A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Zebrafish Model of Neuroblastoma Metastasis

2.7K views

DOI:

10.3791/62416

March 14th, 2021

In This Article

Summary

This paper introduces the method of developing, characterizing, and tracking in real-time the tumor metastasis in zebrafish model of neuroblastoma, specifically in the transgenic zebrafish line with overexpression of MYCN and LMO1, which develops metastasis spontaneously.

Abstract

Zebrafish has emerged as an important animal model to study human diseases, especially cancer. Along with the robust transgenic and genome editing technologies applied in zebrafish modeling, the ease of maintenance, high-yield productivity, and powerful live imaging altogether make the zebrafish a valuable model system to study metastasis and cellular and molecular bases underlying this process in vivo. The first zebrafish neuroblastoma (NB) model of metastasis was developed by overexpressing two oncogenes, MYCN and LMO1, under control of the dopamine-beta-hydroxylase (dβh) promoter. Co-overexpressed MYCN and LMO1 led to the reduced latency and increased penetrance of neuroblastomagenesis, as well as accelerated distant metastasis of tumor cells. This new model reliably reiterates many key features of human metastatic NB, including involvement of clinically relevant and metastasis-associated genetic alterations; natural and spontaneous development of metastasis in vivo; and conserved sites of metastases. Therefore, the zebrafish model possesses unique advantages to dissect the complex process of tumor metastasis in vivo.

Introduction

Zebrafish has been widely used and applied to several areas of research, especially in cancer. This model provides many advantages-such as its robust reproduction, cost-effective maintenance, and versatile visualization of tumor growth and metastasis-all of which make zebrafish a powerful tool to study and investigate the cellular and molecular bases of tumorigenesis and metastasis. New techniques for large-scale genome mapping, transgenesis, genes overexpression or knockout, cell transplantation, and chemical screens have immensely augmented the power of the zebrafish model1. During the past few years, many zebrafish lines have been developed to study tumorigenesis and metastasis of a variety of human cancers, including but not limited to leukemia, melanoma, rhabdomyosarcoma, and hepatocellular carcinoma2,3,4,5. Additionally, the first zebrafish model of neuroblastoma (NB) was generated by overexpressing MYCN, an oncogene, in the peripheral sympathetic nervous system (PSNS) under control of the dopamine-beta-hydroxylase (dβh) promoter. With this model, it was further demonstrated that activated ALK can synergize with MYCN to accelerate tumor onset and increase tumor penetrance in vivo6.

NB is derived from the sympathoadrenal lineage of the neural crest cells, and is a highly metastatic cancer in children7. It is responsible for 10% of pediatric cancer-related deaths8. Widely metastasized at diagnosis, NB can be clinically presented as tumors primarily originating along the chain of the sympathetic ganglia and the adrenal medulla of PSNS9,10. MYCN amplification is commonly associated with poor outcomes in NB patients11,12. Moreover, LMO1 has been identified as a critical NB susceptibility gene in high-risk cases13,14. Studies found that the transgenic coexpression of MYCN and LMO1 in the PSNS of the zebrafish model not only promotes earlier onset of NB, but also induces widespread metastasis to the tissues and organs that are similar to sites commonly seen in patients with high-risk NB13. Very recently, another metastatic phenotype of NB has also been observed in a newer zebrafish model of NB, in which both MYCN and Lin28B, encoding an RNA binding protein, are overexpressed under control of the dβh promoter16.

The stable transgenic approach in zebrafish is often used to study whether overexpression of a gene of interest could contribute to the normal development and disease pathogenesis14,15. This technique has been successfully used to demonstrate the importance of multiple genes and pathways to NB tumorigenesis6,16,17,18,19,20. This paper will introduce how the transgenic fish line that overexpresses both MYCN and LMO1 in the PSNS was created and how it was demonstrated that the cooperation of these two oncogenes accelerate the onset of NB tumorigenesis and metastasis13. First, the transgenic line that overexpresses EGFP-MYCN under control of the dβh promoter (designated MYCN line) was developed by injecting the dβh-EGFP-MYCN construct into one-cell stage of wild-type (WT) AB embryos, as previously described6,17. A separate transgenic line that overexpresses LMO1 in the PSNS (designated LMO1 line) was developed by coinjecting two DNA constructs, dβh-LMO1 and dβh-mCherry, into WT embryos at the one-cell stage13. It has been previously demonstrated that coinjected double DNA constructs can be cointegrated into the fish genome; therefore, LMO1 and mCherry are coexpressed in the PSNS cells of the transgenic animals. Once the injected F0 embryos reached sexual maturity, they were then out-crossed with WT fish for the identification of positive fish with transgene(s) integration. Briefly, the F1 offspring were first screened by fluorescent microscopy for mCherry expression in the PSNS cells. The germline integration of LMO1 in mCherry-positive fish was further confirmed by genomic PCR and sequencing. After successful identification of each transgenic line, the progeny of heterozygous MYCN and LMO1 transgenic fish were interbred to generate a compound fish line expressing both MYCN and LMO1 (designated MYCN;LMO1 line). Tumor-bearing MYCN;LMO1 fish were monitored by fluorescent microscopy biweekly for the evidence of metastatic tumors in the regions distant to the primary site, interrenal gland region (IRG, zebrafish equivalent of human adrenal gland)13. To confirm the metastasis of tumors in MYCN;LMO1 fish, histological and immunohistochemical analyses were applied.

Access restricted. Please log in or start a trial to view this content.

Protocol

All research methods using zebrafish and animal care/maintenance were performed in compliance with the institutional guidelines at Mayo Clinic.

1. Preparation and microinjection of transgene constructs for the development of LMO1 transgenic zebrafish line with overexpression in PSNS

  1. To develop the LMO1-pDONR221 entry clone, amplify the coding region of human LMO1 from cDNA obtained from human cell line using PCR.
    1. Make a 25 µL reaction as detailed here: 2.5 µL of 10x standard Taq Reaction Buffer, 0.125 µL of Taq DNA Polymerase, 0.5 µL of 10 mM dNTPs, 2 µL of cDNA template, 0.5 µL of 10 µM forward LMO1 ATTB1 primer, 0.5 µL of 10 µM reverse LMO1 ATTB2 primer, and 18.875 µL of water.
      ​NOTE: Use forward LMO1 ATTB1 primer: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTACAC-3'.
      CATGATGGTGCTGGACAAGGAGGA-3' and reverse LMO1 ATTB2 primer: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACT
      GAACTTGGGATTCAAAGGT-3'
    2. Amplify using the following program: 1 cycle of 94 °C, 2 min; followed by 30 cycles of (94 °C, 30 s, 55 °C, 30 s, 72 °C, 1 min) and 72 °C, 7 min.
  2. Clone LMO1 PCR product into the pDONR221 gateway donor vector by BP recombinase reaction6,13 (PCR fragment + Donor vector = Entry Clone).
    1. For a 10 µL reaction, mix 1 µL of purified LMO1 PCR product (150 ng/µL), 1 µL (150 ng/µL) pDONR221 donor vector, and 6 µL of TE buffer (pH 8.0) with 2 µL of BP enzyme mix, incubate for 1 h at 25 °C, and transform to TOP10 competent E. coli using the manufacturer's protocol.
    2. Next, spread 50-200 µL from the transformation vial on a Luria Broth (LB) agar plate containing 50 µg/mL kanamycin and incubate at 37 °C overnight.
    3. Select clones by inoculating a single colony into 2-5 mL of LB with 50 µg/mL kanamycin and culturing overnight (16-18 h) at 37 °C.
    4. Use 2 mL of overnight bacterial culture for plasmid isolation according to the manufacturer's protocol. To verify the LMO1 plasmid, send plasmid sample out for sequencing with M13-F primer (5- GTAAAACGACGGCCAG-3').
  3. To generate a dβh-pDONRP4-P1R entry clone, obtain dβh PCR product6,13 by amplifying the 5.2-kb promotor region using the CH211-270H11 BAC clone as template to prepare a 20 µL reaction as previously described in step 1.1.1. Use the following PCR program parameters: 94 °C, 2 min; 10 cycles of 94 °C, 15 s, 50 °C, 30 s, 68 °C, 8 min; 30 cycles of 94 °C, 15 s, 53 °C, 30 s, 68 °C, 8 min; 68 °C, 4 min (with forward primer 5'GGGGACAACTTTGTATAGAAAAGTTGGCGTACTC
    CCCCTTTTTAGG-3' and reverse primer 5'-GGGGACTGCTTTTTTGTACAAACTTGTGTTGCTTTG
    TCGTCTTTTGA-3').
    NOTE: Due to the long DNA templates in this step, ensure usage of an appropriate PCR system for accurate PCR amplification.
  4. Clone dβh PCR product into the pDONRP4-P1R gateway donor vector by BP recombinase reaction6,13 (PCR fragment + Donor vector = Entry Clone).
    1. Mix 1 µL of purified dβh PCR product (172 ng/uL), 1 µL (150 ng/µL) of pDONRP4-P1R donor vector, and 6 µL of TE buffer (pH 8.0) with 2 µL of BP enzyme mix in a total of 10 µL reaction, incubate for 1 h at 25 °C.
    2. Transform to TOP10 competent E. coli according to the manufacturer's protocol. Isolate the plasmid as described in steps 1.2.2-1.2.4 and verify plasmid by sequencing with M13-F (5'-GTAAAACGACGGCCAG-3') and M13-R (5'-CAGGAAACAGCTATGAC-3') primers.
  5. Generate the dβh:LMO1 expression construct.
    1. Combine 1 µL of each entry clone (dβh-pDONRP4-P1R, LMO1-pDONR221 and p3E-polyA11) (20 fmole each), 1 µL (60 ng/µL) of modified destination vector with I-SceI recognition sites, and 4 µL of TE buffer (pH 8.0) containing 2 µL of the LR recombinase enzyme mix. Incubate this mixture for 1 h at 25 °C.
    2. While following the manufacturer's protocol, transform bacteria to chemically competent TOP10 E. coli. Isolate plasmid as described in steps 1.2.2-1.2.4 and verify plasmid by sequencing with DBH Forward (5'-GAAGCTGTCACAGGGTTGTG-3') and LMO1 (5'-GGCATTGGACAAGTACTGGCA-3') primers.
  6. Generate dβh:mCherry DNA construct with a gateway system by combining entry clones of a 5.2-kb dβh promoter, pME-mCherry, and p3E-polyA into the modified destination vector containing I-SceI recognition sites as mentioned previously in step 1.5.16. Isolate plasmid as described in steps 1.2.2-1.2.4 and verify plasmid by sequencing with DBH Forward primer (5'-GAAGCTGTCACAGGGTTGTG-3').
  7. Linearize dβh:LMO1 DNA construct and dβh:mCherry DNA construct (at a 3:1 ratio, respectively) in a total of a 15 µL reaction volume with 1 µL of I-SceI enzyme (5 U/µL) and 0.75 µL of buffer (10x), and incubate at room temperature for a minimum of 4 h or overnight. Ensure that DNA concentration does not exceed 750 ng in reaction.
  8. Next day and after linearization of constructs, add 0.5 µL of fresh I-SceI enzyme (5 U/µL) and 0.5 µL of 0.5% phenol red into 5 µL of total DNA mixture from previous step of 1.7. Microinject the total solution (of 50-80 pg of linearized DNA) into one-cell-stage wild-type AB embryos (and as many as 500 embryos) using 1.0 mm diameter glass micropipette needle as previously described17. Store the remaining DNA mixture at -20 °C for future injections.

2. Screen and verify LMO1 transgenic fish line for germline transmission of LMO1 and mCherry

  1. At 3-4 days-post-fertilization (dpf), anesthetize injected embryos with 0.02% tricaine and screen them for fluorescent mCherry expression, which presents anywhere throughout the fish body due to the mosaic transgenesis. Transfer mCherry-positive embryos into a Petri dish with fresh egg water and raise embryos to sexual maturity in accordance with the zebrafish book21.
    NOTE: Expect the ratio of positive fish to vary depending on the expertise and experience of research personnel. For example, beginning amateurs may have a low integration rate of 10%, compared to an expert's of ≥50%.
  2. To determine the founder fish with dβh:LMO1 and dβh:mCherry transgenes integrated into germ cells, outcross single pairs of injected mCherry-positive F0 sexually matured fish from previous step (2.1) with WT AB fish. Screen the F1 generation for mCherry-positive embryos at 3-4 dpf.
  3. To confirm that the mCherry-positive fish carry LMO1 transgene, isolate the gDNA from F1 mCherry-positive single embryo using the gDNA extraction buffer, which contains: 12.5 µL of 4x lysis buffer (500 µL of 1 M Tris with pH of 8.4, 2.5 mL of 1 M potassium chloride, and 47 mL of purified water), 35 µL of purified water, and 2.5 µL of proteinase K at 10 mg/mL. Incubate the sample for 16 h at 55 °C, followed by 10 min at 98 °C.
  4. Use the extracted gDNA (2 µL) as a template for the genotyping PCR with primers: LMO1 FW: 5'-GGCATTGGACAAGTACTGGCA -3' and LMO1 RV: 5'-CGAAGGCTGGGATCAGCTTG -3', and the following PCR program: 1 cycle of 94 °C, 10 min; 35 cycles of (94 °C for 30 s, 60 °C for 30 s; 68 °C, 30 s); and 68 °C for 7 min. Confirm the amplified 182 bp fragment by sequencing.
  5. After confirmation of the genotype, raise the remaining mCherry-positive F1 embryos to maturity in accordance with the standard guidelines of the zebrafish book21. Fin clip and genotype them at 2-3 months of age using steps 2.3-2.4 from the protocol above to further confirm the integration of the LMO1 transgene in the fish.
    NOTE: The LMO1-positive F1 fish will be the stable transgenic fish [Tg(dβh:LMO1),Tg(dβh:mCherry)] (designated as LMO1 line).
  6. Breed F1 LMO1 stable transgenic fish with WT fish and repeat as needed to propagate this line.

3. Outcross of LMO1 and MYCN transgenic lines to create metastatic model

  1. Once the LMO1 transgenic zebrafish line is generated, interbreed with MYCN line6,17 to develop heterozygous transgenic fish line overexpressing both MYCN and LMO1.
  2. At 1 dpf, sort the progeny of outcross for EGFP expression with stereoscopic fluorescence microscope, which presents as EGFP-positive points in the hindbrain region.
    NOTE: Alternatively, if not all embryos are sorted for MYCN at 1 dpf, raise the embryos to adulthood and genotype by fin clipping and using formerly stated guidelines from steps 2.3-2.4 for gDNA isolation and PCR genotyping, with primers: MYCN-F (5'-ATT CAC CAT CAC TGT GCG TCC-3'); MYCN-R (5'-TGC ATC CTC ACT CTC CAC GTA-3', and the following program with standard Taq polymerase: 1 cycle of 94 °C for 3 min, 35 cycles of (94 °C for 30 s, 60 °C for 30 s, and 68 °C for 3 min), and 68 °C for 7 min with expected amplicon size of 145 bp.
  3. After sorting for EGFP at 1 dpf, isolate screened embryos into separate Petri dishes and label dishes as: MYCN+ (EGFP-positive) or MYCN- (EGFP-negative).
  4. At 3-4 dpf, visualize and sort embryos of both groups (step 3.3) for LMO1 expression with a stereoscopic fluorescence microscope. Look for red fluorescent protein expression as spots in both the superior cervical ganglion and non-PSNS dopaminergic neuronal cells in the head region, especially in oblongata medulla of the hindbrain6,13.
    NOTE: Screen for mCherry/LMO1 before embryos reach 5 dpf, because air-filled swim bladders fully develop by then and will cause the embryos to float, resulting in difficult microscopic focusing of the PSNS cells during the sorting process.
  5. Once sorting is completed, isolate sorted fish into four groups of different genotypes and label as below. Raise the sorted fish in identical conditions according to the standard protocols from the zebrafish book21.
    1. MYCN-only (EGFP-positive),
    2. LMO1-only (mCherry-positive),
    3. MYCN; LMO1 (EGFP and mCherry double positive),
    4. WT (EGFP and mCherry double negative).

4. Visualizing tumor burden in transgenic zebrafish lines

  1. At 4 weeks-post-fertilization (wpf), anesthetize sorted fish from step 3.5 with 0.02% tricaine in a petri dish.
  2. Visualize tumors with a stereoscopic fluorescence microscope by gently flipping fish with a metal spatula onto both lateral sides to view tumor. Expect tumors to present as single EGFP-, single mCherry-, or double EGFP-and-mCherry-positive masses that arise from the interrenal gland region (near head and kidney).
    NOTE: It is possible that the initial tumor onset is typically presented with a brighter and larger fluorescence positive mass on one side of interrenal gland, which is why it is crucial to visualize both sides of fish to avoid missing early tumor onset.
  3. After identification of the possible tumor-bearing fish, isolate fish into a separate tank with appropriate labels, which includes date of birth, date when tumor screened, and genotype.
  4. At 6 wpf, repeat previous steps 4.1-4.3 to screen tumor-bearing fish and non-tumor bearing fish again to confirm the presence of tumors for previously screened tumor-bearing fish or identify new possible tumor-bearing fish, respectively. Look for sustained or increased size of fluorescence-positive mass in confirmed tumor-bearing fish.
  5. After identifying tumor-bearing fish, monitor them biweekly for evidence of tumor cell migration, which presents as tiny EGFP- and/or mCherry-positive tumor masses far from the primary site of tumorgenesis (interrenal gland region). Isolate these fish into separate tanks as needed and label appropriately to indicate possible metastasis.
  6. To further confirm the metastasis, continue tracking these fish regularly (every two weeks) until the distant fluorescence-positive tumor masses show clearly increased size, indicating growth of tumors in the metastatic sites.

5. Tissue processing and paraffin sectioning of tumor-bearing fish

NOTE: Perform this step to characterize the spontaneously developed primary and/or metastatic tumors in MYCN and MYCN;LMO1 transgenic fish.

  1. After identification and verification of tumor-bearing fish, sacrifice fish from step 4.6 in a Petri dish by submerging fish in 0.02% tricaine to anesthetize first and then increasing tricaine dosage until fish is no longer respiring. Cut the fish into two pieces-with one piece containing the head and a portion of the body's middle section (including tumor), and another piece with the rest of the fish's middle section and tail.
  2. Fix both fish sections with 4% paraformaldehyde (PFA) in 1x PBS for 1 h at room temperature on a rocker. To enhance fixation efficiency, replace buffer with fresh 4% PFA to increase penetrance to the internal organs effectively and quickly. Leave fish with fresh fixing buffer on a rocker at 4 °C overnight or for 48 h.
    CAUTION: PFA is toxic. Since precautionary procedures and proper disposal of reagent depends on the regulations of your institution, seek proper guidelines before using and disposal of reagent.
  3. Prior to the processing, place sample(s) in 100% rapid decalcifier solution for 15-20 min at room temperature. Make sure to use a nonmetal container and to check sample(s) throughout incubation to prevent over decalcification. If sample tissue looks heavily degraded, place sample in water or at 4 °C to slow down the decalcification process.
  4. Once fixed and decalcified, wash fish sample(s) with running tap water for 1 h and place it into processor cassette(s). If there is more than one sample, separate each into its own cassette.
  5. Dehydrate and prepare the tissue for paraffin embedding by placing cassette(s) with fish into the tissue processor where the sample(s) are submerged in various solutions, respectively, as follows: 70% ethanol (60 min, 40 °C), 85% ethanol (50 min, 40 °C), 95% ethanol (40 min, 40 °C) twice, 100% ethanol (30 min, 40 °C), another fresh solution of 100% ethanol (50 min, 40 °C) twice, xylene (30 min, 40 °C), another fresh solution of xylene (50 min, 40 °C), another fresh xylene (50 min, 45 °C), paraffin (30 min, 45 °C), paraffin (20 min, 58 °C) three times.
  6. After the tissue is processed, unload the cassette(s) from the processor machine while maintaining organization of each cassette and making sure to prevent mixing up the fish samples.
  7. Choose the appropriate sized mold based on the size of the fish, making sure the mold will fit the entire cassette with the fish sample. Cover the bottom of the mold with liquid paraffin at 60 °C.
  8. Immediately place cassette with the fish on top of mold (making sure the fish is laid on its flat lateral side for sagittal sections) with liquid paraffin, and finish filling with paraffin to the top of the mold to completely embed the fish.
  9. Place the completed mold on the cold plate of the sectioning microtome until the paraffin is hardened.
  10. Once the paraffin block is hard, which can be judged by visually observing higher opacity and a firm touch to the block, gently remove the block from the mold. Carefully scrape off any excess paraffin from the sides of the cassette.
  11. Section the paraffin-embedded fish block sagittally at 4 microns on the microtome and float the sections on a warm water bath at 40 °C containing distilled water.
  12. Carefully transfer the sections onto positively charged slides and bake in oven at 60 °C for 30 min prior to staining before proceeding to either step 6, 7, or 8.

6. Hematoxylin and eosin (H&E) staining of paraffin sections for pathology review

  1. Place slides containing paraffin sections from step 5.12 into a slide holder. Inside a chemical fume hood, deparaffinize with xylene 3 times, 5 min each. Discard solution after each use.
  2. Rehydrate sections with 100% ethanol for 3 min, and repeat twice with fresh 100% ethanol. Replace 100% ethanol with 95% ethanol for 3 min and then, 80% ethanol for 3 min.
  3. Rinse sections with distilled water for 5 min. While the sections are washing in water, make sure to remove oxidized particles from hematoxylin by either filtering or skimming surface of hematoxylin with a lint-free wipe.
  4. Blot the excess water from the slide holder with lint-free professional grade wipes, and stain slides in 50% hematoxylin (1:1 dilution with distilled water) for 2-5 min depending on desired staining preference and reagent deterioration. Discard hematoxylin when solution color changes from plum to blue/brown or when staining time becomes excessive. Rinse the slides with running tap water for 20 min.
  5. Decolorize the sections in 1% acid ethanol (3.3 mL of Hydrochloric acid with 50 mL of 70% ethanol) by quickly dipping the slides multiple times. Slides can be dipped up to 3 s, but the longer the slides are dipped, the lighter the sections become.
  6. Rinse the slides in tap water twice for 1 min each, and once with deionized water. As an option, slides can be left overnight at this stage, soaking in water.
  7. Immerse the sections in 1.36% lithium carbonate solution (47 g lithium carbonate, 3500 mL water) for 3 s. Make sure not to over incubate the sections since the longer the time in lithium carbonate solution, the more likely the tissue will float.
  8. Rinse the sections in tap water for 5 min, and blot the excess water from the slide holder with lint-free professional grade wipes.
  9. Counterstain the slides in 100% ready-to-use eosin for 15-30 s, and immediately dehydrate with 95% ethanol twice for 5 min each. Replace with 100% ethanol twice for 5 min each, discarding the solutions after each use.
  10. Clear the sections in xylene for 15 min and repeat twice for 3 times in total. Optionally, the slides can be left in xylene overnight at room temperature to better clear excess water.
  11. Allow the slides to air dry in the chemical fume hood and then mount a cover slip using mounting medium to seal tissue sample.
  12. Visualize and image the stained tissue sections under microscopy. Carefully examine the tumors at the primary site (the interrenal gland region in head kidney) and the distant sporadic metastases in other tissues and organs of the fish. Send out stained slides for tissue sections to be reviewed by pathologists. Based on the fish model's similar pathological features to human neuroblastoma, expect the tumors that arose in MYCN-only or MYCN;LMO1 fish to be first diagnosed as neuroblastoma by pathologists.

7. Immunohistochemical Analysis (IHC) with antibodies against NB marker and overexpressed transgenes to further confirm the spread of tumor and their sympathoadrenal lineage property

  1. Staining with fully automatic staining system
    1. To better compare the IHC result with that of H&E staining, select adjacent slides from step 5.12 for IHC staining.
      ​NOTE: Although an automated staining system allows for faster and less laborious results, a manual protocol for IHC staining can be used in the absence of such by referring to steps of subsection 7.2.
    2. Dilute the primary antibody against tyrosine hydroxylase (TH) (1:500), a neuroblastoma marker, based on desired concentration and total amount needed with the automated system's corresponding Primary Antibody Diluent.
      ​NOTE: Optimal antibody concentrations may vary depending on antibody and tissue.
    3. Since the automated system uses onboard heat-induced antigen retrieval with epitope retrieval solution for 20 min and the system's corresponding detection reagent, ensure the parameters for the machine are set as: Peroxidase Blocking, 5 min; Primary antibody with desired concentration, 15 min; biotinylated anti-rabbit IgG secondary antibody (1:500), 8 min; Streptavidin HRP, 8 min; mixed DAB intense substrate, 5 min; and Hematoxylin, 5 min.
    4. Once the settings are set, place the antibody tray into the machine. Set up the slides by creating a new case, which will label the slides. The machine is now loaded and ready to run (dewaxing, staining, and counterstaining).
    5. Once the slides are dewaxed, stained, and counterstained using the automated machine, dehydrate the slides in ethanol gradients of 70%, 95%, and 100% for 5 min each. Submerge slides of sections in 100% fresh ethanol again for 5 min.
    6. Clear the sections in xylene for 5 min, twice, or leave slides in xylene overnight to better clear excess water.
    7. Allow the slides to air dry in the chemical fume hood and then mount a cover slip using a mounting medium. Visualize and image the stained tissue sections with microscopy.
    8. To firmly confirm metastasis in the fish model, compare the slides stained with antibodies against neuroblastoma marker from step 7 to those stained by H&E from step 6.
      NOTE: Expect to see positive staining for neuroblastoma marker, TH, in all tumor cells identified by H&E staining. Also expect no positive staining for TH in adjacent tissues where the metastatic tumors were identified in LMO1;MYCN fish. Make sure to select control WT and MYCN-only fish that are of similar age to MYCN;LMO1 fish for this analysis to rule out the possibility that the metastatic tumors are multifocal primary tumors.
  2. Manually staining without automated IHC staining system
    1. After the slides are baked, select adjacent slides from step 5.12 to allow better comparison between H&E and IHC staining to deparaffinize. Inside a chemical fume hood, dewax and rehydrate the slides with xylene using previous steps 6.1 and 6.2., respectively.
    2. After deparaffinization and rehydration, soak slides in endogenous peroxide blocking solution (1x PBS containing 0.1% sodium azide and 0.3% hydrogen peroxide) for 5 min at room temperature. Wash slides in fresh 1x PBS for 3 min and repeat twice for a total of 3 times.
      CAUTION: Sodium azide is acutely toxic. Ensure to practice precautionary procedures and proper disposal of reagent depending on the regulations of your institution.
    3. Retrieve antigen by incubating slides in solution with proteinase K (1:500 in 1x PBS) for 10 min at room temperature. Wash slides 3 times with 1x PBS for 3 min each.
    4. Block slides by incubating with 5% goat serum in 1x PBS for 30 min at room temperature on rocker. Wash slides with fresh 1x PBS twice for 3 min each.
    5. Add 4 drops of Avidin blocking solution directly onto slide and incubate for 15 min at room temperature. After washing slides with fresh 1x PBS twice for 3 min each, add 4 drops of Biotin blocking solution and incubate at room temperature for 15 min.
    6. After blocking slides, incubate in primary antibody of tyrosine hydroxylase (TH) (1:500) for 45-60 min at room temperature, or overnight at 4 °C.
      NOTE: Stain with additional antibodies against transgenes and other relevant markers to address physiology and activity of primary tumor and other metastatic sites. Optimal antibody concentrations may vary depending on antibody and tissue.
    7. Wash slides with fresh 1x PBS for 3 min, repeating twice with a total of 3 times.
    8. Incubate slides in secondary antibody of biotinylated anti-rabbit IgG secondary antibody (1:500) diluted in blocking solution for 45-60 min at room temperature. Repeat previous washing step 7.2.7.
    9. Add HRP conjugated Avidin (1:300 in 1x PBS), and incubate for 20 min at room temperature. Wash slides 3 times with fresh 1x PBS for 5 min each.
    10. Prepare 3,3’-Diaminobenzidine (DAB) solution (2.5 mL distilled water, 1 drop of kit buffer, 1 drop of hydrogen peroxide, and 2 drops of DAB from kit), and place drops of DAB directly onto slides near a microscope. After adding DAB, observe the color change reaction on the slides under microscope. Once desired staining intensity is reached, stop reaction by placing slide sections in cold distilled water.
    11. Counterstain the slides with fresh 50% hematoxylin by submerging or dipping samples for a few short seconds and placing back into distilled water. Repeat as desired, but normally, once should be enough since tissue sections are thin.
    12. Dehydrate tissue samples on slides in alcohol gradient as previously described in step 7.1.5 and continue through the remaining steps (with the last step as 7.1.8) to finish the IHC analysis.

8. Picrosirius red staining of paraffin slides for collagen accumulation in tumors as mechanism study

  1. Repeat steps 6.1-6.3 to dewax, hydrate, and wash paraffin sections on slides.
  2. After blotting the excess water from the slide holder with professional grade lint-free wipes, stain in 50% hematoxylin for 10 min. Rinse the slides with running tap water for 10 min.
  3. Transfer the slides into Picrosirius Red and incubate at room temperature for 1 h.
  4. Wash the slides in acidified water (5 mL glacial acetic acid in 1 L of tap or distilled water) twice, incubating for 5 min on shaker.
  5. Decant most of the water from slides first before physically shaking and blotting sections on slides to remove as much water as possible.
  6. Quickly place slides into three changes of 100% ethanol to dehydrate paraffin sections.
  7. Repeat steps 6.10 and 6.11 to clear slides in xylene and mount sample. Next, image with compound microscope that is equipped with a camera.
  8. Using ImageJ, count the picrosirius red-positive collagen fibers in at least three random fields for each section. Compare between slides of MYCN and MYCN;LMO1 fish sections.

Access restricted. Please log in or start a trial to view this content.

Results

To determine whether LMO1 synergizes with MYCN to affect NB pathogenesis, transgenic constructs that drive expression of either LMO1 (dβh:LMO1 and dβh:mCherry) or MYCN (dβh:EGFP-MYCN) in the PSNS cells under control of the dβh promoter were injected into zebrafish embryos13. As illustrated in Figure 1A, after the development of stable transgenic lines and validation of their genotypes, heterozygou...

Access restricted. Please log in or start a trial to view this content.

Discussion

Zebrafish has been commonly used in research for the past few decades, especially in cancer research, for obvious reasons, such as its ease of maintenance, robust reproduction, and clear advantages for in vivo imaging1,28. The zebrafish model can be easily manipulated embryonically due to their external fertilization and development, which complements well to mammalian model organisms, such as rats and mice, for large-scale genetic studies

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that they have no competing financial interests.

Acknowledgements

This work was supported by a grant R01 CA240323 (S.Z.) from the National Cancer Institute; a grant W81XWH-17-1-0498 (S.Z.) from the United States Department of Defense (DoD); a V Scholar award from the V Foundation for Cancer Research (S.Z.) and a Platform Grant from the Mayo Center for Biomedical Discovery (S.Z.); and supports from the Mayo Clinic Cancer Center and Center for Individualized Medicine (S.Z.).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
3,3’-Diaminobenzidine (DAB) Vector KitVectorSK-4100
Acetic AcidFisher Scientific / Acros Organic64-19-7
Agarose GP2Midwest Scientific009012-36-6
Anti-Tyrosine Hydroxylase (TH) AntibodyPel-FreezP40101
Avidin/Biotin Blocking KitVectorSP-2001
BOND Intense R DetectionLeica BiosystemsDS9263
BOND primary antibody diluentLeica Biosystems Newcastle, Ltd.AR9352
BOND-MAX IHC instrumentLeica Biosystems Newcastle, Ltd.N/Afully automated IHC staining system
CH211-270H11 BAC cloneBACPAC resources center (BRFC)N/A
Compound microscope equipped with DP71 cameraOlympusAX70
Cytoseal XYL (xylene based mounting medium)Richard-Allan Scientific8312-4
EosinLeica3801601ready-to-use (no preparation needed)
EthanolCarolina86-1263
Expand Long Template PCR SystemRoche Applied Science, IN11681834001
Gateway BP Clonase II enzyme mixInvitrogen, CA11789-020
Gateway LR Clonase II enzyme mixInvitrogen, CA11791-100
Goat anti-Rb secondary antibody (Biotinylated)DakoE0432
Hematoxylin Solution, Harris ModifiedSigma Aldrich Chemical Company Inc. / SAFCHHS-32-1L
HRP Avidin DVectorA-2004
Hydrochloric AcidAqua Solutions4360-1L
Hydrogen Peroxide, 3%Fisher ScientificH324-500
I-SceI enzymeNew England Biolabs, MAR0694L
Kanamycin sulfateTeknova, Inc.K2150
Kimberly-Clark Professional Kimtech Science KimwipesFisher Scientific34133
Lithium CarbonateSigma Aldrich Chemical Company Inc. / SAFC554-13-2
Microtome for sectioningLeica BiosystemsRM2255
One Shot TOP10 Chemically Competent E. coliInvitrogenC404006
p3E-polyA Dr. Chi-Bin Chien, Univ. of UtahN/Aa generous gift
(Please refer to webpage http://tol2kit.genetics.utah.edu/index.php/Main_Page to obtain material, which is freely distrubted as described.)
Parafin waxSurgipath Paraplast39603002Parrafin to parafin
ParaformaldehydeAlfa AesarA11313
pDEST vector (modified destination vector containing I-SceI recognition sites)Dr. C. Grabher, Karlsruhe Institute of Technology, Karlsruhe, GermanyN/Aa generous gift
pDONR 221 gateway donor vectorThermo Fisher Scientific12536-017
pDONRP4-P1R donor vector Dr. Chi-Bin Chien, Univ. of UtahN/Aa generous gift
Phenol red, 0.5%Sigma Aldrich P0290
Phosphate Buffered Saline (PBS), 10XBioRad1610780
Picrosirrius red stain kitPolysciences24901-250
pME-mCherryAddgene26028
Proteinase K, recombinant, PCR GradeRoche21712520
QIAprep Spin MiniPrep KitQiagen27104
RDO Rapid DecalcifierApex EnginerringRDO04
Sodium Azide (NaN3)Sigma Aldrich26628-22-8
Stereo fluorescence microscopeLeicaMZ10F
Stereoscopic fluorescence microscope equipped with a digital sight DS-U1 camera for imagingNikonSMZ-1500
Taq DNA PolymeraseNew England Biolabs, MAM0273L
Tissue-Tek VIP® 6 AI Vacuum Infiltration ProcessorSakuraN/AModel #: VIP-6-A1
Tricaine-SWestern Chemical Incorporated20513
XyleneThermo Fisher ScientificX3P1GAL

References

  1. Veldman, M., Lin, S. Zebrafish as a developmental model organism for pediatric research. Pediatric Research. 64, 470-476 (2008).
  2. Feitsma, H., Cuppen, E. Zebrafish as a cancer model. Molecular Cancer Research. 6 (5), 694(2008).
  3. Ethcin, J., Kanki, J. P., Look, A. T. Zebrafish as a model for the study of human cancer. Methods in Cell Biology. 105, 309-337 (2010).
  4. Benjamin, D. C., Hynes, R. O. Intravital imaging of metastasis in adult Zebrafish. BMC Cancer. 17 (1), 660(2017).
  5. Kim, I. S., et al. Microenvironment-derived factors driving metastatic plasticity in melanoma. Nature Communications. 8, 14343(2017).
  6. Zhu, S., et al. Activated ALK collaborates with MYCN in neuroblastoma pathogenesis. Cancer Cell. 21 (3), 362-373 (2012).
  7. Maris, J. M., Hogarty, M. D., Bagatell, R., Cohn, S. L. Neuroblastoma. Lancet. 369 (9579), London, England. 2106-2120 (2007).
  8. Park, J. R., et al. Children's oncology group's 2013 blueprint for research: neuroblastoma. Pediatric Blood and Cancer. 60 (6), 985-993 (2013).
  9. Hoehner, J. C., et al. A developmental model of neuroblastoma: differentiating stroma-poor tumors' progress along an extra-adrenal chromaffin lineage. Laboratory Investigation: A Journal of Technical Methods and Pathology. 75 (5), 659-675 (1996).
  10. Tsubota, S., Kadomatsu, K. Origin and initiation mechanisms of neuroblastoma. Cell and Tissue Research. 372 (2), 211-221 (2018).
  11. Tolbert, V. P., Matthay, K. K. Neuroblastoma: Clinical and biological approach to risk stratification and treatment. Cell and Tissue Research. 372 (2), 195-209 (2018).
  12. Maris, J. M. Recent advances in neuroblastoma. New England Journal of Medicine. 362 (23), 2202-2211 (2010).
  13. Zhu, S., et al. LMO1 Synergizes with MYCN to promote neuroblastoma initiation and metastasis. Cancer Cell. 32, 310-323 (2017).
  14. Patton, E. E., Zon, L. I. The art and design of genetic screens: zebrafish. Nature Reviews Genetics. 2 (12), 956-966 (2001).
  15. Lieschke, G. J., Currie, P. D. Animal models of human disease: zebrafish swim into view. Nature Reviews Genetics. 8 (5), 353-367 (2007).
  16. Tao, T., et al. LIN28B regulates transcription and potentiates MYCN-induced neuroblastoma through binding to ZNF143 at target gene promotors. Proceedings of the National Academy of Sciences of the United States of America. 117 (28), 16516-16526 (2020).
  17. Ung, C. Y., Guo, F., Zhang, X., Zhu, Z., Zhu, S. Mosaic zebrafish transgenesis for functional genomic analysis of candidate cooperative genes in tumor pathogenesis. Journal of Visualized Experiments. (97), e52567(2015).
  18. Zhang, X., et al. Critical role for GAB2 in neuroblastoma pathogenesis through the promotion of SHP2/MYCN cooperation. Cell Reports. 18 (12), 2932-2942 (2017).
  19. Zimmerman, M. W., et al. MYC drives a subset of high-risk pediatric neuroblastomas and is activated through mechanisms including enhancer hijacking and focal enhancer amplification. Cancer Discovery. 8 (3), 320-335 (2018).
  20. Koach, J., et al. Drugging MYCN oncogenic signaling through the MYCN-PA2G4 binding interface. Cancer Research. 79 (21), 5652-5667 (2019).
  21. Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. Stages of embryonic development of the zebrafish. Developmental Dynamics. 203 (3), 253-310 (1995).
  22. DuBois, S. G., et al. Metastatic sites in stage IV and IVS neuroblastoma correlate with age, tumor biology, and survival. Journal of pediatric hematology/oncology. 21 (3), 181-189 (1999).
  23. Wattrus, S. J., Zon, L. I. Stem cell safe harbor: The hematopoietic stem cell niche in zebrafish. Blood Advances. 2 (21), 3063-3069 (2018).
  24. Menke, A. L., Spitsbergen, J. M., Wolterbeek, A. P., Woutersen, R. A. Normal anatomy and histology of the adult zebrafish. Toxicologic Pathology. 39 (5), 759-775 (2011).
  25. Renshaw, S. A., Trede, N. S. A model 450 million years in the making: Zebrafish and vertebrate immunity. Disease Models and Mechanisms. 5 (1), 38-47 (2012).
  26. Junqueira, L. C., Cossermelli, W., Brentani, R. Differential staining of collagens type I, II and III by Sirius Red and polarization microscopy. Archivum histologicum Japonicum (Nihon Soshikigaku Kiroku). 41 (3), 267-274 (1978).
  27. Sweat, F., Puchtler, H., Rosenthal, S. I. Sirius red F3BA as a stain for connective tissue. Archives of Pathology. 78, 69-72 (1964).
  28. Ignatius, M. S., Hayes, M., Langenau, D. M. In vivo imaging of cancer in zebrafish. Advances in Experimental Medicine and Biology. 916, 219-237 (2016).
  29. Howe, C. K., et al. The zebrafish reference genome sequence and its relationship to the human genome. Nature. 496 (7446), 498-503 (2013).
  30. Fazio, M., Ablain, J., Chuan, Y., Langenau, D. M., Zon, L. I. Zebrafish patient avatars in cancer biology and precision cancer therapy. Nature Reviews Cancer. 20 (5), 263-273 (2020).
  31. Yoganantharjah, P., Gibert, Y. The Use of the zebrafish model to aid in drug discovery and target validation. Current Topics in Medicinal Chemistry. 17 (18), 2041-2055 (2018).
  32. Ignatius, M. S., et al. In vivo imaging of tumor-propagating cells, regional tumor heterogeneity, and dynamic cell movements in embryonal rhabdomyosarcoma. Cancer Cell. 21 (5), 680-693 (2012).
  33. Stoletov, K., Montel, V., Lester, R. D., Gonias, S. L., Klemke, R. High-resolution imaging of the dynamic tumor cell vascular interface in transparent zebrafish. Proceedings of the National Academy of Sciences of the United States of America. 104 (44), 17406-17411 (2007).
  34. Ahmed, S., et al. Neuroblastoma with orbital metastasis: ophthalmic presentation and role of ophthalmologists. Eye. 20 (4), London, England. 466-470 (2006).
  35. Papaioannou, G., McHugh, K. Neuroblastoma in childhood: review and radiological findings. Cancer Imaging Society. 5 (1), 116-127 (2005).
  36. Langenau, D. M., et al. Co-injection strategies to modify radiation sensitivity and tumor initiation in transgenic Zebrafish. Oncogene. 27 (30), 4242-4248 (2008).
  37. Amores, A., et al. Zebrafish hox clusters and vertebrate genome evolution. Science. 282 (5394), New York, N.Y. 1711-1714 (1998).
  38. Postlethwait, J. H., et al. Vertebrate genome evolution and the zebrafish gene map. Nature Genetics. 18 (4), 345-349 (1998).
  39. Opazo, J. C., et al. Whole-genome duplication and the functional diversification of teleost fish hemoglobins. Molecular Biology and Evolution. 30 (1), 140-153 (2013).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Tumor DisseminationIn Vivo ImagingTransgenic ZebrafishMYCN OverexpressionLMO1 OverexpressionFluorescence MicroscopyTumor Cell MigrationDrug Screening