Here, we describe the preparation of human organoid-derived intestinal epithelial monolayers for studying intestinal barrier function, permeability, and transport. As organoids represent original epithelial tissue response to external stimuli, these models combine the advantages of expandability of cell lines and the relevance and complexity of primary tissue.
In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations as the former do not faithfully represent original tissue physiology, and the availability of the latter is limited. Hence, their application hampers fundamental and drug development research. Adult stem-cell-based organoids (henceforth referred to as organoids) are miniatures of normal or diseased epithelial tissue from which they are derived. They can be established very efficiently from different gastrointestinal (GI) tract regions, have long-term expandability, and simulate tissue- and patient-specific responses to treatments in vitro. Here, the establishment of intestinal organoid-derived epithelial monolayers has been demonstrated along with methods to measure epithelial barrier integrity, permeability and transport, antimicrobial protein secretion, as well as histology. Moreover, intestinal organoid-derived monolayers can be enriched with proliferating stem and transit-amplifying cells as well as with key differentiated epithelial cells. Therefore, they represent a model system that can be tailored to study the effects of compounds on target cells and their mode of action. Although organoid cultures are technically more demanding than cell lines, once established, they can reduce failures in the later stages of drug development as they truly represent in vivo epithelium complexity and interpatient heterogeneity.
The intestinal epithelium acts as a physical barrier between the luminal content of the intestines and the underlying tissue. This barrier comprises a single epithelial layer of mainly absorptive enterocytes that are connected by tight junctions, which establish strong intercellular connections between adjacent cells. These cells form a polarized epithelial lining that separates the apical (lumen) and basolateral sides of the intestine, while simultaneously regulating paracellular transport of digested nutrients and metabolites. In addition to enterocytes, other important epithelial cells such as goblet, Paneth, and enteroendocrine cells also contribute to intestinal homeostasis by producing mucus, antimicrobial peptides, and hormones, respectively. The intestinal epithelium is constantly replenished by dividing leucine-rich repeat-containing G-protein-coupled receptor 5-positive (LGR5+) stem cells in the bottom of intestinal crypts producing transit-amplifying (TA) cells that migrate upwards and differentiate into other cell types1. Disruption of intestinal epithelial homeostasis by genetic and environmental factors, such as exposure to food allergens, medicinal compounds, and microbial pathogens, leads to disruption of intestinal barrier function. These conditions cause several intestinal diseases including inflammatory bowel disease (IBD), celiac disease, and drug-induced GI toxicity2.
Studies on the intestinal epithelium are performed using several in vitro platform systems such as membrane inserts, organs-on-a-chip systems, Ussing chambers, and intestinal rings.These platforms are suitable for establishing polarized epithelial monolayers with access to both apical and basolateral sides of the membrane, using transformed cell lines or primary tissue as models. Although transformed cell lines, such as the colorectal (adeno)carcinoma cell lines Caco-2, T84, and HT-29, are able to differentiate into polarized intestinal enterocytes or mucus-producing cells to some extent, they are not representative of the in vivo epithelium as several cell types are missing, and various receptors and transporters are aberrantly expressed3. In addition, as cell lines are derived from a single donor, they do not represent interpatient heterogeneity and suffer from reduced complexity and physiological relevance. Although primary tissues used in Ussing chambers and as intestinal rings are more representative of the in vivo situation, their limited availability, short-term viability, and lack of expandability make them unsuitable as a medium for high-throughput (HT) studies.
Organoids are in vitro epithelial cultures established from different organs such as the intestine, kidney, liver, pancreas, and lung. They are proven to have long-term, stable expandability as well as genetic and phenotypic stability and therefore are representative biological miniatures of the epithelium of the original organ with faithful responses to external stimuli4,5,6,7,8,9. Organoids are efficiently established from either resected or biopsied normal, diseased, inflamed, or cancerous tissue, representing heterogeneous patient-specific responses10,11,12,13,14,15,16. This paper demonstrates how to establish intestinal epithelial monolayers derived from organoid cultures. Monolayers have been successfully established from small intestinal as well as colonic and rectal organoid cultures. This model creates an opportunity to study the transport and permeability of the epithelial cells to drugs as well as their toxicological effects on the epithelium. Moreover, the model allows co-culture with immune cells and bacteria to study their interactions with the intestinal epithelium17,18,19. Furthermore, this model can be used to study responses to therapies in a patient-specific manner and initiate screening efforts to look for the next wave of epithelial barrier-focused therapeutics. Such an approach could be extended to the clinic and pave the way toward personalized treatments.
Although the epithelial monolayers in this protocol are prepared from human normal intestinal organoids, the protocol can be applied and optimized for other organoid models. Epithelial organoid monolayers are cultured in intestinal organoid expansion medium containing Wnt to support stem cell proliferation and represent intestinal crypt cellular composition. Intestinal organoids can be enriched to have different intestinal epithelial fates, such as enterocytes, Paneth, goblet, and enteroendocrine cells, by modulating Wnt, Notch, and epidermal growth factor (EGF) pathways. Here, after the establishment of monolayers in expansion medium, they are driven toward more differentiated intestinal epithelial cells, as described previously20,21,22,23,24,25. For screening purposes, depending on the mode of action of the compound of interest, its target cells, and the experimental conditions, the monolayers can be driven toward the cellular composition of choice to measure the effects of the compound with relevant functional readouts.
1. Preparing reagents for culture
NOTE: Perform all steps inside a biosafety cabinet and follow standard guidelines for working with cell cultures. Ultraviolet light is used for 10 min before starting up the biosafety cabinet. Before and after use, the surface of the biosafety cabinet is cleaned with a tissue paper drenched in 70% ethanol. To facilitate the formation of three-dimensional drops of extracellular matrix (ECM), keep a prewarmed stock of 96-, 24-, and 6-well plates ready in the incubator at 37 °C.
2. Organoid cultures
3. Epithelial monolayer preparation
4. Epithelial monolayer assay readouts
5. Upscaling to 96-well plates containing membrane inserts
NOTE: Prepare epithelial monolayers for higher throughput drug screenings or multiple medium conditions using HTS 96-well plates containing membrane inserts.
Figure 1A shows a representative brightfield image of intestinal organoids after thawing them from a cryovial. It is important to thaw organoids at a high density to ensure optimal recovery. Organoids are plated in 24- or 6-well plates in ECM domes of approximately 10 µL (Figure 1B). Most normal intestinal organoids have a cystic morphology. After recovering from the thawing process, the organoids grow to a bigger size and are ready to be passaged after 3-7 days depending on the organoid culture (Figure 1C). After harvesting the organoids and washing the ECM away (Figure 1D), organoids can be disrupted to a small size by mechanical shearing. Depending on the morphology of the organoids (cystic Figure 1C, budding Figure 1E), organoids can be disrupted using plastic or glass pipettes (Figure 1F). Organoids are disrupted in a suspension (Figure 2A), which should be regularly monitored under the microscope. It is important to avoid making them too small, as groups of cells need to stay together to ensure organoid growth. Figure 2B shows the organoids in ECM drops just after passaging. In general, cystic organoids are plated at a relatively high density while budding organoids are plated in a low density; however, this can differ between different organoid cultures.
When passaging organoids for the preparation of monolayers, be sure to plate them at a high density, and let them grow for three days so they are in optimal expansion conditions. Organoids can be harvested for monolayer preparation when they are comparable with Figure 3A in size and density, where 6 wells of a 6-well plate, each containing 200 µL of organoid domes, are typically enough for seeding a full 24-well plate of membrane inserts. After the preparation of a single-cell suspension with the cell dissociation reagent, single cells and small clumps of cells should be visible (Figure 3B), and live cells can be counted (Figure 3C). The arrows indicate dead cells stained with trypan blue, which should be excluded from counting. The single cells and small clumps are then seeded in the membrane inserts as seen in Figure 4A. Monolayer formation is visible after 1-3 days (Figure 4B,C), and the monolayers will be generally be confluent after 3-6 days depending on the organoid culture (Figure 4D). Monolayers stay in expansion medium until they are confluent, after which they can be enriched with, amongst others, enterocytes or goblet cells using different enrichment media. Figure 5A shows a monolayer that was cultured for 8 days in expansion medium (IEM). When enriched with enterocytes (eDM), a structure is seen, as in Figure 5B, while monolayers exposed to combination medium (cDM) show a smoother structure (Figure 5C).
Monolayer formation can be quantitatively followed by measuring TEER (Figure 6A). A completely confluent monolayer has a TEER value of ~100 Ω·cm2, which increases to ~1000 Ω·cm2 when exposed to either differentiation medium (Figure 6B). Monolayers in all medium conditions show a low apparent permeability (Papp) to Lucifer Yellow (0.45 kDa). Lysozyme secretion by ileal monolayers cultured in IEM was higher than that of monolayers cultured in IEM until confluent and for another 4 days in eDM or cDM (denoted as + subsequent eDM or cDM) (Figure 6D). Monolayers cultured in IEM, IEM + subsequent eDM or IEM + subsequent cDM show different morphology, as can be observed with H&E staining (Figure 6E). While colon organoid-derived epithelial monolayers in IEM and cDM media have a smooth apical surface, enterocyte-differentiated monolayers present an invaginated apical morphology in the absence of Wnt. Ki67-positive proliferative cells can be detected in expansion conditions only. Alcian Blue and MUC2 stain mucus produced by goblet cells, which is visualized in the monolayers differentiated in eDM and more prominently in cDM when Wnt, Notch, and EGF signaling are inhibited, respectively (Figure 6E). Upon differentiation, proliferative cells decrease while goblet cell and enterocyte marker gene expression increases in comparison to that observed under IEM conditions, as shown by LGR5, MUC2, and ALPI gene expression quantification by qRT-PCR, respectively (Figure 6F).
Figure 1: Establishing an intestinal organoid culture from frozen organoids. (A) Representative brightfield image of an intestinal organoid culture after thawing. (B) ECM domes (50 µL) seeded in each well of a 24-well culture plate. (C) Representative image of a normal intestinal organoid culture ready for passaging. (D) Representative image on how to check the presence of ECM in a 15-mL tube containing organoids under a light microscope. (E) Representative image of a budding intestinal organoid culture ready for passaging. (F) A 10 µL plastic pipette tip fitted on a low-retention 1250 µL filter tip (left) and a narrowed glass pipette (right) for mechanical shearing of organoids. Scale bars = 100 µm. Abbreviation: ECM = extracellular matrix. Please click here to view a larger version of this figure.
Figure 2: Processing intestinal organoids for maintenance or preparation of monolayers. (A) Representative image of intestinal organoids after mechanical disruption. (B) Representative image of an intestinal organoid culture seeded after passaging. Scale bars = 100 µm. Please click here to view a larger version of this figure.
Figure 3: Preparing single cells from intestinal organoids for monolayer preparation. (A) Intestinal organoids ready to harvest for monolayer preparation. (B) Single cells and small clumps of cells after single cell preparation. (C) Visible single cells and small clumps during counting in a grid chamber. Scale bars = 100 µm. Please click here to view a larger version of this figure.
Figure 4: Monolayer formation after seeding single cells on membranes. (A) Single cells just after seeding on membranes. On average, (B) the monolayer is around 50% confluent 1-3 days after seeding, (C) ~90% confluent at day 3-5, and (D) the complete monolayer has formed around day 4-7. Scale bars = 100 µm. Please click here to view a larger version of this figure.
Figure 5: Enrichment of specific cell types in the monolayer. (A) Monolayer after 8 days in IEM. (B) Monolayer enriched with enterocytes after 4 days in IEM and another 4 days in eDM. (C) Monolayer enriched with goblet cells and other cell types after 4 days in IEM and another 4 days in cDM. Scale bars = 100 µm. Abbreviations: IEM = intestinal organoid expansion medium; eDM = enterocyte differentiation medium; cDM = combination differentiation medium. Please click here to view a larger version of this figure.
Figure 6: A variety of possible readouts using epithelial organoid monolayers. (A) Electrode in the membrane insert to measure TEER. (B) TEER values increase in time with a value of ~100 Ω·cm2 when the monolayer reaches confluence. After enriching monolayers with enterocytes or a combination of different epithelial cells, TEER increases to 1000 Ω·cm2 or higher. (C) Monolayers in all medium conditions (IEM + 4 days IEM/eDM/cDM) are impermeable to Lucifer Yellow. (D) Expression of lysozyme is higher in ileum monolayers when grown in expansion medium than in either type of differentiation medium (IEM + 4 days IEM/eDM/cDM). (E) Colon monolayers show different morphologies when exposed to different medium conditions (IEM + 4 days IEM/eDM/cDM) as visualized by H&E, Ki67, Alcian Blue, and MUC2 stains. As expected, monolayers cultured in expansion medium are very proliferative, as shown by Ki67 staining. Monolayers differentiated with eDM show a columnar epithelium without proliferative cells. Monolayers exposed to cDM are also not proliferative and develop more goblet cells. Scale bar = 100 µm. (F) Stem cell (LGR5), goblet cell (MUC2), and enterocyte (ALPI) marker gene expression in colon monolayers by qRT-PCR. Abbreviations: TEER = transepithelial electrical resistance; IEM = intestinal organoid expansion medium; eDM = enterocyte differentiation medium; cDM = combination differentiation medium; Papp = apparent permeability coefficient; LGR5 = leucine-rich repeat-containing G-protein-coupled receptor 5; H&E = hematoxylin and eosin; AB = Alcian Blue; MUC2 = mucin-2; ALPI = intestinal alkaline phosphatase; qRT-PCR = quantitative reverse-transcription polymerase chain reaction. Please click here to view a larger version of this figure.
Membrane inserts | ||
24-well plates | 96-well plates | |
Membrane surface (cm2) | 0.33 | 0.143 |
Apical volume (µL) | 150 | 100 |
Basolateral volume (µL) | 800 | 300 |
# Cells to seed per well | 450,000 | 200,000 |
HTS plates with membrane inserts | PET | PET |
Plates with separate inserts | PET | NA |
Light-tight plates with membrane inserts | ||
Electrodes are different for the two formats | Refer to the Table of Materials |
Table 1
This protocol describes the general manipulation and maintenance of intestinal organoids as well as the preparation and possible applications of epithelial monolayers derived from these organoids. To date, monolayers have been successfully prepared from the duodenum, ileum, and different regions of colon organoids derived from normal as well as previously and actively inflamed intestinal tissue (unpublished data). The application of patient-derived organoid monolayers facilitates the study of barrier function in a disease- and patient-specific manner as well as the study of patient-specific responses to a variety of drug treatments. Although cell lines can form differentiated and polarized monolayers containing intestinal enterocytes and goblet-like cells, many different enzymes and transporters are aberrantly expressed in these cell lines, resulting in reduced complexity and physiological relevance3,30. Organoid culture is technically more demanding and laborious than cell culture; however, organoids are more representative of the in vivo situation, whereas cell lines have repeatedly failed to represent tissue responses in complex setups.
Although primary tissue-based models can be representative of the in vivo situation, they require the use of test animals or access to human material, which is associated with limited availability and ethical constraints. Additionally, primary tissue has no or limited expandability and is not stable in extended experimental timeframes. Organoid technology requires limited amount of primary tissue to establish genetically and physiologically stable long-term expanding cultures while still representing epithelial tissue complexity and patient heterogeneity. Different cell lines, such as Caco-2, are often used to prepare epithelial monolayers. Caco-2 cells take 21 days to establish a polarized epithelial monolayer that can be used for any experiment30. Organoid-derived epithelial monolayers are prepared from organoid single cells as described in the current protocol, and after 3-6 days, form a polarized epithelium that can be further differentiated to enrich them with enterocytes or goblet cells.
Monolayers are a static model lacking a microfluidic flow or mechanic stretch as is seen in organs-on-a-chip. They do, however, offer the opportunity for co-culturing with (autologous) immune cells, as well as bacteria or parasites17,18,19, 31. Organoids are suitable for monolayer preparation when they are in their expansion phase; for intestinal organoids, this is usually 3 days after passaging. Dissociation of organoids to single cells should be performed quickly to avoid long-term exposure to digestive enzymes. To increase the survival of stem cells after the preparation of a single-cell suspension, the Rho-associated protein kinase inhibitor (ROCK inhibitor), Y27632, is added to the cells to prevent anoikis-induced cell death32. Furthermore, it is critical to culture the monolayers on a membrane precoated with ECM to ensure that they maintain their organoid characteristics and polarization. For functional screening assays that quantify GI tract epithelial cell responses to external stimuli, it is important that organoid cultures represent the required cellular complexity depending on the type of assay to be developed and eventual readouts.
Intestinal organoids represent different epithelial cell types present in vivo, such as stem, TA, enterocyte, Paneth, goblet, and enteroendocrine cells4,5, and are prepared and maintained using a defined organoid medium prepared as described in this protocol. Enterocyte differentiation can be promoted by culturing organoids for an additional four days using culture conditions that dually inhibit the Wnt pathway, by removal of Wnt molecules/activators, and the addition of the Porcupine inhibitor, IWP-2 (enterocyte colon differentiation medium, eDM). As mucus-producing goblet cells are essential for barrier function homeostasis as well, a second culture condition aims to produce a more heterogeneous cell population containing stem, enterocyte, and goblet cells, in which Notch and EGF pathways are inhibited while Wnt signaling is kept partially active by reducing Wnt3aCM to 10% (or 0.1 nM for NGS-Wnt) instead of 50% (0.5 nM NGS-Wnt) used in IEM. In contrast to eDM, which enriches for enterocyte differentiation, this second condition supports the presence of several cell types and is therefore called combination differentiation medium (cDM).
Applications of organoid-derived monolayers include the monitoring of epithelial barrier integrity as well as examining tight junction and transporter expression. Barrier integrity, permeability, and transport can be analyzed using the readouts introduced in this protocol. While TEER measures ionic conductance through tight junctions, the permeability assay measures water flow and thus paracellular permeability through the tight junctions28,29. Epithelial barrier integrity, permeability, and transport functionality of the monolayers can be evaluated by measuring the traffic of different fluorescent or radioactive substrates across apical and basolateral compartments of the membrane inserts. TEER measurements allow for the quantification of barrier integrity, showing an increase in values when differentiating towards polarized enterocytes and goblet cells, and a decrease after inducing injury to the monolayers.
The Lucifer Yellow permeability assay can be used for initial barrier integrity assessment as well as the confirmation of reduced integrity after inducing injury to the monolayers. This protocol introduces Lucifer Yellow permeability from the apical to basolateral compartment as an indication of monolayer integrity. Similarly, other fluorescently labeled reagents, such as 4 or 40 kDa dextran, can be employed to evaluate increased paracellular permeability as the result of barrier damage-inducing agents. Fluorescently labeled substrates, such as Rhodamine 123, can be used for measuring the activity of different transporters, such as P-glycoprotein-1. The fluorescence assay described in this protocol allows the measurement of the levels of proteins, such as lysozyme, that are secreted into the apical compartment. Responses to injury induction by pro-inflammatory cytokines can be measured with these readouts, as well as the potential effects of barrier-restoring compounds.
The authors have nothing to disclose.
This work is supported by the Topsector Life Sciences & Health – Topconsortium voor Kennis en Innovatie Health~Holland (LSH-TKI) public-private partnerships (PPP) allowance of the Dutch LSH sector with Project number LSHM16021 Organoids as novel tool for toxicology modelling to Hubrecht Organoid Technology (HUB) and HUB internal funding to Disease Modeling and Toxicology department. We thank the laboratories of Sabine Middendorp (Division of Pediatric Gastroenterology, Wilhelmina Children's Hospital, UMC, Utrecht) and Hugo R. de Jonge and Marcel J.C. Bijvelds (Department of Gastroenterology and Hepatology, Erasmus MC, Rotterdam) for providing initial technical support to set up monolayers on membrane inserts.
100% ethanol | Fisher Emergo | 10644795 | |
1250, 300, and 20 µL low-retention filter-tips | Greiner bio-one | 732-1432 / 732-1434 / 732-2383 | |
15 mL conical tubes | Greiner bio-one | 188271 | |
24-well cell culture plates | Greiner bio-one | 662160 | |
24-well HTS Fluoroblok Transwell plate (light-tight) | Corning | 351156 | Plates require REMS AutoSampler for TEER measurements |
24-well HTS Transwell plates (Table 1) | Corning | 3378 | |
24-well plate with Transwell inserts | Corning | 3470 | membrane inserts |
40 µm cell strainer | PluriSelect | 43-50040-01 | |
50 mL conical tubes | Greiner bio-one | 227261 | |
6-well cell culture plates | Greiner bio-one | 657160 | |
96-well black plate transparent bottom | Greiner bio-one | 655090 | |
96-well fast thermal cycling plates | Life Technologies Europe BV | 4346907 | |
96-well HTS Fluoroblok Transwell plate | Corning | 351162 | |
96-well HTS Transwell plates (Table 1) | Corning | 7369 | |
96-well transparent culture plate | Greiner bio-one | 655180 | |
A83-01 | Bio-Techne Ltd | 2939 | |
Accutase Cell Dissociation Reagent | Life Technologies Europe BV | A11105-01 | |
Advanced DMEM/F-12 | Life Technologies Europe BV | 12634028 | |
B27 supplement | Life Technologies Europe BV | 17504001 | |
Cell culture microscope (light / optical microscope) | Leica | ||
CellTiter-Glo | Promega | G9683 | |
Centrifuge | Eppendorf | ||
CO2 incubator | PHCBI | ||
DAPT | Sigma-Aldrich | D5942 | |
DEPC treated H2O | Life Technologies Europe BV | 750024 | |
Dulbecco's phosphate-buffered saline (DPBS) with Ca2+ and Mg2+ | Life Technologies Europe BV | 14040091 | |
DPBS, powder, no calcium, no magnesium | Life Technologies Europe BV | 21600069 | |
EnzChek Lysozyme Assay Kit | Life Technologies Europe BV | E22013 | |
EVOM2 meter with STX electrode | WTI | ||
Gastrin | Bio-Techne Ltd | 3006 | |
Glass pipettes | Volac | ||
GlutaMAX | Life Technologies Europe BV | 35050038 | |
hEGF | Peprotech | AF-100-15 | |
HEPES | Life Technologies Europe BV | 15630056 | |
Human Noggin | Peprotech | 120-10C | |
Human Rspo3 | Bio-Techne Ltd | 3500-RS/CF | |
IWP-2 | Miltenyi Biotec | 130-105-335 | |
Ki67 primary antibody | Sanbio | BSH-7302-100 | |
Ki67 secondary antibody | Agilent | K400111-2 | |
Kova International Glasstic Slide with Counting grids | Fisher Emergo | 10298483 | |
Laminar flow hood | Thermo scientific | ||
Lucifer Yellow CH dilithium salt | Sigma-Aldrich | L0259 | |
Matrigel, Growth Factor Reduced (GFR) | Corning | 356231 | extracellular matrix (ECM) |
MicroAmp Fast 8-Tube Strip, 0.1 mL | Life Technologies Europe BV | 4358293 | |
MicroAmp Optical 8-Cap Strips | Life Technologies Europe BV | 4323032 | |
Microcentrifuge tubes | Eppendorf | 0030 120 086 | |
Micropipettes (1000, 200, and 20 µL) | Gilson | ||
Microtome | Leica | ||
MUC2 primary antibody | Santa Cruz Biotechnology | sc-15334 | |
MUC2 secondary antibody | VWR | VWRKS/DPVR-HRP | |
Multichannel pipette (200 µL) | Gilson | ||
N-acetylcysteine | Sigma-Aldrich | A9165 | |
NGS Wnt | U-Protein Express | N001-0.5mg | |
Nicotinamide | Sigma-Aldrich | N0636 | |
Oligonucleotide ALPI1/Forward | Custom-made | GGAGTTATCCTGCTCCCCAC | |
Oligonucleotide ALPI1/Reverse | Custom-made | CTAGGAGGTGAAGGTCCAACG | |
Oligonucleotide LGR5/Forward | Custom-made | ACACGTACCCACAGAAGCTC | |
Oligonucleotide LGR5/Reverse | Custom-made | GGAATGCAGGCCACTGAAAC | |
Oligonucleotide MUC2/Forward | Custom-made | AGGATCTGAAGAAGTGTGTCACTG | |
Oligonucleotide MUC2/Reverse | Custom-made | TAATGGAACAGATGTTGAAGTGCT | |
Oligonucleotide TBP/Forward | Custom-made | ACGCCGAATATAATCCCAAGCG | |
Oligonucleotide TBP/Reverse | Custom-made | AAATCAGTGCCGTGGTTCGTG | |
Optical adhesive covers | Life Technologies Europe BV | 4311971 | |
PD0325901 | Stemcell Technologies | 72184 | |
Penicillin/streptomycin | Life Technologies Europe BV | 15140122 | |
Plate shaker | Panasonic | ||
PowerUp SYBR Green Master Mix | Fisher Emergo | A25776 | |
Primocin | InvivoGen | ANT-PM-2 | antimicrobial formulation for primary cells |
Qubit RNA HS Assay Kit | Life Technologies Europe BV | Q32852 | |
Reagent reservoir for multichannel pipet | Sigma-Aldrich | CLS4870 | |
REMS AutoSampler with 24-probe or 96C-probe | WTI | ||
Richard-Allan Scientific Alcian Blue/PAS Special Stain Kit | Thermo scientific | 87023 | |
RNase-Free DNase Set | Qiagen | 79254 | |
RNeasy Mini Kit | Qiagen | 74106 | |
SB202190 | Sigma-Aldrich | S7076 | |
Serological pipettes | Greiner bio-one | 606180 / 607180 / 760180 | |
Serological pipettor (Pipet-Aid) | Drummond | ||
Single edge razor blade | GEM Scientific | ||
Superscript 1st strand system for RT-PCR | Life Technologies Europe BV | 11904018 | |
Tecan Spark 10M plate reader | Tecan | ||
Trypan Blue Solution, 0.4% | Life Technologies Europe BV | 15250-061 | |
TrypLE Express Enzyme (1x) | Life Technologies Europe BV | 12605-010 | Cell dissociation reagent |
Water bath | Grant | ||
Y27632 (ROCK inhibitor) | AbMole | M1817 |