Samples collected by citizen scientists for the detection of SARS-CoV-2. During an 8-month period (mid-March to the third week of November 2020), 482 citizens were approved to participate in this project, of which 350 (73%) requested a kit. A total of 362 kits were delivered (i.e., some participants requested multiple kits), and 246 (70%) were returned (Figure 4A,B). All 4,080 samples contained in these kits were processed. Collection sites were distributed across North Coastal, North Central, Central, and Southern districts of the county, as well as a few at the eastern districts (Figure 4A). These districts have the highest population density of San Diego County and the most documented COVID-19 cases, as reported by the San Diego Human Health Service Agency39.
Citizens requested pickup of most sampled kits (i.e., average success rate: 70.4%). Each day, 1-16 kits were requested, and 0-14 kits were returned to the laboratory (Figure 4B). A survey of the citizen scientists showed that the collection of a complete kit (16 samples) took 1-3 h distributed throughout an average of 8 days (Figure 4A and Table 4). The great majority of the kits were complete (91.1%), meaning they contained a swab inside all 16 sample tubes, and the corresponding sampling data was uploaded to the LIMS (Figure 4A and Table 4).
Detection of SARS-CoV-2 using GITC-chloroform extraction and multiplex reverse transcriptase loop-mediated isothermal amplification (RT-LAMP). For the colorimetric RT-LAMP assay, two sets of primers11,20,28 were used to target the nucleocapsid (N2) and the envelope (E1) genes (Table 2). The sequences recognized by these primers are in the same region as the primers and probes approved by the CDC40 and the European Union (EU)41 for human diagnosis of COVID-19 by RT-qPCR. These results corroborate what Zhang et al.28 described, in which adding 60 mM guanidine hydrochloride to the reaction increases the LOD when run in multiplex. The LOD at a frequency of 100% was 500 copies per 25 µL reaction (Figure 3A,B). In the colorimetric RT-LAMP, positive samples changed color from pink to yellow due to a pH shift from ~8 to 5.5 (Figure 3B). When the reaction turned orange at low-copy numbers, samples were run in a 1.5% agarose gel to confirm these were positive and resulted in a ladder-like pattern (Figure 3C). RT-LAMP was used to detect SARS-CoV-2 in pooled RNA samples.
To control for false negatives due to reaction inhibitors, each sample was tested in an additional reaction spiked with 500 copies of synthetic SARS-CoV-2. Positive pooled samples were dereplicated by isolating the RNA of each individual sample in the pool and run in a RT-LAMP reaction to determine the identity of the positive sample. The detection results were then uploaded to the LIMS where the unique sample ID was paired with the information on date, time, GPS coordinates, site, and image of the sample.
Real-time and traditional RT-PCR methods: inhibition by sample contaminants. To select the best method suitable for the proposed detection pipeline, other RNA amplification methods were tested with environmental samples collected by a pilot cohort of citizen scientists. Examples of the results of each of these methods are presented in Figure 5 to depict their sensitivity to environmental inhibitors and background signal noise at low viral copy-number concentrations.
Six RT-qPCR formulations (Table of Materials) approved by the CDC and the WHO were tested for detection of the virus on environmental samples. Protocols were followed according to the manufacturer's instructions as well as CDC guidelines for the detection of SARS-CoV-2 in clinical settings40. Reactions containing different concentrations of synthetic SARS-CoV-2 RNA controls were spiked into swabbed-surface samples after crude RNA isolation. All master mixes were sensitive to inhibitors at LOD concentrations of the positive control (Figure 5A).
To bypass inhibitors of these real-time technologies, a traditional RT-PCR system was tested. A one-step RT-PCR system (Table of Materials) was used to amplify the nucleocapsid gene using the primer sets N1, N2, and the envelope gene using the primer set E1 approved by the CDC (USA) and the ECDC (EU), respectively (Table 2). Protocols were followed according to the manufacturer's instructions as well as CDC guidelines for the detection of SARS-CoV-2 in clinical settings40. The primer sets N1 and N2 designed by the CDC yield a ~70 bp product; however, low-copy number positives were not distinguished from the amplification background noise of the negative control (Figure 5B), which introduced false positives into the results. The product of the E1 primers had a weak signal at low-copy number (Figure 5B), introducing false negatives into the results. Furthermore, the RT-PCR method tested was still sensitive to inhibitors present in the environmental samples (data not shown).
Other methods have been developed to detect very small quantities of target sequence. One of these methods is the Rolling Circle Amplification (RCA), whereupon recognition of the target sequence, RNA or DNA, by a specific linear probe, a ligase circularizes the template. Using primers designed to hybridize with the probe, a DNA polymerase with strand-displacement activity amplifies the probe in an isothermal reaction42. It is the probe that identified the target, which is amplified, and not the target sequence, which makes this method highly sensitive43. Wang et al.44 published an RCA protocol for the direct detection of SARS-CoV-1 RNA. The method was modified to use primers specific for SARS-CoV-2. Unfortunately, in the non-template control (NTC), the probe circularizes and yields product in the absence of RNA template, even when using a wide variety of ligases, including an SNP-sensitive ligase. In the absence of ligase, the NTC did not show amplification from the linearized probe (Figure 5C).

Figure 1: Web-based sampling platform with sample collection data interface for mobile devices. (A) A website, containing a multilingual plugin, was created to mediate the interaction between the laboratory and the citizen scientists. The platform was used for sample kit delivery/pickup request and sample data submission. The platform contained detailed English/Spanish graphic and audiovisual sampling protocols. (B) Mobile device view used to upload sample data: date, time, GPS coordinates, sample site description, and an image of the collection site. Abbreviations: SARS-CoV-2 = severe acute respiratory syndrome coronavirus 2; GPS = Global Positioning System. Please click here to view a larger version of this figure.

Figure 2: Sample collection kit. Citizen scientists received a cooler containing two ice packs, a safety data sheet to inform volunteers about the hazards of handling the GITC solution, a detailed sampling and mask-wearing protocol, a KN95 mask, a waste bag, a spray bottle with hand sanitizer, a spray bottle with 0.5% SDS, 16 pairs of gloves, a small bag with 16 toothpicks and 16 polyester swabs, 16 pre-labeled microcentrifuge tubes containing 200 µL of GITC solution, a box containing the sampling tubes, and a bag used as the secondary container for the tube box in the event of a spill. Abbreviations: GITC = guanidinium thiocyanate; SDS = sodium dodecyl sulfate. Please click here to view a larger version of this figure.

Figure 3: Multiplexed Reverse-Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) assay. Multiplexed reactions using primers for SARS-CoV-2 nucleocapsid (N2) and envelope (E1) genes to detect as few as 10 copies of the virus in the reaction. Synthetic SARS-CoV-2 RNA was used as positive control. (A) Frequency of detection in multiplex colorimetric RT-LAMP of SARS-CoV-2 at different genome copy numbers per reaction. Mean value of five replicates in pink. (B) Limit-of-detection (LOD) of SARS-CoV-2 in multiplex colorimetric RT-LAMP; yellow = positive (pH ~5); pink = negative (pH ~8). (C) Ladder pattern of positive SARS-CoV-2 RT-LAMP reactions in 1.5% agarose gel electrophoresis. Abbreviations: SARS-CoV-2 = severe acute respiratory syndrome coronavirus 2; rxn = reaction. Please click here to view a larger version of this figure.

Figure 4: Location of citizen scientist sampling kits in San Diego County and success rate of requested kits. (A) Orange dots represent the location of 1 sampling kit, which contains 16 samples. The blue pie chart shows the percentage of kits that took various days from when they were delivered to the citizen scientists to when they were returned to the laboratory. Number of days in parentheses. The orange pie chart shows the percentage of kits with different number of completed samples from a total of 16 samples. Number of completed samples containing a swab inside the sample tube and the corresponding sampling data uploaded to the LIMS in parentheses. (B) Percentage of kits that were returned to the laboratory (dots), and total number of requested kits (bars), relative to the date when the kit was requested. Please click here to view a larger version of this figure.

Figure 5: Alternative SARS-CoV-2 RNAdetection methods. (A) RT-qPCR detection of SARS-CoV-2 nucleocapsid (N) gene using primer set N2. Pooled environmental samples spiked with 900 (green), or 9 (orange) copies of SARS-CoV-2. Positive controls of the same copy numbers in blue. Arrow indicates the decrease in fluorescence detection of low-copy number positive control when environmental sample is present. (B) Traditional RT-PCR detection of SARS-CoV-2. Top: RT-PCR products of the nucleocapsid gene using primer sets N1 and N2. A faint background signal is observed in the no-template control. Bottom: RT-PCR products of the envelope gene using primer set E1. Very low signal is observed at the LOD concentration. Blue arrows show expected positive product: (top) ~70 bp and (bottom) 113 bp in 2% agarose gel electrophoresis. (C) RCA of SARS-CoV-2 RNA. Circular probe amplifies in the presence of ligase and absence of RNA template (NTCcir); in the absence of ligase and RNA template linear probe does not amplify (NTClin). Abbreviations: SARS-CoV-2 = severe acute respiratory syndrome coronavirus 2; RFU = relative fluorescence units; bp = base pairs; rxn = reaction; MM = molecular marker; RT-PCR = reverse-transcription polymerase chain reaction; RT-qPCR = real-time quantitative RT-PCR; RCA = rolling circle amplification; NTC= no-template control; LOD = limit of detection; rxn = reaction. Please click here to view a larger version of this figure.
| Primer | 20X Concentration (μM) | 1X Concentration (μM) |
| FIP | 32 | 1.6 |
| BIP | 32 | 1.6 |
| F3 | 4 | 0.2 |
| B3 | 4 | 0.2 |
| LoopF | 8 | 0.4 |
| LoopB | 8 | 0.4 |
Table 1: Formulation for 20X RT-LAMP primer mix. In the RT-LAMP reaction, 6 primers recognize 8 regions of the targeted DNA. Abbreviations: reverse-transcription loop-mediated isothermal amplification; FIP = forward inner primer; BIP = backward inner primer; F3 = forward displacement primer; B3 = backward displacement primer; LoopF = forward loop primer; LoopB = backward loop primer.
| Primer | Sequence | Target | Product size |
| RT-LAMP9,18,19 |
| E1-F3 | TGAGTACGAACTTATGTACTCAT | E | ladder-like pattern |
| E1-B3 | TTCAGATTTTTAACACGAGAGT |
| E1-FIP | ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGACAG |
| E1-BIP | TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT |
| E1-LoopB | GCGCTTCGATTGTGTGCGT |
| E1-LoopF | CGCTATTAACTATTAACG |
| N2-F3 | ACCAGGAACTAATCAGACAAG | N |
| N2-B3 | GACTTGATCTTTGAAATTTGGATCT |
| N2-FIP | TTCCGAAGAACGCTGAAGCGGAACTGATTACAAACATTGGCC |
| N2-BIP | CGCATTGGCATGGAAGTCACAATTTGATGGCACCTGTGTA |
| N2-LoopF | GGGGGCAAATTGTGCAATTTG |
| N2-LoopB | CTTCGGGAACGTGGTTGACC |
| RT-qPCR38 |
| 2019-nCoV_N1-F | GACCCCAAAATCAGCGAAAT | N | 72 bp |
| 2019-nCoV_N1-R | TCTGGTTACTGCCAGTTGAATCTG |
| 2019-nCoV_N1-P | 5’-FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1-3’ |
| 2019-nCoV_N2-F | TTACAAACATTGGCCGCAAA | N | 67 bp |
| 2019-nCoV_N2-R | GCGCGACATTCCGAAGAA |
| 2019-nCoV_N2-P | 5’-FAM-ACA ATT TGC CCC CAG CGC TTC AG-BHQ1-3’ |
| RT-PCR39 |
| E1_Sarbeco_F | ACAGGTACGTTAATAGTTAATAGCGT | E | 113 bp |
| E1_Sarbeco_R | ATATTGCAGCAGTACGCACACA |
Table 2: Primers used for RT-LAMP, RT-qPCR, and RT-PCR. Primer sequences, target gene, expected product size, and corresponding reference are listed. Abbreviations: RT-LAMP = reverse-transcription loop-mediated isothermal amplification; RT-PCR = reverse-transcription polymerase chain reaction; bp = base pairs; RT-qPCR = real-time quantitative RT-PCR; E1 = envelope gene; N2 = nucleocapsid gene; F = forward primer; R = reverse primer; P = Probe ; FIP = forward inner primer; BIP = backward inner primer; F3 = forward displacement primer; B3 = backward displacement primer; LoopF = forward loop primer; LoopB = backward loop primer.
| Reagent | Volume (μL) |
| WarmStart Colorimetric LAMP 2X Master Mix with UDG | 12.5 |
| N2 Primer Mix (20x) | 1.25 |
| E1 Primer Mix (20x) | 1.25 |
| Guanidine Hydrochloride (600 mM)* | 2.5 |
| Target RNA | 5 |
| Nuclease-free H2O | 2.5 |
| Total Volume | 25 |
Table 3: Reaction master mix for multiplex colorimetric RT-LAMP. (*) Guanidine Hydrochloride has been shown to increase the sensitivity and speed of the reaction by an uncharacterized mechanism28. Abbreviations: LAMP = loop-mediated isothermal amplification; UDG = uracil-DNA glycosylase; N2 = nucleocapsid gene; E1 = envelope gene; DEPC = diethylpyrocarbonate.
| Approved citizens | Citizens who requested a kit | Delivered kits | Returned sampled kits | Days dedicated to sampling | % Complete kits | % Incomplete kits | Processed samples |
| 482 | 72.6% (350/482) | 362 | 70.4% (255/362) | Mean | 8 | 91.1 (224/246) | 8.9 (22/246) | 4,080 |
| Median | 3 |
Table 4:Swabbing for SARS-CoV-2 by the numbers. Outreach and sampling success rates. Abbreviation: SARS-CoV-2 = severe acute respiratory syndrome coronavirus 2.