos de 24 sondas, cada conjunto que cubra la primera y la última región de 1 kb de lacZ (3.072 bp)19.
      NOTA: Estos conjuntos de sondas se denominan, en adelante, "sonda de ARNm de 5" y sonda de ARNm "3", respectivamente. Las secuencias de estas sondas se enumeran en la Tabla de materiales.
  2. Ordene secuencias de sonda como oligonucleótidos de ADN con un enlace de aminoácidos C6 en el extremo 5'. Disolver sondas individuales en agua a 1 mM.
  3. Combine cantidades equimolares de sondas para conjuntos de "sonda de ARNm de 5" y "sonda de ARNm" "3". Por ejemplo, para el conjunto de sondas de ARNm de 5' para lacZ,combine 20 ml de cada sonda (total 24 tipos de sondas en el conjunto).
  4. Realizar la precipitación de etanol22 de las sondas combinadas para eliminar cualquier contaminación de aminas primarias y secundarias (como Tris, glicina y sales de amonio) que puedan inhibir la reacción de conjugación. Al final, disolver el pellet de ADN en 100 l de agua (produciendo 4,5 mM de ADN en un conjunto de sondas).
    NOTA: Este paso se recomienda incluso si las sondas se sometieron a una purificación de desalado estándar por parte del fabricante. Una purificación estándar basada en filtros puede funcionar en lugar de y además de la precipitación de etanol.
  5. Elija dos fluoróforos espectralmente distintos con una mitad monofuncional del éster NHS, de modo que los conjuntos de sondas de ARNm de 5' y 3' se puedan etiquetar diferencialmente. Por ejemplo, prepare el éster Cy5 NHS para sondas de ARNm de 5' y éster Cy3B NHS para sondas de ARNm de 3'. Disolver cada tipo de fluoróforos en DMSO anhidro a 20 mg/ml final (25 mM).
  6. Preparar bicarbonato sódico de 0,1 M (pH 8.5) justo antes de cada reacción de etiquetado. La exposición al aire durante mucho tiempo reducirá su pH y reducirá la eficiencia del etiquetado.
  7. Para la reacción de conjugación, combine lo siguiente: 15 l del stock de fluoróforo Cy5 (del paso 1.5), 4 ml del conjunto de sondas de ARNm de 5' (del paso 1.4), 75 l de bicarbonato de sodio (del paso 1.6) y 7 l de agua. Envuelva el tubo con papel de aluminio y agite a temperatura ambiente durante 3-6 h.
    NOTA: Una incubación más larga no necesariamente da lugar a una mayor eficiencia de etiquetado. Además, la reacción se puede escalar hacia arriba o hacia abajo si se mantienen las concentraciones de los componentes.
  8. Repita el paso anterior para el conjunto de sondas de ARNm de 3' y el fluoróforo correspondiente (es decir, Cy3B NHS-ester).
  9. Realice la precipitación de etanol22 para eliminar moléculas de tinte no reaccionadas. Disolver el pellet en 50 ml de tampón TE (10mM Tris-HCl pH 8.0 con 1mM EDTA).
  10. Estimar las concentraciones de ADN y fluoróforo mediante el uso de un espectrómetro UV-Vis.
    1. Mida la absorbancia a 260 nm y 559 nm (Cy3B) o 649 nm (Cy5). Si la muestra está demasiado concentrada para producir una medición precisa, diluya 1 l de la muestra a 10 l.
    2. Convierta la absorbancia en la concentración:
      Equation 1
      Equation 2
      Equation 3
      ε ADN de 0,2 m-1 (para ADN de una sola cadena de 20 nt), εCy5 a 0,25 m-1y εCy3B a 0,13 m-1
      NOTA: [ADN] es la concentración de sondas totales dentro de la solución. La concentración de sondas individuales es aproximadamente 24 veces menor. La concentración de sondas totales se utilizará como "concentraciones de sonda" a partir de este punto. Si la relación entre [ADN] y [tinte] es 1, se puede omitir el siguiente paso de HPLC23, y la muestra debe diluirse a 4-5 m final en el búfer TE.
  11. (Recomendado) Purifique las sondas etiquetadas a partir de sondas sin etiquetar y tintes libres utilizando HPLC.
    NOTA: Aunque este paso de purificación adicional conducirá a la pérdida de la muestra, es beneficioso para las aplicaciones posteriores. La eliminación de sondas de ADN sin etiqueta aumentará la señal de fluorescencia de los objetivos de ARNm y la eliminación de tintes no reaccionados reducirá la fluorescencia de fondo.
    1. Prepare HPLC con una columna analítica estándar C18, acetato de trietimonimonio de 0,1 M (TEAA) como búfer A y acetonitrilo como búfer B.
    2. Agregue 1 M TEAA a la muestra (desde el paso 1.9) para hacer 0.1 M TEAA.
    3. Establezca el programa de gradiente de la siguiente manera: 0-5 min con 0% B, 5-35 min con un gradiente lineal de 0-30% de B, 35-37 min con un gradiente lineal 30-100% de B, y 37-40 min con 0% B. Mantenga el caudal en 0.1 mL/min y registre cromatogramas a 260 y 649 nm (para las muestras etiquetadas por Cy5) o a 260 y 559 nm (para las muestras etiquetadas cy3B).
    4. Recoger la muestra eluida cuando la absorbancia aumenta tanto en el ADN como en los canales de fluoróforo.
    5. Concentrar la muestra eluida utilizando un concentrador de vacío y volver a suspender el pellet en un tampón TE de 50-100 l.
  12. Compruebe la concentración de ADN y fluoróforo utilizando un espectrómetro UV-Vis (ver Paso 1.10). Diluir, si es necesario, para hacer la concentración final alrededor de 4-5 m. Almacene las sondas a -20 oC

2. Preparación de soluciones

  1. Preparar un gran volumen de agua tratada con DEPC y tampones (Tabla 1). Estas soluciones pueden durar más de un año a temperatura ambiente.
  2. Preparar la solución de fijación 4x y la solución de lavado (Tabla 1).
  3. Prepare la solución de hibridación previa y la solución de hibridación de sondas(Tabla 1). Prepare la solución de hibridación de la sonda durante la incubación en los pasos 5.1 o 6.1 y, a continuación, mantenga la solución en un agitador de encimera de 37 oC durante 20-40 min con una cubierta para minimizar la exposición a la luz.
    NOTA: Las concentraciones de formamida, SSC y sonda se optimizaron para los conjuntos de sondas lacZ para minimizar la fluorescencia de fondo mientras se maximiza la señal real. Consulte la sección Discusión para obtener más información sobre cómo modificar estas concentraciones para diferentes aplicaciones.

3. Preparación de cubreobjetos y portaobjetos de vidrio

  1. Limpie los cubreobjetos y los portaobjetos de vidrio.
    1. Coloque cubreobjetos y diapositivas individuales en un frasco de Coplin usando fórceps. Asegúrese de que los cubreobjetos y las diapositivas estén separados y no se toquen entre sí.
    2. Llene el frasco con etanol 100% y cierre la tapa. Coloque el frasco en un limpiador ultrasónico de baño de agua y sonicar durante 15-20 min.
      NOTA: Para el sonicador de baño de agua, se recomienda apagar la función del calentador.
    3. Vierta el etanol y lave con agua ultrapura 3-4x. Utilice el agua que fluye directamente desde la máquina de purificación de agua.
    4. Vierta el agua del frasco y llénelo con 70% de etanol. Cierre la tapa y realice la sonicación durante 15-20 minutos y lave con agua ultrapura.
    5. Llene el frasco con agua ultrapura y sonicar durante 15-20 min.
      NOTA: Los cubreobjetos y toboganes de vidrio se pueden mantener durante la noche en el frasco de Coplin lleno de agua ultrapura.
    6. Saque un portaobjetos o un cubreobjetos del frasco de Coplin con fórceps limpios y séquelo con gas N2. Repita esto para las diapositivas y los cubreobjetos restantes.
  2. Coloque los portaobjetos secos en una caja de almacenamiento limpia hasta que se utilicen en el paso 7.5. Coloque los cubreobjetos secos en una caja de punta de pipeta vacía de 1.000-L, que servirá como una "cámara" en el procedimiento restante.
  3. Usando un marcador hidrófobo, dibuje círculos en los cubreobjetos después de agujeros circulares en la caja de punta de la pipeta. Estos círculos (0,5 cm de diámetro) servirán como "pozos". Espere al menos 5-10 min para que el marcador se seque por completo.
    NOTA: Mantenga siempre la tapa de la caja de la punta cerrada.
  4. Aplicar una caída de 20-L de 0.1% poli-L-lisina a cada pocól. Incubar durante 10-50 min a temperatura ambiente.
    NOTA: Ajuste este volumen según el tamaño del pozo. Asegúrese de que la solución cubra completamente el área del pozo. Para una incubación más larga, tenga cuidado de evitar la evaporación.
  5. Después de la incubación aspirar poli-L-lisina sin tocar la superficie, ya que esto raspará la poli-L-lisina. A continuación, aplique una gota (20 oL) de agua DEPC a los pomos tratados con poli-L-lisina. Cierre la tapa de la "cámara" para evitar la evaporación hasta el paso 5.1.

4. Experimento de curso de tiempo y fijación de muestras

  1. Cultivar células de E. coli en un cultivo líquido de 20 ml en un matraz de 250 ml. Conservar el matraz en una coctelera de baño de agua (30 oC) y continuar agitando. Detenga el agitador sólo cuando tome muestras.
    NOTA: Los resultados presentados en este artículo se obtienen de células MG1655 cultivadas en medio mínimo M9 complementado con 0,2% de glicerol, 0,1% de ácidos casamino y 1 mg/L de tiamina a una fase de crecimiento exponencial (OD600a 0,2).
  2. Añadir 250 l de la solución de fijación 4x en un tubo vacío de 1,5 ml. Repita y prepare varios tubos, tantos como los puntos de tiempo a tomar. Etiquete los tubos con números de punto de tiempo y manténgalos a temperatura ambiente.
  3. Tome 750 l de cultivo celular (OD600x 0,2) antes de iniciar un experimento de tiempo-curso. Agregue el cultivo a un tubo marcado para "tiempo cero" (desde el paso 4.2). Invierta el tubo suavemente para mezclar las células con la solución de fijación.
    NOTA: No pipetee hacia arriba y hacia abajo para mezclar, vórtice o "ser áspero" en las células. Esta muestra representa el estado reprimido y se utilizará como control para calcular la intensidad de fluorescencia de un solo ARNm (ver Paso 9.4).
  4. Añadir 0,02-1 mM de isopropilo β-D-1-thiogalactopyranoside (IPTG) al cultivo líquido para inducir la expresión de lacZ. Inicie un temporizador en este punto (t a 0 min) y muestree en un intervalo de tiempo determinado (por ejemplo, cada 1 min) a partir de entonces. Para el muestreo, repita el paso 4.3.
  5. Añadir 5 mM de ortonitroheynl-β-D-fucopyranoside (ONPF) o 500 mM de glucosa24 en un momento determinado durante el experimento de tiempo-curso (p. ej. en t a 1,5 min) para reprimir la expresión de lacZ. Después de la re-represión, continúe probando los cultivos (Paso 4.3) para rastrear la degradación del ARNm.
    NOTA: La represión también se puede hacer con rifampina de 400 g/ml, un inhibidor de iniciación de transcripción25.
  6. Para la fijación, incubar los tubos que contienen células muestreadas a temperatura ambiente durante 15 min, seguidos de incubación en hielo durante 30 min.
  7. Para eliminar los fijadores, centrifugar los tubos a 4.500 x g durante 4 minutos a temperatura ambiente. Retire el sobrenadante con una pipeta.
    NOTA: Asegúrese de desechar el formaldehído en un contenedor de residuos separado siguiendo el protocolo de seguridad.
  8. Agregue 1 mL DEPC-PBS y vuelva a suspender las celdas. Repetir centrifugación y re-suspensión 2 veces más veces.
    NOTA: Las células fijas son frágiles y necesitan un tratamiento suave. Reabrir cuidadosamente el pellet y evitar las burbujas.
  9. Después del paso de lavado final, vuelva a suspender las células en DEPC-PBS de 30 ml.

5. Permeabilización de las membranas celulares

  1. Aplicar cada muestra de punto de tiempo a diferentes pomos en el cubreobjetos (30 ml por pocódus). Espere 10-30 minutos a temperatura ambiente para que las células se adhieran a la superficie. Evite la fusión de las gotas líquidas entre los pozos.
  2. Para enjuagar las células no unidas, aspire el líquido y aplique DEPC PBS de 20 ml a cada pocópta. Aspirar DEPC PBS en pocos minutos.
  3. Permeabilizar las membranas celulares mediante la aplicación de 15 l de 70% de etanol a cada pozo durante 4 min. Aspirar el etanol después de los 4 min, y asegúrese de que los pozos estén completamente secos.
    NOTA: Es fundamental limitar el tratamiento con etanol durante 4 min. Un tratamiento más largo dará lugar a una permeabilización excesiva.
  4. Aplicar 30 l de la solución de lavado a cada pocól.

6. Hibridación de sondas

  1. Aspirar la solución de lavado de cada pozo. Aplicar 30 l de la solución de pre-hibridación a cada pocól. Incubar la cámara en el horno de 37oC durante 30 min.
    NOTA: Agregue 50 ml de agua al fondo de la cámara para proporcionar humedad.
  2. Aspirar la solución de pre-hibridación de cada pozo. Aplique 30 l de la solución de hibridación de la sonda a cada pocól. Cubrir la cámara con papel de aluminio e incubar en el horno de 37oC durante 2 h.
    NOTA: Asegúrese de que la solución de hibridación de la sonda se encuentra en el agitador de encimera de 37 oC antes de este paso. Evitar la fusión de líquidos entre pozos. Aplique un volumen más pequeño de la solución a cada pozo, si es necesario.

7. Lavado y preparación post-hibridación para imágenes

  1. Con una pipeta multicanal, aplique 30 ml de la solución de lavado a cada pozo a la vez. Aspirar y repetir 3-5 veces de lavado. Incubar la cámara en el horno de 37oC durante 15-30 min.
  2. Repita el paso 7.1 dos veces más.
  3. Lave cada pozo con DEPC-PBS 5 veces. Siga el método utilizado en el paso 7.1, pero omita el proceso de incubación.
  4. Aspirar el líquido del cubreobjetos. Aplique 4 l de DEPC-PBS a cada pocól.
  5. Usando fórceps, levante y voltee el cubreobjetos, y colóquelo suavemente sobre un portaobjetos de vidrio (desde el paso 3.2). Evita las burbujas.
  6. Selle los bordes del cubreobjetos con goma dental de silicona.
  7. Espere hasta que la encía se solidifice. Uno puede hacer una pausa aquí y almacenar el portaobjetos durante la noche a 4 oC.
    NOTA: Otros protocolos smFISH sugieren añadir reactivos de barrido de oxígeno (por ejemplo, glucosa oxidasa/catalasa) o utilizar un medio de montaje anti-fade comercial14,26 para aumentar la fotoestabilidad de los fluoróforos.

8. Imágenes

  1. Para encontrar un área de interés, utilice el modo en vivo de imágenes de contraste de fase. Cambie el campo de visión dentro de un pozo maniobrando el joystick del escenario. Elija un área donde la densidad de celdas sea óptima (es decir, hay muchas celdas que están separadas en su mayoría). Ajuste el enfoque z de modo que las imágenes de celda de contraste de fase estén enfocadas.
  2. Tome instantáneas en el orden de Cy5 (exposición de 4 s), Cy3 (exposición de 2 s) y contraste de fase (exposición de 0,2 s).
    NOTA: Las moléculas de tinte Cy3B se visualizan en el canal Cy3, y las imágenes se conocen como imágenes Cy3.
  3. Repita los pasos 8.1-8.2 para adquirir imágenes de 10 áreas diferentes dentro de un pozo.
  4. Mueva el objetivo a otro pozo y repita los pasos 8.1-8.3.
  5. Exportar imágenes como archivos TIFF.
  6. (Opcional) Imagen de perlas multicolor adsorbidas en la superficie del cubreobjetos en los canales Cy5 y Cy3 para determinar el desplazamiento espacial entre los canales Cy5 y Cy3 para fines de registro de imágenes.
    1. Aplicar 10 ml de perlas fluorescentes multicolores (diámetro de 0,2 m) sobre una superficie limpia de cubreobjetos y esperar de 10-30 min. Después de lavar con 50 oL de PBS, aplicar 5 l de PBS y emparedar el cubreobjetos con un portaobjetos de vidrio. Selle y monte en el microscopio.
    2. Cuentas de imagen en los canales Cy5 y Cy3.

9. Análisis de imagen

NOTA: El código Matlab utilizado en este paso está disponible en el siguiente sitio web de GitHub: https://github.com/sjkimlab/Code_Publication/tree/master/JoVE_2020. La carpeta GitHub contiene todo lo necesario para el análisis de imágenes, incluidos los valores de parámetro para la segmentación de celdas y la identificación de puntos. El procedimiento en este paso se explica más detalladamente en el script maestro, llamado "FISHworkflow.m".

  1. Abra una herramienta de segmentación de celdas, como microbeTracker27 u Oufti28,e imágenes de contraste de fase de carga. Elija "Marcos independientes" y pulse un botón llamado "Todos los fotogramas" para comenzar el proceso de segmentación, a partir del cual se identifican las celdas y se calculan sus contornos (Figura 3B,C).
    NOTA: Los protocolos detallados para utilizar estos paquetes de software están disponibles en línea (por ejemplo, oufti.org).
  2. Cargue las imágenes de fluorescencia Cy5 en la función spotFinder de microbeTracker u Oufti, y pulse el botón"Ejecutar"para iniciar la identificación y cuantificación del punto basada en el ajuste gaussiano 2D (Figura 3B,C). Repita este paso para que las imágenes de fluorescencia Cy3 analicen puntos en el canal Cy3. Este paso produce una lista de manchas en cada celda, incluidas sus intensidades y coordenadas.
  3. (Opcional) Filtre los puntos tenues (falsos positivos) utilizando un umbral, como se explica en el archivo FISHworkflow.m.
    NOTA: Examine los puntos fluorescentes en el control negativo (p. ej., MG1655 álacZ)y determine el umbral para filtrar los falsos positivos.
  4. Para obtener la intensidad puntual de un solo ARNm, utilice una lista de intensidades puntuales medidas en el tiempo cero (antes de añadir IPTG) y ajuste la distribución de intensidades puntuales con un modelo de mezcla gaussiana con dos componentes de mezcla. Tome la posición máxima de la primera población gaussiana (línea negra en la Figura 3D,E)como la intensidad puntual de un solo ARNm. Realice esto para las manchas Cy5 y las manchas Cy3 por separado para obtener la intensidad puntual de un solo ARNm lacZ de 5' y 3'.
    NOTA: Repita esto en cada experimento de curso de tiempo porque la intensidad puntual de un solo ARNm puede variar ligeramente en diferentes experimentos.
  5. Divida la intensidad de fluorescencia de un punto con la intensidad de un solo ARNm (del paso 9.4) para obtener el número de ARNm dentro de un punto. Suma de intensidades puntuales normalizadas dentro de una celda para calcular el número total de ARNm en una celda (Figura 3F). Realice estos cálculos para 5' y 3' mRNA por separado.
  6. Calcular y trazar los números medios de ARNm por célula en cada punto de tiempo (por ejemplo, Figura 4B), y analizar la cinética in vivo de la transcripción y la degradación del ARNm a partir del cambio temporal en los niveles medios de ARNm (Figura 4B).
    1. Para obtener la tasa de alargamiento de transcripción, realice un ajuste de mínimos cuadrados de una línea al aumento inicial en señales de ARNm de 5' y 3' e identifique las interceptaciones a los niveles basales (Figura 4B). La diferencia entre estas interceptaciones indica el tiempo medio para que los PNRP viajen de la región de sondeo de 5' a la región de sondeo de 3'. Divida la distancia entre dos conjuntos de sondas (2 kb) con este tiempo para obtener la tasa media de alargamiento de transcripción.
    2. Para obtener la tasa de degradación del ARNm, ajuste una función de decaimiento exponencial, y - A-exp(-t/-) a la región de descomposición final de las señales de ARNm de 5' y 3' (por ejemplo, figura 4B). El parámetro de ajuste, el valor de la mametra de resonancia.
  7. (Opcional) Analice la variación de célula a célula en la expresión génica (por ejemplo, la respuesta a nivel de célula a la inducción que se muestra en la Figura 4C),basándose en la distribución de números de ARNm en cada celda (calculada en el paso 9.5).
  8. (Opcional) Utilizando información sobre la ubicación del punto a lo largo de los ejes principal y menor de una celda (obtenida del paso 9.2), analice la localización de los mRNAs (Figura 4D,E).
  9. (Opcional) Analice la co-localización de 5' y 3' mRNAs (Figura 5) comparando la localización de las manchas detectadas en los canales Cy5 y Cy3.
    1. Cargue imágenes de perlas multicolores (Paso 8.6) en la función spotFinderF en microbeTracker y obtenga coordenadas de centroides de cuentas en los canales Cy5 y Cy3. Utilice la lista de coordenadas centroide para calcular la matriz de transformación afines, que informa cómo se desplazan y giran los canales Cy5 y Cy3 entre sí29.
    2. Aplique la matriz de transformación afín a las imágenes Cy5 y Cy3 FISH para convertir imágenes Cy3 en la coordenada Cy5. Clasificar si un punto está co-localizado con otro punto en un canal diferente. Por ejemplo, un punto en el canal Cy5 se considera co-localizado con otro punto en el canal Cy3 si la distancia entre sus centroides es inferior a 150 nm (Figura 5).
    3. Analice cuántas manchas Cy5 se clasifican como "colocalizadas" con puntos Cy3 en cada punto de tiempo. Además, analice la intensidad de los puntos colocalizadas (Figura 5).

Representative Results

La Figura 3 muestra imágenes representativas de este protocolo smFISH. Un campo de visión completo (86,7 m x 66,0 m utilizando nuestra configuración de microscopía detallada en la Tabla de materiales)muestra 500 células de E. coli dispersas por todo el campo ( Figura3A). Si la densidad de las celdas es mucho mayor que la que se muestra en esta imagen, la segmentación automática de celdas se vuelve difícil ya que los algoritmos de segmentación no identifican de forma fiable las celdas individuales cuando las celdas se tocan entre sí. Es necesario ajustar la concentración de células y el tiempo de incubación utilizado para la adherencia superficial (Paso 5.1) para lograr la densidad óptima de las células en el campo de visión.

La morfología de las células en las imágenes de contraste de fase debe seguir siendo comparable a la de las células vivas con fines de segmentación(Figura 3A-C). Si las células están sobre-permeabilizadas, la morfología celular cambia (como "fantasmas"; Figura complementaria 1). En ese caso, se puede reducir la duración del 70% del tratamiento con etanol en el paso 5.3.

Antes de la inducción, el nivel medio de expresión lacZ era de 0,03 mRNAs por celda, de conformidad con los informes anteriores15,30. Además, la distribución de las intensidades puntuales de ARNm lacZ antes de la inducción no encajaba bien con una distribución normal o una distribución de Poisson debido a la presencia de manchas con altas intensidades (Figura 3D,E). Esto sugiere que la mayoría de las manchas detectadas bajo el estado reprimido representan un solo ARNm lacZ, pero una pequeña población de manchas contiene más de un ARNm lacZ. Para aislar la población con un solo ARNm lacZ, utilizamos un modelo de mezcla gaussiana con dos componentes de mezcla (insets en la Figura 3D,E). A continuación, la media del primer gaussiano se tomó como la intensidad media de un solo punto de ARNm (por ejemplo, el pico de la curva negra en la Figura 3D)y se utilizó para convertir la intensidad del punto al número de ARNm, para cualquier punto detectado en el experimento de tiempo. Para calcular el número total de mRNAs dentro de una celda, las intensidades de punto normalizadas se sumaron en cada celda (Figura 3F)19.

Cuando el nivel de expresión de ARNm lacZ es bajo, hay una o dos manchas de ARNm lacZ limitadas por difracción separadas espacialmente dentro de una celda. Por lo tanto, las imágenes de estos puntos pueden ser analizadas por ajuste gaussiano 2D para su intensidad y localización.

Cuando el nivel de expresión es alto, de tal manera que las manchas se superponen entre sí dentro de una celda, el ajuste gaussiano 2D no realiza una cuantificación fiable. En ese caso, el nivel de ARNm debe calcularse dividiendo la señal de fluorescencia total, restada por fondo dentro de una célula con la intensidad media de un solo ARNm19.

Cuando se induce la expresión de lacZ, la señal de 5' lacZ mRNA aumenta primero y la de 3' lacZ mRNA aumenta más tarde (Figura 4B). Si se reprime la expresión de lacZ, las señales de ARNm de 5' y 3' disminuyen con algún retraso en el medio(Figura 4B). Para obtener la tasa de alargamiento de transcripción, el aumento de las señales de 5' y 3' se ajusta primero con las líneas (Figura 4B), y la diferencia en las intercepciones x se toma como el tiempo para que los PNRP viajen la distancia entre dos regiones de sonda (2.000 nt). La tasa de alargamiento de transcripción se puede medir a partir de cada experimento de curso de tiempo y las desviaciones estándar se pueden calcular a partir de duplicados experimentales. La tasa media de alargamiento de transcripción fue de 15-30 nt/s bajo nuestras condiciones experimentales19.

Además, la tasa de degradación del ARNm (inversa de la vida útil media del ARNm) se obtuvo ajustando la región de descomposición con una función exponencial (Figura 4B). Nuestros datos del curso de tiempo contienen la degradación del ARNm durante y después de la transcripción31. Ajustamos los puntos de tiempo después de que 3' mRNA comenzó a decaer (t > 6 min) para sondear la degradación de los ARNm liberados. Obtuvimos 90 s como una vida útil media de 5' o 3' lacZ mRNA19.

La tasa de iniciación de la transcripción se puede calcular a partir de la pendiente del aumento de la señal de 5' después de la inducción(Figura 4B, azul), o del número medio de ARNm en estado estacionario (que es la tasa de iniciación dividida por la tasa de degradación). Además, se puede estimar la probabilidad de terminación prematura de la transcripción, ya sea tomando la relación entre la pendiente del aumento de la señal de 3' frente al de 5' aumento de la señal32 o entre los niveles de estado estacionario de 3' y 5' regiones de ARNm19.

Debido a que smFISH es una técnica de una sola célula, podemos analizar la variabilidad de célula a célula en la transcripción. Por ejemplo, se puede analizar el porcentaje de celdas que expresan lacZ mRNA después de agregar IPTG (Figura 4C). También se puede abordar si la localización de ARNm cambia después de la inducción. Observamos que los puntos de ARNm de 5' y 3' de LAcZ se mueven ligeramente hacia afuera, lejos del centro de la célula (Figura 4D,E), de conformidad con un informe anterior33.

Por último, el análisis de la co-localización entre 5' y 3' puntos de ARNm puede ser informativo (Figura 5A). Por ejemplo, en el estado reprimido (tiempo cero), alrededor del 25% de las manchas de ARNm de 5' se co-localizan con un punto de ARNm de 3'. En t a 1 min, ya que muchos loci gen tienen síntesis de ARNm de 5', pero aún no síntesis de ARNm de 3', la mayoría de los puntos de ARNm de 5' son por sí mismos sin señal de ARNm de 3' (es decir, baja probabilidad de co-localización). Sin embargo, cuando aparece el ARNm de 3' (es decir, t a 2 min), aumenta la probabilidad de co-localización (flecha púrpura en la Figura 5A,B). Este punto de tiempo, cuando la co-localización se vuelve frecuente, depende de la tasa de alargamiento de transcripción. La gráfica de densidad 2D de números de ARNm lacZ de 5' y 3' dentro de cada punto de co-localización detectado en este punto de tiempo se puede utilizar para inferir la densidad de ARNP en el gen lacZ (Figura 5C). Como se informó anteriormente19, los números de ARNm de 5' en esta gráfica indican que la mayoría de los loci lacZ tienen menos de 10 ARNP en el ADN cuando la expresión lacZ es inducida por 1 mM IPTG. Además, los números de ARNm de 3' en esta gráfica están relacionados con la agrupación en clústeres de ARNP34. El hecho de que el número de ARNm de 3' esté cerca de uno significa que aproximadamente sólo un ARNP entra en la región de la sonda de 3'. Esto sugiere que los PNRP en el gen lacZ están separados espacialmente, en lugar de formar un cúmulo (o "convoy").

Figure 1
Figura 1: Diseño de sondas smFISH para un ARNm de interés. (A) Un método de ordenamiento en teselas. Se eligen secuencias de oligonucleótidos de ADN cortos (20 bp de longitud) para que puedan cubrir el ARNm de interés. Las sondas de oligonucleótidos están etiquetadas con una molécula de tinte fluorescente. (B) Un método de matriz. Una matriz no codificantes de secuencias en tándem (por ejemplo, "matriz lacO") se fusiona transcripcionalmente al ARNm de interés. La sonda con etiqueta fluorescente complementaria a la unidad de repetición (por ejemplo, sonda lacO de 17 bp de longitud) se utiliza para amplificar la señal de un ARNm. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: Esquema del procedimiento experimental smFISH y duración del tiempo de cada paso. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: análisis de imágenes smFISH. (A-C) imagen de microscopía smFISH de 5' lacZ mRNA (rojo) y 3' lacZ mRNA (verde) en tipo salvaje E. coli (MG1655) cultivado en medio mínimo M9 complementado con 0,2% de glicerol, 0,1% de ácidos de casamino, y 1 mg/L de tiamina a 30oC. (A) Una imagen representativa de una muestra de t a 3 min después de la inducción con 0,05 mM de IPTG a t a 0 min y la represión con 500 mM de glucosa a t a 1,5 min. El contraste de fase y dos imágenes de fluorescencia de Cy5 (para 5' lacZ mRNA, rojo) y Cy3 (para 3' lacZ mRNA, verde) fueron superpuestas con pseudo-colorante. La imagen muestra un campo completo de 86,7 m x 66,0 m. Barra de escala, 5 m. (B) Versión ampliada de una pequeña región (cuadro amarillo) en (A). Los contornos de celda se muestran en blanco, y las manchas de fluorescencia identificadas a partir del análisis de imágenes se muestran con puntos rojos. Barra de escala, 1 m. (C) Detección de contornos de celdas y puntos fluorescentes bajo una condición de alta expresión (t a 4 min después de la inducción con 1 mM de IPTG). Barra de escala, 1 m. (D-E) Distribuciones de intensidades puntuales de ARNm de 5' y 3' medidas antes de añadir IPTG (el estado reprimido). Los histogramas se muestran con dos funciones gaussianas (negro y gris) cuyos valores medios provienen del modelo de mezcla gaussiana. La inserción muestra la gráfica cuantil-cuantitativa de los números aleatorios generados a partir de los modelos de mezcla gaussiana e intensidades de punto de ARNm medida experimentalmente (n a 1040 para 5' mRNA y 680 para 3' mRNA). (F) Información obtenida para una celda individual puntiaguda en el panel (B). Para una célula determinada (i), se identificaron manchas en los canales Cy5 y Cy3, y su intensidad (I) y su coordenada a lo largo del eje corto y largo de una celda (d, l) se cuantificaron a partir del accesorio gaussiano 2D. Después de la normalización, las intensidades del punto se sumaron para producir el número total de 5' o 3' mRNAs en esta célula. También, la co-localización entre los puntos de diversos canales se puede analizar como en el ejemplo mostrado en el cuadro 5. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: Análisis de la cinética in vivo de la transcripción y la degradación del ARNm. (A) Imágenes esquemáticas y representativas de experimentos smFISH de dos colores que miden los cambios en los niveles de ARNm lacZ a lo largo del tiempo. Las líneas punteadas rojas y verdes indican sondas de oligonucleótidos etiquetadas Cy5 o Cy3B que hibriden en las regiones de ARNm de 1 kb de largo de 5' y 3' de ARNm lacZ en E. coli,respectivamente. También se muestran superposiciones de dos imágenes de fluorescencia con una imagen de contraste de fase en los puntos de tiempo indicados después de la inducción con 0,2 mM de IPTG a t a 0 min. La transcripción fue reprimida con 500 mM de glucosa a t a 1,5 min. Barra de escala, 1 m. La figura ha sido modificada de Kim et al19. (B) 5' y 3' números de ARNm lacZ por célula a lo largo del tiempo, durante el experimento descrito en el panel (A). Las barras de error son SEM arrancados. Se analizaron al menos 1.200 células por punto de tiempo. El aumento inicial de las señales de ARNm de 5' y 3' fue apto con una línea (azul). La diferencia en las intercepciones x fue de 1,93 min, lo que produjo la tasa media de alargamiento de transcripción de 17,3 nt/s. La decadencia final de las señales de ARNm de 5' y 3' encajaba con una función de descomposición exponencial (gris). Los parámetros de ajuste indican que la vida útil media del ARNm es de 1,52 min para el ARNm de 5' y 1,66 min para el ARNm de 3'. (C) Porcentaje de células con una o más manchas de ARNm lacZ durante el experimento descrito en (A). Las barras de error son SEM arrancados. (D) Localización de un punto a lo largo del eje corto de una celda. Se puede cuantificar la proximidad de un punto a la membrana dividiendo la ubicación a lo largo del eje corto (d) con la mitad de la anchura de la celda (w). (E) Cambio en la localización de 5' y 3' manchas de ARNm lacZ a lo largo del eje corto de las células durante el experimento descrito en (A). Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: Análisis de la co-localización de 5' y 3' manchas de ARNm. (A) Esquema que muestra la co-localización esperada entre 5' y 3' puntos de ARNm después de la inducción. Cuando se produce un ARNm de 3', aumenta la probabilidad de que un punto de ARNm de 5' se colocalice con un punto de ARNm de 3' (flecha púrpura). (B) La probabilidad de co-localización después de la inducción con 1 mM IPTG. La flecha púrpura indica el punto de tiempo en el que la probabilidad de co-localización se vuelve frecuente de acuerdo con el esquema en el panel (A). (C) El número de 5' y 3' lacZ mRNAs dentro de un punto de co-localización detectado en t a 2 min después de la inducción con 1 mM IPTG (total 841 puntos). Los puntos grises representan puntos colocalizadas individuales, mientras que los puntos rojos representan el promedio de los datos localizados. Las barras de error son SEM. El tono de gris indica la densidad de puntos en un área determinada del gráfico. La línea punteada indica una pendiente de 1. Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6: Optimización de la condición de hibridación de sondeo. Se utilizaron dos tipos de muestras: células MG1655 cultivadas como se describe en la Figura 3 y permanecen sin inducir (azul) o tratadas con 0,5 mM de IPTG durante 20 min (rojo). La solución de hibridación de sondas se hizo con diferentes concentraciones de sondas (total 72 sondas Cy5 conjugadas a mosaico de toda la región lacZ) y de formamida. Las concentraciones de formamida también se ajustaron en la solución de pre-hibridación y la solución de lavado, en consecuencia. "Sin sonda" (línea gris) indica el nivel de fluorescencia de las células añadidas por IPTG tratadas sin sondas durante el paso de hibridación. La intensidad media de fluorescencia normalizada por área celular (UA) se calculó a partir de 300-800 células. Las barras de error son SEM arrancados. Haga clic aquí para ver una versión más grande de esta figura.

Figura complementaria 1: Morfologías celulares distorsionadas debido a la permeabilización excesiva. Superposición de contraste de fase (escala gris), 5' lacZ mRNA (Cy5, rojo) y 3' lacZ mRNA (Cy3, verde) imágenes de células MG1655 5 min después de la inducción con 1 mM IPTG. (A) Un ejemplo que muestra la mezcla de células normales y células excesivamente permeabilizadas que carecen de morfología normal (indicada con flechas rosas). (B) Un ejemplo que muestra celdas "fantasma" agrupadas. Barra de escala a 1 m. Haga clic aquí para descargar este archivo.

AGUA DEPC
Añadir 0.1% DEPC al agua ultrapura e incubar la botella (cubierta) en el horno de 37oC durante la noche y autoclave al día siguiente.
DEPC PBS (10X)
Mezcle lo siguiente:
80 g NaCl (final 1.37 M)
2 g KCl (final 27 mM)
14,2 g Na2HPO4 (final 100 mM)
2,7 g KH2PO4 (final 20 mM)
Agua ultrapura a 1L
Filtrar (0,22 m) en una botella de vidrio.
Añadir 0.1% DEPC y seguir las instrucciones para el agua DEPC.
Para hacer una solución 1X, diluir 10 veces con agua DEPC.
1M DEPC tampón de fosfato sódico, pH 7.4
Mezcle lo siguiente:
115 g Na2HPO4
22,8 g NaH2PO4
Agua ultrapura a 1 L
Filtrar (0,22 m) en una botella de vidrio.
Añadir 0.1% DEPC y seguir las instrucciones para el agua DEPC.
Solución de fijación 4X (16% formaldehído)
5 mL 20% de formaldehído
500 l AGUA DEPC
750 l 1M DEPC tampón de fosfato sódico, pH 7.4
Conservar a 4oC durante un máximo de 2-4 semanas.
ADVERTENCIA: El formaldehído es tóxico. Use guantes y use una campana de humo al hacer esta solución.
Solución de lavado
Mezcle lo siguiente:
10 mL Formamida (final 25%)
4 mL 20X SSC (final 2X)
Llenar el agua DEPC a 40 mL
Filtrar (0,22 m) y conservar a 4 oC
ADVERTENCIA: La formamida es tóxica. Use guantes y use una campana de humo al hacer esta solución.
Solución de pre-hibridación
200 l Formamida (final 20%)
100 l 20X SSC (final 2X)
10 l 100X VRC (final 1X)
25 l 4% (p/v) BSA (final 0,1%)
685 l AGUA DEPC
NOTA: Vórtice el stock de VRC antes de sacar 10 l.
ADVERTENCIA: La formamida es tóxica y se conoce a teratógeno. Use guantes y manéjelo debajo de una campana de humos.
Solución de hibridación de sondas
200 l Formamida (final 20%)
100 l 20X SSC (final 2X)
10 l 100X VRC (final 1X)
25 l 4% (p/v) BSA (final 0,1%)
10 l 40 mg/ml E. coli tRNA (final 0,4 mg/ml)
200 l 50% sulfato de dextrán (final 10%)
x L 5' mRNA probe set (del paso 1.12) al final 4 nM.
y'L' 3' mRNA probe set (del paso 1.12) al final 4 nM.
- AGUA DEPC para hacer el volumen total 1 mL
NOTA: Agregue el sulfato de dextrán por última vez. Debido a que es muy viscoso, corte el extremo de una punta de pipeta antes de sacar 200 l de la población del 50%. Después de añadir sulfato dextrano, pipetear hacia arriba y hacia abajo para homogeneizar la solución.

Tabla 1: Recetas de las soluciones utilizadas.

Discussion

Aquí, presentamos un protocolo smFISH para medir la cinética de ARNm en E. coli. En los protocolos smFISH publicados anteriormente para las bacterias23,las células se mantuvieron en los tubos hasta el final del protocolo, es decir, hasta que están listas para la toma de imágenes. Si bien tiene muchos beneficios, como la unión mínima inespecífica de sondas fluorescentes en la superficie del cubreobjetos23,es difícil seguir estos protocolos cuando hay muchas muestras de un experimento de curso de tiempo. En primer lugar, un volumen relativamente grande de células (>1 ml) necesita ser muestreado e incluso cosechado antes de la fijación. En segundo lugar, las muestras de células deben ser centrifugadas varias veces para intercambiar soluciones y lavarse después del paso de hibridación. En nuestro protocolo, un pequeño volumen (<1 mL) de cultivo se mezcla directamente con una solución de fijación en un tubo de 1,5 ml, ayudando a "congelar" rápidamente el estado de la célula en el momento del muestreo. Además, las células permanecen unidas a la superficie durante todo el procedimiento, y diferentes soluciones se pueden intercambiar rápidamente aspirando líquidos con un sistema de filtración por vacío y aplicando gotas de solución a la vez con una pipeta multicanal. Esta diferencia hace que nuestro protocolo sea muy ventajoso cuando un gran número de muestras necesitan ser procesadas a la vez. Usando nuestro protocolo, 12-48 muestras se pueden manejar simultáneamente y todo el procedimiento FISH se puede completar dentro de 8 horas, aproximadamente una cantidad similar de tiempo necesario para unas pocas muestras (Figura 2). Aunque utilizamos la expresión de lacZ en E. coli como ejemplo, el protocolo es ampliamente aplicable a diferentes genes y especies bacterianas con consideraciones discutidas a continuación.

Para diferentes genes, lo primero que hay que tener en cuenta son las sondas smFISH. Se pueden diseñar sondas de oligonucleótidos que teen el ARNm de interés (Figura 1A)13. En este enfoque de sonda de "mosaico", cada sonda tiene una longitud de 20o y está etiquetada con un fluoróforo en la terminal de 5' o 3'. Esta estrategia es conveniente, ya que no se necesita manipulación genética. Alternativamente, se puede insertar una repetición en tándem de secuencia de 20 bp, ajena a la secuencia genómica (por ejemplo, una serie de secuencias lacO en Caulobacter crescentus14), en la región no traducida de un gen de interés y se utiliza una sola sonda complementaria a la unidad de repetición para etiquetar el ARNm ("enfoque de arreglo"; Figura 1B). En ambos casos, varios fluoróforos decoran un ARNm, dando una señal de fluorescencia amplificada que se puede diferenciar fácilmente de una sola sonda enlazada sin especificación dentro de una celda.

Si elegir enfoques de "tiling" o "array" depende del control negativo, una muestra donde se prueba el enlace no específico de sondas porque carece del ARNm de destino. Para las sondas de mosaico (Figura 1A), una cepa mutante sin el gen de interés o una condición, en la que el gen no se transcribe (por ejemplo, la represión de lacZ) puede servir como un control negativo para probar la unión inespecífica de sondas. Para el smFISH basado en matrices (Figura 1B), una cepa de tipo comodín que carece de la matriz puede servir como un control negativo porque no contiene sitios de enlace para los sondeos.

Las condiciones óptimas de hibridación pueden depender de las secuencias de la sonda e incluso de la elección de los tintes de fluoróforo. Optimizamos la condición de hibridación para los conjuntos de sondas lacZ manteniendo la temperatura de hibridación a 37 oC y probando diferentes concentraciones de conjuntos de sondas y formamida en la solución de hibridación. Las concentraciones más altas de formamida tienden a reducir la unión no específica y no específica26,35. Recomendamos cambiar sistemáticamente la hibridación y sus condiciones de lavado manteniendo el tiempo y la temperatura de hibridación iguales. A medida que la condición se vuelve más estricta, disminuyen tanto los enlaces no específicos como los específicos (Figura 6). Es importante encontrar un punto en el que el enlace no específico comience a alcanzar por debajo de un umbral aceptable sin comprometer aún más la unión específica. Por ejemplo, utilizamos el nivel de señal obtenido sin ningún sondeo ("sin sondas") como umbral(Figura 6).

El método smFISH de dos colores que etiqueta dos regiones separadas de un ARNm se limita a genes largos. Para medir la tasa de alargamiento de transcripción, aprovechamos el hecho de que lacZ es larga (3075 bp) y su expresión puede ser inducida por IPTG. Cuando un gen es corto, es difícil diseñar dos conjuntos de sondas de mosaico (cerca de 5' y 3' extremos) y resolver el retardo de tiempo entre apariciones de 5' vs. 3' regiones de ARNm. En este caso, se pueden contar los mRNas nacientes en estado estacionario por smFISH y analizar su distribución con un modelo analítico que tiene la tasa de alargamiento de transcripción como parámetro de ajuste20. Además, cuando un gen de interés no es inducible, se pueden tratar las células con rifampicina en el momento cero y medir el cambio temporal en subregiones de ARNm de 5' y 3'. El retardo de la disminución de la señal de ARNm de 5' a la de la señal de ARNm de 3' se puede utilizar entonces para calcular la tasa de alargamiento de transcripción como se hizo anteriormente31.

Por último, el protocolo smFISH es versátil y se puede combinar con otros esquemas de etiquetado. Anteriormente, el locus de ADN se visualizaba junto con los ARNM combinando mRNA FISH con DNA FISH14 o el sistema fluorescente reportero-operador20. Los productos proteicos pueden visualizarse realizando inmunofluorescencia junto con mRNA FISH14,,36. Además, se puede combinar con microscopía tridimensional de superconorción37 para visualizar los MRNAs en las tres dimensiones38,,39.

Disclosures

Los autores declaran que no tienen intereses financieros competidores.

Acknowledgments

Este protocolo fue desarrollado por S.K. durante su investigación postdoctoral en el laboratorio de la Dra. Christine Jacobs-Wagner en el Instituto Médico Howard Hughes y el Instituto de Ciencias Microbianas de la Universidad de Yale. Agradecemos a la Dra. Jacobs-Wagner y a los miembros de su laboratorio por diversos aportes durante el desarrollo del método y a Laura Troyer por la lectura crítica del manuscrito. S.K. reconoce el apoyo del Programa de Becas Searle; K.V. reconoce el apoyo del James Scholar Preble Research Award de la Universidad de Illinois.

Materials

Name Company Catalog Number Comments
Bacterial strain
Escherichia coli MG1655
Chemicals, peptides, and others
Acetonitrile Sigma-Aldrich 34851 UPLC buffer B
Ammonium chloride Fisher Chemical A661-500 To make M9 medium
Bovine serum albumin (BSA) Sigma-Aldrich B2518 Probe hybridization
Calcium chloride Acros Organics 349610250 To make M9 medium
Casamino acid BD Difco 223050 To make M9 medium
Cy3B NHS ester GE Healthcare Life Sciences PA63101 Fluorophore for FISH probes
Cy5 NHS ester GE Healthcare Life Sciences PA15101 Fluorophore for FISH probes
DEPC Sigma-Aldrich D5758
Dextran sulfate Millipore S4030 Probe hybridization
Dextrose Fisher Chemical D16 To repress the expression of lacZ
Dimethyl sulfoxide (DMSO) Sigma-Aldrich D8418 To dissolve fluorophores
E. coli tRNA Sigma-Aldrich R1753 Probe hybridization
Ethanol Decon Laboratories 2701 Used in DNA purification, lysis, and cleaning coverslips
FISH probes Biosearch Technologies Sequences are published in ref#16
Formaldehyde Ladd Research Industries 20295 Fixation
Formamide American Bio AB00600 Probe hybridization, pre-hybridization, and wash
Glycerol Americanbio AB00751-01000 To make M9 medium
Isopropylthio-β-galactoside (IPTG) Invitrogen 15529019 lacZ induction
Magnesium sulfate Fisher Chemical M65-500 To make M9 medium
2-Nitrophenyl β-D-fucopyranoside (ONPF) Santa Cruz Biotechnology sc-216258 lacZ repression
Picodent twinsil 22 Picodent 1300 1000 Sealant
Poly-L-lysine Sigma-Aldrich P8920 To treat the coverslip surface
Potassium chloride Fisher BioReagents BP366-500 To make PBS
Potassium phosphate monobasic Fisher BioReagents BP362-500 To make PBS and M9 medium
Rifampicin Sigma-Aldrich R3501 To stop transcription initiation
Saline-sodium citrate buffer (SSC) Invitrogen AM9763 Probe hybridization, pre-hybridization, and wash
sodium bicarbonate Fisher BioReagents BP328-500 Fluorophore-probe conjugation
Sodium chloride Fisher BioReagents BP358-1 For DNA purification, PBS and M9 medium
Sodium phosphate dibasic Fisher BioReagents BP332-500 To make PBS and M9 medium
Sodium phosphate monobasic Fisher BioReagents BP329-500 To make a sodium phosphate buffer
Super PAP Pen Invitrogen 8899 Hydrophobic marker for coverslips
TetraSpek microspheres Invitrogen T7280 Controls for multi-channel registration
Thiamine Sigma-Aldrich T1270 To make M9 medium
Triethylammonium acetate Sigma-Aldrich 90358 UPLC buffer A
Vanadyl ribonucleoside complex (VRC) Sigma-Aldrich 94742 Probe hybridization and pre-hybridization
Equipment
C18 column Waters Acquity BEH C18 column
Countertop centrifuge Eppendorf 5425
Countertop incubator Eppendorf Thermomixer F1.5
Incubator (Oven) Thermo Scientific 51030514 Gravity convection
Water purification system Millipore Milli-Q Reference
Nanodrop Thermo Scientific 2000C
Nitrogen gas Building For blow-drying coverslips and glass slides
UPLC Waters Acquity UPLC system
Vacuum and aspirator Building Aspirator is made of a filtration flask with a side arm.
Vacuum concentrator Labconco 7810010 Centrivap; to dry samples collected from UPLC.
Vortexer Scientific Industries Genie-2 SI-0236
Water bath shaker New Brunswick Innova 3100 Critical for time-course experiments
Water bath sonicator VWR 97043-960 To clean coverslips and glass slides
Tools
1.5-mL tubes Eppendorf 22431021 DNA lobind tubes
1000-uL pipette tip box Denville Scientific P1126 An empty box after using all the tips
Coplin jar SPI 01240-AB To clean coverslips and glass slides
Coverslip Fisher Scientific 22-050-230 24x60 No1
Filtered pipette tips Denville Scientific P1121,P1122,P1126 SHARP® Precision Barrier Tips
Forceps SPI K35a To handle clean coverslips and glass slides
Glass slide Fisher Scientific 12-544-1
Gloves Microflex MK-296-M
Multichannel pipetter Eppendorf 2231300045 To use in the washing step (#7)
Pipette Gilson P1000, P200, P20
Reagent reservoir MTC Bio P8025-1S To use in the washing step (#7)
Syringe filter (0.22 um) Millipore SLGS033SS
Timer VWR 62344-641
Software and algorithms
MATLAB Mathworks R2013 and up https://www.mathworks.com
MicrobeTracker or Oufti https://www.github.com/JacobsWagnerLab/MicrobeTracker
https://oufti.org/
Stellaris Probe Designer Biosearch Technologies https://www.biosearchtech.com/support/tools/design-software/stellaris-probe-designer
Microscope
CCD camera Hamamatsu Photonics Orca-II-ER
Cy3 filter set Chroma 49004
Cy5 filter set Chroma 49006
Epi-fluorescence microscope Nikon Eclipse Ti For phase-contrast and epi fluorescence
Fluorescence excitation source Lumencor SOLA-E
Nikon Elements software Nikon software that controls the microscope setup
Phase-contrast 100x objective Nikon Plan Apochromat (NA 1.45)
Probe sequence
DNA oligos with C6 amino modification at the 5' end Biosearch Technologies Inc
lacZ1 GTGAATCCGTAATCATGGTC 5' mRNA
lacZ2 TCACGACGTTGTAAAACGAC 5' mRNA
lacZ3 ATTAAGTTGGGTAACGCCAG 5' mRNA
lacZ4 TATTACGCCAGCTGGCGAAA 5' mRNA
lacZ5 ATTCAGGCTGCGCAACTGTT 5' mRNA
lacZ6 AAACCAGGCAAAGCGCCATT 5' mRNA
lacZ7 AGTATCGGCCTCAGGAAGAT 5' mRNA
lacZ8 AACCGTGCATCTGCCAGTTT 5' mRNA
lacZ9 TAGGTCACGTTGGTGTAGAT 5' mRNA
lacZ10 AATGTGAGCGAGTAACAACC 5' mRNA
lacZ11 GTAGCCAGCTTTCATCAACA 5' mRNA
lacZ12 AATAATTCGCGTCTGGCCTT 5' mRNA
lacZ13 AGATGAAACGCCGAGTTAAC 5' mRNA
lacZ14 AATTCAGACGGCAAACGACT 5' mRNA
lacZ15 TTTCTCCGGCGCGTAAAAAT 5' mRNA
lacZ16 ATCTTCCAGATAACTGCCGT 5' mRNA
lacZ17 AACGAGACGTCACGGAAAAT 5' mRNA
lacZ18 GCTGATTTGTGTAGTCGGTT 5' mRNA
lacZ19 TTAAAGCGAGTGGCAACATG 5' mRNA
lacZ20 AACTGTTACCCGTAGGTAGT 5' mRNA
lacZ21 ATAATTTCACCGCCGAAAGG 5' mRNA
lacZ22 TTTCGACGTTCAGACGTAGT 5' mRNA
lacZ23 ATAGAGATTCGGGATTTCGG 5' mRNA
lacZ24 TTCTGCTTCAATCAGCGTGC 5' mRNA
lacZ25 ACCATTTTCAATCCGCACCT
lacZ26 TTAACGCCTCGAATCAGCAA
lacZ27 ATGCAGAGGATGATGCTCGT
lacZ28 TCTGCTCATCCATGACCTGA
lacZ29 TTCATCAGCAGGATATCCTG
lacZ30 CACGGCGTTAAAGTTGTTCT
lacZ31 TGGTTCGGATAATGCGAACA
lacZ32 TTCATCCACCACATACAGGC
lacZ33 TGCCGTGGGTTTCAATATTG
lacZ34 ATCGGTCAGACGATTCATTG
lacZ35 TGATCACACTCGGGTGATTA
lacZ36 ATACAGCGCGTCGTGATTAG
lacZ37 GATCGACAGATTTGATCCAG
lacZ38 AAATAATATCGGTGGCCGTG
lacZ39 TTTGATGGACCATTTCGGCA
lacZ40 TATTCGCAAAGGATCAGCGG
lacZ41 AAGACTGTTACCCATCGCGT
lacZ42 TGCCAGTATTTAGCGAAACC
lacZ43 AAACGGGGATACTGACGAAA
lacZ44 TAATCAGCGACTGATCCACC
lacZ45 GGGTTGCCGTTTTCATCATA
lacZ46 TCGGCGTATCGCCAAAATCA
lacZ47 TTCATACAGAACTGGCGATC
lacZ48 TGGTGTTTTGCTTCCGTCAG
lacZ49 ACGGAACTGGAAAAACTGCT 3' mRNA
lacZ50 TATTCGCTGGTCACTTCGAT 3' mRNA
lacZ51 GTTATCGCTATGACGGAACA 3' mRNA
lacZ52 TTTACCTTGTGGAGCGACAT 3' mRNA
lacZ53 GTTCAGGCAGTTCAATCAAC 3' mRNA
lacZ54 TTGCACTACGCGTACTGTGA 3' mRNA
lacZ55 AGCGTCACACTGAGGTTTTC 3' mRNA
lacZ56 ATTTCGCTGGTGGTCAGATG 3' mRNA
lacZ57 ACCCAGCTCGATGCAAAAAT 3' mRNA
lacZ58 CGGTTAAATTGCCAACGCTT 3' mRNA
lacZ59 CTGTGAAAGAAAGCCTGACT 3' mRNA
lacZ60 GGCGTCAGCAGTTGTTTTTT 3' mRNA
lacZ61 TACGCCAATGTCGTTATCCA 3' mRNA
lacZ62 TAAGGTTTTCCCCTGATGCT 3' mRNA
lacZ63 ATCAATCCGGTAGGTTTTCC 3' mRNA
lacZ64 GTAATCGCCATTTGACCACT 3' mRNA
lacZ65 AGTTTTCTTGCGGCCCTAAT 3' mRNA
lacZ66 ATGTCTGACAATGGCAGATC 3' mRNA
lacZ67 ATAATTCAATTCGCGCGTCC 3' mRNA
lacZ68 TGATGTTGAACTGGAAGTCG 3' mRNA
lacZ69 TCAGTTGCTGTTGACTGTAG 3' mRNA
lacZ70 ATTCAGCCATGTGCCTTCTT 3' mRNA
lacZ71 AATCCCCATATGGAAACCGT 3' mRNA
lacZ72 AGACCAACTGGTAATGGTAG 3' mRNA

DOWNLOAD MATERIALS LIST

References

  1. Bervoets, I., Charlier, D. Diversity, versatility and complexity of bacterial gene regulation mechanisms: opportunities and drawbacks for applications in synthetic biology. FEMS Microbiology Reviews. 43, (3), 304-339 (2019).
  2. Epshtein, V., Nudler, E. Cooperation between RNA polymerase molecules in transcription elongation. Science. 300, (5620), 801-805 (2003).
  3. Vogel, U., Jensen, K. F. The RNA chain elongation rate in Escherichia coli depends on the growth rate. Journal of Bacteriology. 176, (10), 2807-2813 (1994).
  4. Tennyson, C. N., Klamut, H. J., Worton, R. G. The human dystrophin gene requires 16 hours to be transcribed and is cotranscriptionally spliced. Nature Genetics. 9, 184 (1995).
  5. Singh, J., Padgett, R. A. Rates of in situ transcription and splicing in large human genes. Nature Structural & Molecular Biology. 16, 1128 (2009).
  6. Selinger, D. W., Saxena, R. M., Cheung, K. J., Church, G. M., Rosenow, C. Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. Genome Research. 13, (2), 216-223 (2003).
  7. Bernstein, J. A., Khodursky, A. B., Lin, P. -H., Lin-Chao, S., Cohen, S. N. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proceedings of the National Academy of Sciences. 99, (15), 9697-9702 (2002).
  8. Pérez-Ortín, J. E., Medina, D. A., Chávez, S., Moreno, J. What do you mean by transcription rate. BioEssays. 35, (12), 1056-1062 (2013).
  9. Tang, F., et al. mRNA-Seq whole-transcriptome analysis of a single cell. Nature Methods. 6, (5), 377-382 (2009).
  10. Kuchina, A., et al. Microbial single-cell RNA sequencing by split-pool barcoding. BioRxiv. 869248 (2019).
  11. Blattman, S. B., Jiang, W., Oikonomou, P., Tavazoie, S. Prokaryotic single-cell RNA sequencing by in situ combinatorial indexing. Nature Microbiology. (2020).
  12. Femino, A., Fay, F., Fogarty, K., Singer, R. Visualization of single RNA transcripts in situ. Science. 280, (5363), 585-590 (1998).
  13. Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. Imaging individual mRNA molecules using multiple singly labeled probes. Nature Methods. 5, (10), 877-879 (2008).
  14. Montero Llopis, P., et al. Spatial organization of the flow of genetic information in bacteria. Nature. 466, (7302), 77-81 (2010).
  15. So, L. -h, et al. General properties of transcriptional time series in Escherichia coli. Nature Genetics. 43, (6), 554-560 (2011).
  16. Taniguchi, Y., et al. Quantifying E. coli proteome and transcriptome with single-molecule sensitivity in single cells. Science. 329, (5991), 533-538 (2010).
  17. Jones, D. L., Brewster, R. C., Phillips, R. Promoter architecture dictates cell-to-cell variability in gene expression. Science. 346, (6216), 1533-1536 (2014).
  18. Iyer, S., Park, B. R., Kim, M. Absolute quantitative measurement of transcriptional kinetic parameters in vivo. Nucleic Acids Research. 44, (18), 142 (2016).
  19. Kim, S., Beltran, B., Irnov, I., Jacobs-Wagner, C. Long-Distance Cooperative and Antagonistic RNA Polymerase Dynamics via DNA Supercoiling. Cell. 179, (1), 106-119 (2019).
  20. Wang, M., Zhang, J., Xu, H., Golding, I. Measuring transcription at a single gene copy reveals hidden drivers of bacterial individuality. Nature Microbiology. 4, (12), 2118-2127 (2019).
  21. Joo, C., Ha, T. Labeling DNA (or RNA) for single-molecule FRET. 2012, (9), Cold Spring Harbor. 1005-1008 (2012).
  22. Sambrook, J., Russell, D. W. Standard Ethanol Precipitation of DNA in Microcentrifuge Tubes. 2006, (1), Cold Spring Harbor Protocols. 4456 (2006).
  23. Skinner, S. O., Sepúlveda, L. A., Xu, H., Golding, I. Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization. Nature Protocols. 8, (6), 1100-1113 (2013).
  24. Adesnik, M., Levinthal, C. The synthesis and degradation of lactose operon messenger RNA in E. coli. Cold Spring Harbor Symposia on Quantitative Biology. 35, 451-459 (1970).
  25. Campbell, E. A., et al. Structural mechanism for rifampicin inhibition of bacterial RNA polymerase. Cell. 104, (6), 901-912 (2001).
  26. Raj, A., Tyagi, S. Methods in Enzymology. Walter, N. G. 472, Academic Press. 365-386 (2010).
  27. Sliusarenko, O., Heinritz, J., Emonet, T., Jacobs-Wagner, C. High-throughput, subpixel precision analysis of bacterial morphogenesis and intracellular spatio-temporal dynamics. Molecular Microbiology. 80, (3), 612-627 (2011).
  28. Paintdakhi, A., et al. Oufti: an integrated software package for high-accuracy, high-throughput quantitative microscopy analysis. Molecular Microbiology. 99, (4), 767-777 (2016).
  29. Moffitt, J. R., Zhuang, X. Methods in Enzymology. Filonov, G. S., Jaffrey, S. R. 572, Academic Press. 1-49 (2016).
  30. Yu, J., Xiao, J., Ren, X., Lao, K., Xie, X. S. Probing gene expression in live cells, one protein molecule at a time. Science. 311, (5767), 1600-1603 (2006).
  31. Chen, H., Shiroguchi, K., Ge, H., Xie, X. S. Genome-wide study of mRNA degradation and transcript elongation in Escherichia coli. Molecular Systems Biology. 11, (1), 781 (2015).
  32. Vogel, U., Sørensen, M., Pedersen, S., Jensen, K. F., Kilstrup, M. Decreasing transcription elongation rate in Escherichia Coli exposed to amino acid starvation. Molecular Microbiology. 6, (15), 2191-2200 (1992).
  33. Yang, S., et al. Transcription and translation contribute to gene locus relocation to the nucleoid periphery in E. coli. Nature Communications. 10, (1), 5131 (2019).
  34. Zenklusen, D., Larson, D. R., Singer, R. H. Single-RNA counting reveals alternative modes of gene expression in yeast. Nature Structural & Molecular Biology. 15, (12), 1263-1271 (2008).
  35. Fontenete, S., Guimarães, N., Wengel, J., Azevedo, N. F. Prediction of melting temperatures in fluorescence in situ hybridization (FISH) procedures using thermodynamic models. Critical Reviews in Biotechnology. 36, (3), 566-577 (2016).
  36. Sepúlveda, L. A., Xu, H., Zhang, J., Wang, M., Golding, I. Measurement of gene regulation in individual cells reveals rapid switching between promoter states. Science. 351, (6278), 1218-1222 (2016).
  37. Huang, B., Wang, W., Bates, M., Zhuang, X. Three-Dimensional Super-Resolution Imaging by Stochastic Optical Reconstruction Microscopy. Science. 319, (5864), 810-813 (2008).
  38. Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. Spatial organization shapes the turnover of a bacterial transcriptome. eLife. 5, 13065 (2016).
  39. Fei, J., et al. Determination of in vivo target search kinetics of regulatory noncoding RNA. Science. 347, (6228), 1371-1374 (2015).
Sondeo de mRNA cinética en el espacio y el tiempo en <em>Escherichia coli</em> usando hibridación de fluorescencia de una sola molécula de dos colores
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, S., Vaidya, K. Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization. J. Vis. Exp. (161), e61520, doi:10.3791/61520 (2020).More

Kim, S., Vaidya, K. Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization. J. Vis. Exp. (161), e61520, doi:10.3791/61520 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter