The protocol provides instruction for modifying RNA with dimethyl sulfate for mutational profiling experiments. It includes in vitro and in vivo probing with two alternative library preparation methods.
Method Article
The protocol provides instruction for modifying RNA with dimethyl sulfate for mutational profiling experiments. It includes in vitro and in vivo probing with two alternative library preparation methods.
The role of RNA structure in virtually any biological process has become increasingly evident, especially in the past decade. However, classical approaches to solving RNA structure, such as RNA crystallography or cryo-EM, have failed to keep up with the rapidly evolving field and the need for high-throughput solutions. Mutational profiling with sequencing using dimethyl sulfate (DMS) MaPseq is a sequencing-based approach to infer the RNA structure from a base's reactivity with DMS. DMS methylates the N1 nitrogen in adenosines and the N3 in cytosines at their Watson-Crick face when the base is unpaired. Reverse-transcribing the modified RNA with the thermostable group II intron reverse transcriptase (TGIRT-III) leads to the methylated bases being incorporated as mutations into the cDNA. When sequencing the resulting cDNA and mapping it back to a reference transcript, the relative mutation rates for each base are indicative of the base's "status" as paired or unpaired. Even though DMS reactivities have a high signal-to-noise ratio both in vitro and in cells, this method is sensitive to bias in the handling procedures. To reduce this bias, this paper provides a protocol for RNA treatment with DMS in cells and with in vitro transcribed RNA.
Since the discovery that RNA has both structural1,2 and catalytic3 properties, the importance of RNA and its regulatory function in a plethora of biological processes have been gradually uncovered. Indeed, the effect of RNA structure on gene regulation has gained increasing attention4. Like proteins, RNA has primary, secondary, and tertiary structures, referring to the sequence of nucleotides, the 2D mapping of base-pairing interactions, and the 3D folding of these base-paired structures, respectively. While determining the tertiary structure is key to understanding the exact mechanisms behind RNA-dependent processes, the secondary structure is also highly informative regarding RNA function and is the basis for further 3D folding5.
However, determining the RNA structure has been intrinsically challenging with conventional approaches. While for proteins, crystallography, nuclear magnetic resonance (NMR), and cryogenic electron microscopy (cryo-EM) have made it possible to determine the diversity of structural motifs, allowing for structure prediction from the sequence alone6, these approaches are not widely applicable to RNAs. Indeed, RNAs are flexible molecules with building blocks (nucleotides) that have much more conformational and rotational freedom in comparison to their amino acid counterparts. Furthermore, the interactions through base-pairing are more dynamic and versatile than those of amino acid residues. As a result, classical approaches have been successful only for relatively small RNAs with well-defined, highly compact structures7.
Another approach to determine the RNA structure is through chemical probing combined with next-generation sequencing (NGS). This strategy generates information about the binding status of each base in an RNA sequence (i.e., its secondary structure). In brief, the bases in an RNA molecule that are not engaging in base-pairing are differentially modified by small chemical compounds. Reverse-transcribing these RNAs with specialized reverse transcriptases (RTs) incorporates the modifications into complementary deoxyribonucleic acid (cDNA) as mutations. These cDNA molecules are then amplified by the polymerase chain reaction (PCR) and sequenced. To obtain information about their "status" as bound or unbound, the mutation frequencies at each base in an RNA of interest are calculated and entered into structure prediction software as constraints8. Based on nearest neighbor rules9 and minimum free energy calculations10, this software generates structure models that best fit the obtained experimental data11,12.
DMS-MaPseq uses DMS, which methylates the N1 nitrogen in adenosines and N3 nitrogen in cytosines at their Watson-Crick face in a highly specific manner13. Using thermostable group II intron reverse transcriptase (TGIRT-III) in reverse transcription creates mutational profiles with unprecedented signal-to-noise ratios, even allowing for the deconvolution of overlapping profiles generated by two or more alternative conformations14,15. Furthermore, DMS can penetrate cell membranes and whole tissues, making probing within physiological contexts possible. However, the generation of good-quality data is challenging, as variations in the handling procedure can impact the results. Therefore, we provide a detailed protocol for both in vitro and in-cell DMS-MaPseq to reduce bias and guide newcomers to the method through the difficulties they may encounter. Especially in light of the recent SARS-CoV2 pandemic, high-quality data on RNA viruses is an important tool for studying gene expression and finding possible therapeutics.
NOTE: See the Table of Materials for details related to all the materials, software, reagents, instruments, and cells used in this protocol.
1. Gene-specific in vitro DMS-MaP

Figure 1: Experimental setup for the RT-PCR of large DMS-treated fragments. When performing reverse transcription on a modified RNA, the modifications on the sequence that the primer anneals to will not be recorded. Thus, when the fragments exceed 400-500 bp in length, fragments overlapping in the primer regions need to be designed, as exemplified here. The length of the fragments depends on the sequencing needs. When using paired-end 150 cycle sequencing, the fragments should not exceed 300 bp. Abbreviations: RT-PCR = reverse transcription polymerase chain reaction; DMS = dimethyl sulfate. Please click here to view a larger version of this figure.
2. Whole-genome DMS-MaP using virus-infected cells
NOTE: In cells, DMS treatment can also be combined with the gene-specific amplification approach described above. The whole-genome library requires enormous sequencing depth to achieve full coverage on a single gene. However, if viral RNAs make up a significant fraction of the ribodepleted RNA after extraction, whole-genome sequencing would be appropriate. Furthermore, other enrichment methods can be combined with the whole-genome library generation method.
NOTE: Uninfected cells were used for demonstration purposes in the video protocol.
3. Analysis of the sequencing data
NOTE: To create RNA secondary structure models from the DMS-MaP sequencing data, the resulting .fastq files must be processed by several different steps. These steps can be automatically performed using the
Gene-specific in vitro DMS-MaP
To study the 5'UTR of SARS2, the virus' first 300 bp were ordered as a gBlock sequence, alongside three primers. Those included two primers to propagate the fragment ("FW" & "RV") via PCR, as well as one to attach the T7 promotor ("FW-T7"). These sequences can be seen in Table 1.
| Name | Sequence (5’->3’) |
| FW | ATTAAAGGTTTATACCTTCCCAGGTAAC |
| RV | GCAAACTGAGTTGGACGTGT |
| FW-T7 | TAATACGACTCACTATAGG ATTAAAGGTTTATACCTTCCCAGGTAAC |
Table 1: Primer sequence for DMS-MaP RT-PCR of SARS-CoV2 5'UTR. Here, FW-T7 and RV are needed to generate a DNA template for in vitro transcription, the RV is used in the reverse transcription and the FW-RV primer-pair is used in the subsequent PCR amplification of the cDNA. The primers anneal to the very beginning of the SARS-CoV2 genome (FW) and the sequence right downstream of the region of interest. Abbreviations: DMS-MaP = Mutational profiling with sequencing using dimethyl sulfate; RT-PCR = reverse transcription polymerase chain reaction; SARS-CoV2 = severe acute respiratory syndrome-coronavirus 2; UTR = untranslated region; RV = reverse primer; FW = forward primer.
To generate RNA from the gBlock fragment, the sequence of the T7 polymerase promotor was attached using overlap PCR using the PCR premix according to the scheme seen in Figure 2A. From the elongated fragment, RNA was generated using the T7 Transcription Kit. The DNA template was subsequently digested using the DNase and RNA isolated using RNA Clean & Concentrator columns.
Quality control of the in vitro transcription was done by running the RNA product on a 1% agarose gel alongside an ssRNA ladder. As there was only one band visible, in vitro DMS probing and RT-PCR were performed (see Figure 2B).
To verify the success of the PCR reaction, the sample was run on a 2% agarose gel using a dsDNA ladder. After indexing, the band should run ~150 bp higher on the same gel, accounting for the size of the indexing primers.

Figure 2: In vitro transcription of the DNA template. (A)To in vitro transcribe a DNA template that does not yet have an intrinsic RNA polymerase promotor, the template must be attached by overlap PCR first. This is done by using a forward primer, which includes the sequence TAATACGACTCACTATAGG (in the case of the T7 RNA polymerase) upstream of the first bases overlapping with the desired fragment. The underlined base here symbolizes the transcription start site of the polymerase. Once the promoter has attached to the dsDNA fragment, it can be transcribed by the T7 polymerase. Importantly, the polymerase uses the strand opposed to the mentioned promoter sequence as the template (blue), effectively creating RNA identical to the sequence immediately downstream of the indicated promoter sequence (red). (B) A 1% agarose gel with an ssRNA Ladder (lane 1) and the in vitro transcribed RNA product at 300 nt (lane 2). (C) A 2% agarose gel with GeneRuler 1 kb plus Ladder (lane 1), the PCR product after RT-PCR running at 300 bp (lane 2), and the indexed fragment after library preparation running at 470 bp (lane 3). Abbreviations: RT-PCR = reverse transcription polymerase chain reaction; DMS = dimethyl sulfate; nt = nucleotides; dsDNA = double-stranded DNA; ssRNA = single-stranded RNA. Please click here to view a larger version of this figure.
Whole-genome in vivo DMS-MaP using virus-infected cells
Prior to the DMS treatment, the HCT-8 cells were infected with OC43. When a cytopathic effect (CPE) was observed 4 days post infection (dpi) (as seen in Figure 3A), these cells were treated, and the RNA was extracted and ribodepleted. When running the total RNA on an agarose gel, two bright bands were visible, accounting for the 40S and 60S subunits of the ribosome, which make up approximately 95% of total RNA mass (see Figure 3B). When RNA extraction was unsuccessful or was degraded (e.g., by multiple freeze-thaw cycles), the RNA degradation products were visible on the bottom of the gel (see Figure 3C, second lane). Furthermore, after rRNA depletion, the two bright bands disappeared, leaving a smear in the lane (see Figure 3C, third lane). Finally, after library preparation, the samples had varying size distributions and were shown as a smear on the final PAGE gel. The band was excised between 200 nucleotides (nt) and 500 nt, in agreement with the 150 x 150 paired-end sequencing run planned to analyze these libraries. Most importantly, the adaptor dimers running at ~150 nt were separated out (see Figure 3D).

Figure 3: Checkpoints of in vivo DMS-MaP with virus-infected cells. (A) Light microscopy image of virus-infected HCT-8 cells, 4 days dpi. To obtain the highest possible yield of viral RNA from the total RNA while minimizing the adverse effects due to cell death, DMS should be added when CPE starts or even before that, as seen in the image. (B) A 1% agarose gel with six samples of 1 µg of total RNA. In each lane, two bright bands, accounting for the 40S and 60S subunits, are visible, as ribosomal RNA makes up ~95% of total RNA. Note: In-cell DMS treatment causes some RNA fragmentation and smearing, but the two rRNA bands should still be visible. Mild fragmentation post modification is tolerated because the information containing the methylation mark is generated and reports on the RNA structure during the DMS incubation while the cells are still alive. (C) A 1% Agarose gel of GeneRuler 1 kb plus ladder DNA marker (lane 1) total RNA previously stored at −80 °C for 6 months (lane 2) and ribodepleted RNA (lane 3). When storing RNA for a long time with several freeze-thaw cycles, the RNA starts degrading and possibly should not be used for probing experiments. Furthermore, after ribodepleting the total RNA, the two bright bands, accounting for the 40S and 60S subunits of the ribosome, fade, and a smear of the residual RNAs starts to show. (D) A PAGE gel of GeneRuler 1 kb plus ladder DNA marker (lane 1) and a library sample of whole-genome prepared RNA. The gel should be excised based on the sequencing needs. For a paired-end sequencing run spanning 150 cycles from both sides, the gel should be excised between 300 bp and 500 bp. Adaptor dimers (running at 170 bp) should be separated out. Abbreviations: DMS-MaP = Mutational profiling with sequencing using dimethyl sulfate; dpi = days post infection; CPE = cytopathic effect. Please click here to view a larger version of this figure.
After sequencing, the .fastq files were analyzed by submitting a job to the DREEM webserver (http://rnadreem.org/), together with a .fasta reference file. The output generated by the server includes quality control files generated by fastqc (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) and TrimGalore (https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/), as well as other output files containing the population average mutation frequencies. Apart from the diagram showing the mutation frequencies with an interactive .html (see Figure 4A) format and a .csv file with the raw reactivites per base and a struct_constraint.txt file, readable by several RNA structure prediction software, this also includes a bitvector.txt file reporting on the by-read mutations. From these, the population average structures were calculated by submitting the .fasta and struct_constraint.txt files to the RNAfold webserver (http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi). This uses the ViennaRNA software to generate structure predictions based on the minimum free energy, which can be viewed online or downloaded in ct or Vienna format. To generate RNA structure models, these downloadable files were submitted to VARNA (https://varna.lri.fr/, see Figure 4B). Lastly, bitvector.txt files can be used by the stable version of DREEM (https://codeocean.com/capsule/6175523/tree/v1) to search for alternative RNA conformations. To obtain good structure models using DREEM, a coverage of 10,000 reads per base should be achieved; for clustering, up to 100,000 reads per base might be required. An overview of the whole workflow can be found in Figure 4C.

Figure 4: Exemplary data obtained from chemical probing experiments of the SARS-CoV2 5'UTR. (A) Reactivity profile of the first 300 bases of the SARS-CoV2 genome colored by base (A: red, C: blue, U: green, G: yellow). The raw reactivities are calculated as the absolute mutation frequency divided by the coverage. Bases with open conformation have high reactivity values; bases engaging in base-pairing have low reactivity values. U and G are not modified by DMS and have low reactivity values, originating from polymerase infidelity. The predictions were made with the DREEM webserver. (B) Structure model of the SARS-CoV2 5'UTR predicted from reactivity values made with VARNA. Bases with high reactivity values are colored in red; bases with low reactivity values are colored in white. (C) Workflow of the DMS-MaP analysis starting with the .fastq files obtained from sequencing. These can be quality-controlled using fastqc; the adaptor sequences are trimmed using TrimGalore and then mapped back to a reference sequence using Bowtie2. From the obtained .bam files, DREEM counts the mutations in each read, creating a mutation map or .bitvector.txt file. These report the mutations of each read in a position-dependent way, based on which the population average reactivity profiles can be created. Alternatively, bitvectors can be clustered using DREEM to search for alternative RNA conformations. Lastly, the obtained structure models are visualized using software (e.g., VARNA). Abbreviations: DMS-MaP = Mutational profiling with sequencing using dimethyl sulfate; SARS-CoV2 = severe acute respiratory syndrome-coronavirus 2. Please click here to view a larger version of this figure.
The protocol here describes how to probe RNA in vitro and in cells using DMS mutational profiling experiments. Furthermore, it gives instructions on how to prepare libraries for Illumina sequencing to generate gene-specific data and analyze the obtained .fastq files. Additionally, genome-wide library approaches can be used. However, gene-specific RT-PCR produces the highest quality and most robust data. Therefore, if comparing between samples, it is important to ensure that they are prepared with identical sequencing strategies, as the library generation causes some bias. The reproducibility should always be measured by using replicates.
Several precautions
RNA is an unstable molecule that is sensitive to degradation both through elevated temperatures and by RNases. Therefore, special measures — the use of personal protective equipment (PPE), RNAse-free material, and RNAse inhibitors — is recommended. Most importantly, RNA should be kept on ice whenever possible. This especially applies to methylated RNA, which is even more sensitive to high temperatures.
It is important to confirm that the RNA structure of interest is not sensitive to the DMS concentration and buffer conditions. Buffers such as 100 mM Tris, 100 mM MOPS, and 100 mM HEPES at pH 7-7.5 give a high signal but may not be sufficient to maintain the pH during the reaction21. As DMS hydrolyzes in water, which decreases the pH, a strong buffer is critical to maintain a neutral pH during the modification reaction. The addition of bicine has been shown to help maintain the pH as slightly basic21 but results in low DMS modification on Gs and Us, which could be informative but should be analyzed separately due to the production of a much lower signal than As and Cs and is not discussed further in this protocol.
In gene-specific RT-PCR, the modified RNA is reverse-transcribed into the DNA and amplified in fragments by PCR. While the size of the RNA can theoretically be unlimited, these PCR fragments should not exceed a length of 400-500 base pairs (bp) to prevent bias during the reverse transcription reaction. Ideally, the fragments should be within the scope of the sequencing run (i.e., if sequencing is conducted using a 150 x 150 cycle paired-end sequencing program, a single fragment should not exceed 300 bp). When using sequencing programs with fewer cycles, the PCR products can be fragmented using a dsDNase. Furthermore, as sequences within the primer sequences do not hold any structural information, the fragments must overlap when the probed RNA comprises >1 fragment. RT reactions can contain multiple RT primers for different fragments (up to 10 different RT primers). Depending on the sequences, pooling the RT primers can make the reverse transcription less efficient but typically works well. Each PCR reaction should be conducted separately.
When probing RNA with DMS, the experimental conditions play an additional role, as many RNAs are thermodynamically unstable and change their conformation based on environmental factors such as temperature. To avoid irregularities, the experimental conditions should be kept as constant as possible, also with respect to reaction times. The buffer conditions seem to be exchangeable to a certain degree17,20,22,23 when the basic conditions are maintained — the buffering capacity and presence of monovalent (Na) and divalent ions (Mg) — to ensure proper folding of RNA24.
With respect to the library preparation of modified RNAs, several aspects must be taken into consideration. First, as mentioned before, modified RNAs are less stable than their unmodified counterparts, meaning they might require the optimization of the fragmentation times for optimal fragment size distribution. Furthermore, certain RNA library preparation kits, as well as many other RNAseq approaches, use random primers in the reverse transcription kit. This might lead to lower coverage of the reference, especially in the 3' of a gene, and, ultimately, to insufficient coverage depth. If the coverage of a certain region is too low, it might be necessary to remove those bases from the structure prediction. Apart from RT-PCR and whole-genome RNAseq kits, other library preparation approaches can be used. Protocols that include the ligation of 3' and/or 5' adaptors to the RNA are advantageous when using small fragments of RNA or when the loss of probing information in the primer regions must be avoided.
Lastly, the analysis of the chemical probing experiments must always be interpreted carefully. Currently, there is no software that predicts the RNA structure of any RNA from the sequence alone with high accuracy. Although chemical probing constraints greatly improve the accuracy, generating good models for long RNAs (>500 nt) is still challenging. These models should be further tested by other approaches and/or mutagenesis. RNA prediction software optimizes for the maximum number of base pairs, thus significantly penalizing open conformations, which may not accurately represent RNA folding5. Thus, the obtained structure model should be tested by quantifying the prediction agreement with the underlying chemical probing data (e.g., by AUROC) and between replicates (e.g., by mFMI), as exemplified by Lan et al.20.
Ideally, several experiments in different systems to challenge the obtained structure model should be used to strengthen one's hypothesis. These can include the usage of in vitro and in-cell approaches, compensatory mutations, and different cell lines and species. Moreover, raw reactivities are often just as or even more informative than structure predictions, as they record the "ground truth" snapshot of the RNA folding ensemble. As such, raw reactivities are very suitable and informative for comparing structure changes between different conditions. Importantly, the lowest free energy structures calculated using chemical probing constraints with computational prediction should only be used as a starting hypothesis toward a complete structure model.
The authors have no conflicts of interest to declare.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 1 Kb Plus DNA Ladder | 10787018 | Thermo | |
| 2-mercaptoethanol | M6250-250ML | Sigma | |
| Acid-Phenol:Chloroform, pH 4.5 | AM9720 | Thermo | |
| Advantage PCR | 639206 | Takara | |
| CloneAmp HiFi PCR Premix | 639298 | Takara | |
| DMS | D186309 | Sigma | |
| dNTPs 10 mM each | U151B | Promega | |
| E-Gel EX Agarose Gels, 2% | G402022 | Thermo | precast agarose gels |
| Ethanol (200 proof) | E7023-4X4L | Sigma | |
| Falcon tubes, 15 mL, 50 mL | |||
| GlycoBlue | co-precipitant | ||
| HCT-8 cells | ATCC #CCL-244 | ||
| Invitrogen MgCl2 (1 M) | AM9530G | fisherscientific | |
| Isopropanol | 278475 | Sigma | |
| Megascript T7 transcription | AM1334 | Thermo | |
| NanoDrop spectrophotometer | |||
| Novex TBE Gels, 8%, 10 well | EC6215BOX | Thermo | |
| OC43 | ATCC #VR-1558 | ||
| RiboRuler Low Range RNA Ladder | SM1831 | Thermo | |
| RNAse H | M0297L | NEB | |
| Sodium Cacodylate, 0.4 M, pH 7.2 | 102090-964 | VWR | |
| Sodium hydroxide solution | S8263-150ML | Sigma | |
| SuperScript II Reverse Transcriptase for FSB and DTT | 18064014 | Thermo | |
| TGIRT-III Enzyme | TGIRT50 | Ingex | |
| The Oligo Clean & Concentrator | D4060 | Genesee | |
| The RNA Clean & Concentrator kits are RNA clean up kits | R1016 | Genesee | |
| TRIzol Reagents | 15596018 | Thermo | RNA isolation reagent |
| Water, (For RNA Work) (DEPC-Treated, DNASE, RNASE free/Mol. Biol.) | BP561-1 | fisherscientific | |
| xGen Broad-range RNA Library Prep 16rxn | 10009865 | IDT | |
| Zymo RNA clean and concentrator columns |