Method Article

Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function

7.4K views

DOI:

10.3791/62074

July 29th, 2021

In This Article

Summary

Here, we describe the preparation of human organoid-derived intestinal epithelial monolayers for studying intestinal barrier function, permeability, and transport. As organoids represent original epithelial tissue response to external stimuli, these models combine the advantages of expandability of cell lines and the relevance and complexity of primary tissue.

Abstract

In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations as the former do not faithfully represent original tissue physiology, and the availability of the latter is limited. Hence, their application hampers fundamental and drug development research. Adult stem-cell-based organoids (henceforth referred to as organoids) are miniatures of normal or diseased epithelial tissue from which they are derived. They can be established very efficiently from different gastrointestinal (GI) tract regions, have long-term expandability, and simulate tissue- and patient-specific responses to treatments in vitro. Here, the establishment of intestinal organoid-derived epithelial monolayers has been demonstrated along with methods to measure epithelial barrier integrity, permeability and transport, antimicrobial protein secretion, as well as histology. Moreover, intestinal organoid-derived monolayers can be enriched with proliferating stem and transit-amplifying cells as well as with key differentiated epithelial cells. Therefore, they represent a model system that can be tailored to study the effects of compounds on target cells and their mode of action. Although organoid cultures are technically more demanding than cell lines, once established, they can reduce failures in the later stages of drug development as they truly represent in vivo epithelium complexity and interpatient heterogeneity.

Introduction

The intestinal epithelium acts as a physical barrier between the luminal content of the intestines and the underlying tissue. This barrier comprises a single epithelial layer of mainly absorptive enterocytes that are connected by tight junctions, which establish strong intercellular connections between adjacent cells. These cells form a polarized epithelial lining that separates the apical (lumen) and basolateral sides of the intestine, while simultaneously regulating paracellular transport of digested nutrients and metabolites. In addition to enterocytes, other important epithelial cells such as goblet, Paneth, and enteroendocrine cells also contribute to intestinal ....

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Preparing reagents for culture

NOTE: Perform all steps inside a biosafety cabinet and follow standard guidelines for working with cell cultures. Ultraviolet light is used for 10 min before starting up the biosafety cabinet. Before and after use, the surface of the biosafety cabinet is cleaned with a tissue paper drenched in 70% ethanol. To facilitate the formation of three-dimensional drops of extracellular matrix (ECM), keep a prewarmed stock of 96-, 24-, and 6-well plates ready in the incubator at 37 °C.

  1. Basal medium preparation
    1. Prepare basal medium (BM) in a 500 mL Advanced Dulbecco's Modified Eagle Me....

Access restricted. Please log in or start a trial to view this content.

Results

Figure 1A shows a representative brightfield image of intestinal organoids after thawing them from a cryovial. It is important to thaw organoids at a high density to ensure optimal recovery. Organoids are plated in 24- or 6-well plates in ECM domes of approximately 10 µL (Figure 1B). Most normal intestinal organoids have a cystic morphology. After recovering from the thawing process, the organoids grow to a bigger size and are ready to be passaged after 3-7.......

Access restricted. Please log in or start a trial to view this content.

Discussion

This protocol describes the general manipulation and maintenance of intestinal organoids as well as the preparation and possible applications of epithelial monolayers derived from these organoids. To date, monolayers have been successfully prepared from the duodenum, ileum, and different regions of colon organoids derived from normal as well as previously and actively inflamed intestinal tissue (unpublished data). The application of patient-derived organoid monolayers facilitates the study of barrier function in a diseas.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare no conflict of interest.

Acknowledgements

This work is supported by the Topsector Life Sciences & Health - Topconsortium voor Kennis en Innovatie Health~Holland (LSH-TKI) public-private partnerships (PPP) allowance of the Dutch LSH sector with Project number LSHM16021 Organoids as novel tool for toxicology modelling to Hubrecht Organoid Technology (HUB) and HUB internal funding to Disease Modeling and Toxicology department. We thank the laboratories of Sabine Middendorp (Division of Pediatric Gastroenterology, Wilhelmina Children's Hospital, UMC, Utrecht) and Hugo R. de Jonge and Marcel J.C. Bijvelds (Department of Gastroenterology and Hepatology, Erasmus MC, Rotterdam) for providing initial ....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
100% ethanolFisher Emergo10644795
1250, 300, and 20 µL low-retention filter-tipsGreiner bio-one732-1432 / 732-1434 / 732-2383
15 mL conical tubesGreiner bio-one188271
24-well cell culture platesGreiner bio-one662160
24-well HTS Fluoroblok Transwell plate (light-tight)Corning351156
24-well HTS Transwell plates (Table 1)Corning3378
24-well plate with Transwell insertsCorning3470
40 µm cell strainerPluriSelect43-50040-01
50 mL conical tubesGreiner bio-one227261
6-well cell culture platesGreiner bio-one657160
96-well black plate transparent bottomGreiner bio-one655090
96-well fast thermal cycling platesLife Technologies Europe BV4346907
96-well HTS Fluoroblok Transwell plateCorning351162
96-well HTS Transwell plates (Table 1)Corning7369
96-well transparent culture plateGreiner bio-one655180
A83-01Bio-Techne Ltd2939
Accutase Cell Dissociation ReagentLife Technologies Europe BVA11105-01Cell dissociation reagent 2
Advanced DMEM/F-12Life Technologies Europe BV12634028
B27 supplementLife Technologies Europe BV17504001
Cell culture microscope (light / optical microscope)Leica
CellTiter-GloPromegaG9683
CentrifugeEppendorf
CO2 incubatorPHCBI
DAPTSigma-AldrichD5942
DEPC treated H2OLife Technologies Europe BV750024
Dulbecco's phosphate-buffered saline (DPBS) with Ca2+ and Mg2+Life Technologies Europe BV14040091
DPBS, powder, no calcium, no magnesiumLife Technologies Europe BV21600069
EnzChek Lysozyme Assay KitLife Technologies Europe BVE22013
EVOM2 meter with STX electrodeWTI
GastrinBio-Techne Ltd3006
Glass pipettesVolac
GlutaMAXLife Technologies Europe BV35050038
hEGFPeprotechAF-100-15
HEPESLife Technologies Europe BV15630056
Human NogginPeprotech120-10C
Human Rspo3Bio-Techne Ltd3500-RS/CF
IWP-2Miltenyi Biotec130-105-335
Ki67 primary antibodySanbioBSH-7302-100
Ki67 secondary antibodyAgilentK400111-2
Kova International Glasstic Slide with Counting gridsFisher Emergo10298483
Laminar flow hoodThermo scientific
Lucifer Yellow CH dilithium saltSigma-AldrichL0259
Matrigel, Growth Factor Reduced (GFR)Corning356231extracellular matrix (ECM)
MicroAmp Fast 8-Tube Strip, 0.1 mLLife Technologies Europe BV4358293
MicroAmp Optical 8-Cap StripsLife Technologies Europe BV4323032
Microcentrifuge tubesEppendorf0030 120 086
Micropipettes (1000, 200, and 20 µL)Gilson
MicrotomeLeica
MUC2 primary antibodySanta Cruz Biotechnologysc-15334
MUC2 secondary antibodyVWRVWRKS/DPVR-HRP
Multichannel pipette (200 µL)Gilson
N-acetylcysteineSigma-AldrichA9165
NGS WntU-Protein ExpressN001-0.5mg
NicotinamideSigma-AldrichN0636
Oligonucleotide ALPI1/ForwardCustom-madeGGAGTTATCCTGCTCCCCAC
Oligonucleotide ALPI1/ReverseCustom-madeCTAGGAGGTGAAGGTCCAACG
Oligonucleotide LGR5/ForwardCustom-madeACACGTACCCACAGAAGCTC
Oligonucleotide LGR5/ReverseCustom-madeGGAATGCAGGCCACTGAAAC
Oligonucleotide MUC2/ForwardCustom-madeAGGATCTGAAGAAGTGTGTCACTG
Oligonucleotide MUC2/ReverseCustom-madeTAATGGAACAGATGTTGAAGTGCT
Oligonucleotide TBP/ForwardCustom-madeACGCCGAATATAATCCCAAGCG
Oligonucleotide TBP/ReverseCustom-madeAAATCAGTGCCGTGGTTCGTG
Optical adhesive coversLife Technologies Europe BV4311971
PD0325901Stemcell Technologies72184
Penicillin/streptomycinLife Technologies Europe BV15140122
Plate shakerPanasonic
PowerUp SYBR Green Master MixFisher EmergoA25776
PrimocinInvivoGenANT-PM-2antimicrobial formulation for primary cells
Qubit RNA HS Assay KitLife Technologies Europe BVQ32852
Reagent reservoir for multichannel pipetSigma-AldrichCLS4870
REMS AutoSampler with 24-probe or 96C-probeWTI
Richard-Allan Scientific Alcian Blue/PAS Special Stain KitThermo scientific87023
RNase-Free DNase SetQiagen79254
RNeasy Mini KitQiagen74106
SB202190Sigma-AldrichS7076
Serological pipettesGreiner bio-one606180 / 607180 / 760180
Serological pipettor (Pipet-Aid)Drummond
Single edge razor bladeGEM Scientific
Superscript 1st strand system for RT-PCRLife Technologies Europe BV11904018
Tecan Spark 10M plate readerTecan
Trypan Blue Solution, 0.4%Life Technologies Europe BV15250-061
TrypLE Express Enzyme (1x)Life Technologies Europe BV12605-010Cell dissociation reagent 1
Water bathGrant
Y27632 (ROCK inhibitor)AbMoleM1817

References

  1. Haegebarth, A., Clevers, H. Wnt signaling, lgr5, and stem cells in the intestine and skin. The American Journal of Pathology. 174 (3), 715-721 (2009).
  2. Schoultz, I., Keita, ÅV. The intestinal barrier and current techniques for the assessment of gut permea....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Organoid Derived MonolayerEpithelial Barrier IntegrityTransepithelial Electrical ResistanceOrganoid CultureEpithelial PermeabilityStem Cell OrganoidsAntimicrobial Protein SecretionCell Differentiation MarkersTranswell Membrane

Related Articles