Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
JoVE Journal Immunology and Infection

Immunology and Infection

Enrichment of Native and Recombinant Extracellular Vesicles of Mycobacteria

Published: December 8, 2023 doi: 10.3791/65138
Automatic Translation
1, 1, 1,2, 1,3, 1, 1, 1, 1,4, 1, 1
1Bacterial Pathogenesis Laboratory, Infectious Diseases and Immunology Group, Translational Health Science and Technology Institute, NCR Biotech Science Cluster, 2Clinical Microbiology Division, CSIR-Indian Institute of Integrative Medicine, 3ICAR-Research Complex for Eastern Region, 4Public Health Research Institute, Rutgers University

ERRATUM NOTICE

Summary

This protocol details the enrichment of native mycobacterial extracellular vesicles (mEVs) from axenic cultures of Mycobacterium smegmatis (Msm) and how mCherry (a red fluorescent reporter)-containing recombinant MsmEVs can be designed and enriched. Lastly, it verifies the novel approach with the enrichment of MsmEVs containing the EsxA protein of Mycobacterium tuberculosis.

Abstract

Most bacteria, including mycobacteria, generate extracellular vesicles (EVs). Since bacterial EVs (bEVs) contain a subset of cellular components, including metabolites, lipids, proteins, and nucleic acids, several groups have evaluated either the native or recombinant versions of bEVs for their protective potency as subunit vaccine candidates. Unlike native EVs, recombinant EVs are molecularly engineered to contain one or more immunogens of interest. Over the last decade, different groups have explored diverse approaches for generating recombinant bEVs. However, here, we report the design, construction, and enrichment of recombinant mycobacterial EVs (mEVs) in mycobacteria. Towards that, we use Mycobacterium smegmatis (Msm), an avirulent soil mycobacterium as the model system. We first describe the generation and enrichment of native EVs of Msm. Then, we describe the design and construction of recombinant mEVs that contain either mCherry, a red fluorescent reporter protein, or EsxA (Esat-6), a prominent immunogen of Mycobacterium tuberculosis. We achieve this by separately fusing mCherry and EsxA N-termini with the C-terminus of a small Msm protein Cfp-29. Cfp-29 is one of the few abundantly present proteins of MsmEVs. The protocol to generate and enrich recombinant mEVs from Msm remains identical to the generation and enrichment of native EVs of Msm.

Introduction

Despite the development and administration of a wide range of vaccines against infectious diseases, even to this day, ~30% of all human deaths still occur from communicable diseases1. Before the advent of the Tuberculosis (TB) vaccine - Bacillus Calmette Guerin (BCG) - TB was the number one killer (~10,000 to 15,000/100,000 population)2. With the administration of BCG and easy access to first and second-line anti-TB drugs, by 2022, TB-related deaths have dramatically dropped to ~1 million/year by 2022 (i.e., ~15-20/100,000 population1). However, in TB endemic populations of the world, TB-related deaths continue to stand at ~100-550/100,000 population1. While experts recognize several reasons leading to these skewed numbers, BCG-mediated protection not lasting for even the first decade of life appears to be the prominent reason3,4,5,6,7. Consequently, given the renewed 'Sustainable Development Goals' of the UN and the 'End TB Strategy', of WHO, there is a concerted global effort to develop a much superior vaccine alternative to BCG that perhaps provides lifelong protection from TB.

Towards that objective, several groups are currently evaluating modified/recombinant BCG strains, non-pathogenic and attenuated mycobacterial species other than BCG, and subunit candidates8,9,10,11,12,13,14,15,16,17,18. Typically, subunit vaccines are liposomes selectively loaded with few purified (~1-6) full-length or truncated immunogenic proteins of the pathogen. However, because of their spurious folding into non-native conformations and/or random non-functional interactions between the loaded proteins, subunits often lack native and germane epitopes and hence, fail to sufficiently prime the immune system14,19,20.

Consequently, extracellular vesicles (EVs) of bacteria have picked up pace as a promising alternative21,22,23,24,25,26. Typically, bacterial EVs (bEVs) contain a subset of their cellular components, including some portions of nucleic acids, lipids, and hundreds of metabolites and proteins27,28. Unlike liposomes where a few purified proteins are artificially loaded, bEVs contain hundreds of naturally-loaded, natively-folded proteins with a better propensity to prime the immune system, especially without the boost/aid of adjuvants and Toll-like receptor (TLR) agonists27,28,29. It is in this line of research that we and others have explored the utility of mycobacterial EVs as potential subunit boosters to BCG30. Despite concerns that bEVs lack uniform antigen loads, EVs from attenuated Neisseria meningitidis have successfully protected humans against serogroup B meningococcus31,32.

At least theoretically, the best EVs that could boost BCG well are the EVs enriched from pathogenic bacteria. However, enriching EVs generated by pathogenic mycobacterium is expensive, time-consuming, and risky. Additionally, pathogen-generated EVs may be more virulent than protective. Given the potential risks, here, we report a well-tested protocol for the enrichment of EVs generated by axenically grown Msm, an avirulent mycobacterium.

However, despite encoding several pathogen protein orthologs, avirulent mycobacteria lack several vaccine antigens/pathogenic protein epitopes necessary to sufficiently prime the immune system towards protection33. Therefore, we also explored constructing and enriching recombinant EVs of Msm through molecular engineering, such that a significant portion of any pathogenic protein of interest expressed and translated in Msm, must reach its EVs. We hypothesized that one or more of the top 10 abundant proteins of Msm EVs when fused to the protein of interest will aid in such translocation.

While we were beginning to standardize the enrichment of mycobacterial EVs (mEVs) in our laboratory, in 2011, Prados-Rosales et al. first reported the visualization and enrichment of mEVs in vitro30. Later, in 2014, the same group published a modified version of their 2011 method34. In 2015, Lee et al. also reported an independently standardized method for mEV enrichment again from axenic cultures of mycobacteria35. Combining both protocols34,35 and incorporating a few of our modifications after thorough standardization, we describe here a protocol that helps routinely enrich mEVs from axenic cultures of mycobacteria36.

Here, we particularly detail the enrichment of Msm-specific EVs, which is an extension of a published protocol36 for the enrichment of mycobacterial EVs in general. We also detail how to construct recombinant mEVs (R-mEVs) that contain the mCherry protein (as a red fluorescent reporter) and EsxA (Esat-6)37,38,39 a predominant immunogen and a potential subunit vaccinogen of Mycobacterium tuberculosis. The protocol for enriching the R-mEVs remains identical to the one we have described for enriching native EVs from Msm.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Growth conditions of Mycobacterium smegmatis, Escherichia coli, and their derivatives

  1. Media
    1. Middlebrook 7H9 liquid broth
      1. Prepare 20% Tween-80 stock solution by pre-warming the required volume of double-distilled water (ddw) in a glass beaker to ~45-50 oC in a microwave, add the required volume of Tween-80 using an appropriate measuring cylinder, and stir continuously on a small magnetic stirrer to bring the 20% Tween-80 into uniform solution. Filter the 20% Tween-80 through a 0.22 um disposal filter and store the pale yellow stock solution at 4 oC.
        NOTE: All traces of Tween-80 in the measuring cylinder must be transferred into the beaker for accurate final concentration. Do not autoclave the prepared Tween-80 stock. Filter (use 0.22 µM) sterilize and store at 4 oC.
      2. Follow the manufacturer's instructions for the preparation of the 7H9 broth. Suspend 4.7 g of 7H9 powder in 900 mL of ddw. Add 2 mL of glycerol, mix the contents, and autoclave at 121 oC, 15 psi for 20 min.
        NOTE: Do not add Middlebrook ADC enrichment (ADC) and Tween-80 before autoclaving.
      3. After the autoclaved media cools to room temperature (RT, i.e.,~25 oC), in a standard A2-type biosafety cabinet, aseptically add 10x stock of 100 mL of ADC (final 1x) and 2.5 mL (final 0.05%) of 20% Tween-80. Filter the mixture through a 0.22 µm disposable filter unit and store the very light yellowish green, transparent stock solution at 4 oC.
        NOTE: The pH of the media must be ~6.6 to 6.8 (if <6.4 or >7.0, discard and make fresh). Store at 4 oC (stable for 3-4 weeks). Filtering the 7H9 media (after the addition of ADC and Tween-80) twice through two independent 0.22 µm disposable filter units is highly recommended.
    2. Sauton's (minimal media) liquid broth
      1. Dissolve L-asparagine (0.4% w/v) and citric acid (0.2% w/v) in 950 mL of ddw. Add 1 mL each of freshly prepared 1,000x stocks (in ddw) of dibasic potassium phosphate (colorless; stock 10 g/20 mL; final 1x 0.5 g/L); magnesium sulfate heptahydrate (colorless; stock 10 g/20 mL; final 1x 0.5 g/L); and ferric ammonium citrate (very light brown; stock 1.6 g/40 mL; final 1x 0.04 g/L) and stir well on a magnetic stirrer.
        NOTE: At best, the 1,000x stocks can be 2 weeks old; if older than that, prepare fresh stocks; store them at RT in the dark (e.g., inside a cabinet/shelf). If the ferric ammonium citrate is dark brown, discard it and make it fresh. It is best to add the three salts in the order mentioned in step 1.1.2.1. Swirl the solution every time before adding each salt solution.
      2. Measure and note the pH using a pH meter; ensure it is around 3.1 to 3.2. If the pH is more than 3.7, discard the stocks and prepare fresh. To adjust the pH to 7.4, use as many drops of 10 N sodium hydroxide as required. Monitor the final pH while continuously stirring the solution/media on a magnetic stirrer.
      3. Add 4.76 mL of glycerol, 0.25 mL of 20% Tween-80 (final 0.005%, also see note for step 2.2.1.3), and only then, make up the volume to 1 L. Then, filter-sterilize twice the 1 L of medium with two separate 0.22 µm disposal filters. Store the clear, colorless medium at 4 oC (stable for 2 weeks).
        NOTE: Only after the pH is adjusted to 7.4, add glycerol. Otherwise, the media will turn cloudy white. If cloudy, discard it (do not try heating it) and prepare it fresh. For all mEVs preparations, use freshly prepared Sauton's.
    3. Middlebrook 7H11 agar base
      1. Follow the manufacturer's instructions for preparation. Suspend 19 g of 7H11 powder in 900 mL of ddw. Add 5 mL of glycerol, swirl on a magnetic stirrer to obtain a uniform suspension (pale green; pH 6.6 to 6.8; if >7.2, discard and prepare fresh), and autoclave at 121 oC, 15 psi, and for 20 min.
        NOTE: Do not add ADC and 0.05% Tween-80 before autoclaving.
      2. When the medium cools to ~50 oC, aseptically in an A2 type biosafety cabinet, add 100 mL of ADC (brought to RT) and 2.5 mL of 20% (final 0.05%) Tween-80 (brought to RT). Immediately dispense aseptically into Petri dishes.
        NOTE: Plates are stable at 4 oC for at least 4-6 weeks. Make sure the plates are at RT overnight before wrapping the plates up for 4 oC storage. Otherwise, moisture will get trapped in the plates during the incubation at 37 oC.
    4. Miller Luria Bertani (LB) broth and Agar base
      1. Follow the manufacturer's instructions for preparation. To prepare LB Broth, suspend 25 g of powder in 1,000 mL of ddw and gently stir for 5 min in a glass beaker on a magnetic stirrer. Upon uniform suspension, aliquot the required volumes into media bottles (e.g., 300 mL in a 500 mL media bottle) and autoclave. To prepare LB Agar, suspend 40 g of powder in 1,000 mL of ddw and autoclave (12 g of powder in 300 mL ddw in a 500 mL glass media bottle).
  2. Growth conditions
    NOTE: All steps of bacterial culture work must be performed in a biosafety cabinet (A2 type). All cultures must be processed with sterile tubes, flasks, and pipette tips.
    1. Day 1
      1. Add 1 mL each of glycerol stock of Msm (from -80 oC freezer) to 2 x 10 mL (in 50 mL sterile conical centrifuged tubes) of freshly autoclaved, cooled, and prewarmed (~37 oC) 7H9 broth, swirl thrice, close the lids, and incubate the tubes overnight at 37 oC and 200-220 rpm (incubator shaker).
        NOTE: To grow Mycobacterium tuberculosis (Mtb), follow similar steps but incubate the 50 mL tubes for 4-6 days at 37 oC and 120-150 rpm (incubator shaker) in BSL3 settings. Follow ALL international guidelines and biosafety practices of BSL3 and Risk Group 3 pathogens while handling and discarding Mtb and its cultures. Use B2 type biosafety cabinet for handling Mtb and its cultures.
    2. Day 2
      1. When OD600 (A600nm; cell densitometer) reaches ~1.0, centrifuge the Msm cultures for 10 min at 3,200 × g and RT (benchtop centrifuge). Discard the supernatants using sterile 1 mL pipette tips.
        NOTE: The above step remains the same for Mtb cultures, except that the number of days are 4-7. Be sure to not touch the bacterial pellet with the pipette tip.
      2. Wash: To each Msm pellet, add 1 mL of prewarmed Sauton's (at RT) media (step 1.1.2) and gently resuspend with 1 mL pipette tips to obtain a uniform suspension. Using sterile pipette tips, make up the volumes to 10 mL (in each) with the same media. Centrifuge the suspensions for 10 min at 3,200 × g and RT and discard the supernatants. Repeat this step once more.
        NOTE: The above step remains the same for Mtb cultures.
      3. Resuspend the twice-washed Msm cells in 20 mL (each) of prewarmed Sauton's (prewarmed in a plate or shaker incubator) and measure the optical density of the cells at 600 nm. Inoculate the required volume of Msm cultures into sterile 1 L Erlenmeyer flasks containing ~330 mL of sterile Sauton's such that the final OD600 is ~0.05.
        NOTE: Resuspensions must always begin in a small volume. If the final volume is directly added to the pellet as a single step, cells will remain as diffused pellets (an indicator of poor resuspension). The only way to resolve the issue is to spin the cultures down and redo the resuspension as recommended. The above step remains the same for Mtb cultures.
    3. Day 2/3
      1. Incubate the 330 mL culture in the incubator shaker at 200 rpm and 37 oC until the culture OD600 reaches ~0.3. Then, wash the cells once (similar to step 1.2.2.2 but with equal volume) and then, resuspend the pellet in the same volume. Distribute 50 mL of the resuspended cultures each into six sterile 1 L sterile Erlenmeyer flasks, each containing 280 mL of sterile prewarmed Sauton's with 1/10th of normally used (0.05%) Tween-80 i.e. 0.005% (also see note of step 2.2.1.3. to understand why 1/10th). The final OD600 must be approx. 0.05.
        NOTE: For Mtb cultures, Instead of Erlenmeyer flasks, use roller bottles (of 1/2/4 L capacity). Adjust the culture volume per bottle such that when kept on the roller apparatus, the culture does not reach the mouth of the bottle. The actual volume in the roller bottle will depend upon the capacity of the roller bottle.
      2. Incubate each of the 330 mL cultures in the incubator shaker at 200 rpm and 37 oC until OD600 reaches 2.0 to 2.5 (~15-18 h).
        ​NOTE: For Mtb cultures, ensure that the final OD600 is ~1.0-1.2 (takes ~5-8 days).

2. Enrichment of Msm mEVs by employing density gradient centrifugation

  1. Day 4
    1. Centrifuge the ~2 L of mid-exponential stage Msm cultures in 6 x 400 mL sterile centrifuge bottles at 4 oC for 20 min at ~8,000 × g (floor model centrifuge). Collect the spent media/culture supernatant in two pre-chilled, autoclaved 1 L Erlenmeyer flasks and store an aliquot of the pellet for any analytical procedures (such as SDS-PAGE and western blotting-not detailed here).
      NOTE: All subsequent steps must be performed in cold (~ 4 °C) to better maintain the integrity of the mEVs. The mEVs are quite stable at RT but refrigeration is a must for long-term stability (repeated freezing and thawing are not recommended). During axenic culture growth, mEVs disassociate from the surface of Msm/Mtb and accumulate in the culture supernatant/spent media.
    2. Filter the Msm culture supernatant first through the 0.45 µm disposal filter unit(s) and then, through the 0.22 µm disposal filter unit(s) to remove all traces of bacteria.
      NOTE: Direct filtration through the 0.22 µm filters often chokes the filter units (as the bacterial pellet may get disturbed while performing step 2.1.1.). To generate Mtb culture supernatants, carry out three filtrations of Mtb cultures (i.e., first filtration step with a 0.45 µm disposable filter unit; two consecutive filtration steps with 0.22 µm disposable filter units) before moving the culture filtrates into BSL-2 settings.
  2. Day 4/5
    1. Use the 30 kDa membrane concentrators to concentrate the Msm culture filtrate (~2 L) down to ~ 38 mL by centrifuging the culture filtrate at 4 oC, 20 min and at 3,200 × g.
      1. Prewash the concentrators first with sterile, cold ddw (~15 mL) (wash at 4 oC, 5 min, and at 3,200 × g).
      2. Wash with ~15 mL of prefiltered, cold Sauton's (same conditions as for water (2.2.1.1.)) to remove all traces of chemicals (used during manufacturing).
      3. Since ~130 centricons (if one use only) are technically required to concentrate ~2 L of culture filtrate, reuse the centricons at least 3-4 times if necessary. Follow these steps: concentrate 15 mL to 0.5 to 1.0 mL (follow step 2.2.1), transfer the concentrate to a clean, autoclaved, and cold 38 mL ultracentrifuge tube, and then re-transfer the remaining unconcentrated culture filtrate to the used centricons for repeat concentration.
        NOTE: Using 24, 30 kDa concentrators to concentrate 2 L of culture filtrate will take up to 6 h. Upon concentrating the culture filtrate, the Tween-80 also gets concentrated and can block the concentrator. Using Tween-80 to 0.005% final (rather than 0.05%) in Sauton's media helps to prevent this blockage. The reduced concentration of Tween-80 does not affect the uniform suspension of Msm during growth and does not cause clumping of Msm cells. However, as Mtb cells do clump at 0.005% Tween-80, use 0.05% Tween-80 for Mtb-specific EVs.
    2. Transfer the concentrated Msm culture filtrate (~38 mL) into a clean, washed (with ddw) and pre-chilled 40-50 mL polypropylene centrifuge tube and subject it to a two-step centrifugation, first at 4,000 × g and then at 15,000 × g, both steps at 4 oC for 20 min (to remove all debris). Use a floor-type centrifuge for the same.
  3. Day 5/6
    1. Transfer the culture supernatant into a prechilled 38.5 mL polypropylene ultracentrifuge tube and spin it in an ultracentrifuge at 100,000 × g for 4 h at 4 oC.
      NOTE: A swing bucket works best at this speed. Make sure to fill the ultracentrifuge tube to the brim and have a balance ultracentrifuge tube of equivalent weight. If either tube is stuck to the swing bucket after centrifugation (which happens due to condensation), using forceps, gently remove it from the rotor. Wiping off the condensed moisture present on the outer surface of the ultracentrifuge before ultracentrifugation prevents sticking.
    2. Save the supernatant in a 50 mL prechilled tube (see note). Invert the ultracentrifuge tube on a fresh lint-free absorbent paper to remove traces of the supernatant. Resuspend the pellet in 600 µL of HEPES buffer solution (50 mM HEPES and 150 mM NaCl, pH 7.4; filter-sterilize before use).
      NOTE: Save the supernatant only as a backup. The native mEV pellet appears as a jelly-like, 5-7 mm diameter, dull greyish yellow to translucent spot. If no pellet is visible, repeat step 2.3.1 by reusing the saved supernatant. If no pellet appears after repeating step 2.3.1, discard and restart from step 1.2. The pellet takes time to resuspend. It is recommended to add the HEPES buffer and leave it overnight at 4 oC for easy resuspension. Resuspend gently but with repeated pipetting (use P200 tips for better resuspension) until uniform resuspension.
  4. Day 6
    1. Subject the resuspended pellet to 'iodixanol'-based density gradient centrifugation.
      1. Layer the resuspended pellet at the bottom of the 13 mL clean, washed (with ddw) and pre-chilled ultra-clear polypropylene ultracentrifuge tube and gently mix (use 1 mL pipette) with ~4 mL of inert density gradient 'iodixanol' solution (commercially available as a ~60% w/v solution). After layering the resuspended pellet at the bottom of the tube (to a maximum of 5 mL), then overlay with 1 mL (w/v) each of 40%, 30%, 20%, and 10% sub-stocks of 'iodixanol' in the respective order (prepare sub-stocks (with HEPES buffer) from 60% stock). Then, add 4 mL of 6% sub-stock (prepared from 60% stock with HEPES buffer) at the top to fill the tube.
        NOTE: Prepare the gradient just before use; never store and use.
      2. Carefully (without shaking), weigh the tube in a glass beaker, and gently transfer it into the swinging bucket rotor.
        NOTE: Weighing is necessary to balance with a dummy tube (also weighed).
      3. Subject it to ultracentrifugation at 141,000 × g for 16 h at 4 oC.
  5. Day 7
    1. Carefully remove the tube (see note of step 2.3.1) and collect 1 mL fractions into freshly autoclaved microcentrifuge tubes; pay attention to the 4th to 6th fractions, which typically contain the Msm mEVs.
      NOTE: The mEVs from these fractions normally fractionate into three or four mEVs bands (one is the major band) that are dull white in color. The R-mEVs containing mCherry fractionate out in the 5th to 7th fractions and appear dark purple to magenta. The Mtb EVs typically fractionate out in the 5th to 7th fractions. Separation of the mEVs in the gradient depends on the gradient concentration used and how well the gradient is layered. If mEVs rupture partially, they may fraction out in earlier fractions. Alternatively, if the pellet obtained after step 2.3.2 is not resuspended well, the vesicles form dense micropellets that fraction out as later fractions. We recommend precise collection of the fractions only when the user wants to evaluate which of the 1 mL fractions contain the mEVs. Users may like to aliquot into smaller or larger fractions based on their convenience. When we use them for certain applications, for example, testing them as a potential subunit vaccine booster to BCG, we limit our collection of the mEVs to less than 250 µL of the fractions (where mEVs fractionate) so that we can specifically collect only the mEVs bands and process as indicated in 2.7.5. This helps to more effectively remove all traces of iodixanol that may interfere in the way of our downstream experiments.
  6. Day 8
    1. Pool the mEVs-containing fractions, dilute with HEPES buffer to 38 mL, and repeat the ultracentrifugation at 4 oC for 16 h at 100,000 × g. Resuspend the pellet (as in step 2.3.2 with the same cautions) either in HEPES buffer or in any buffer that downstream experiments (not detailed here) such as protein estimation, nano-tracking analyses, negative staining, transmission electron microscopy, western blotting, and immune-gold labeling require.
      ​NOTE: For better resuspension, sonicate the mEV-containing tube for 10 min using an ultrasonic water bath sonicator. Sonicating for a longer time can initiate rupturing and loss of intact mEVs. If suspended well, sonication is unnecessary. All steps from 2.1 to 2.6 are identical while enriching Mtb-generated EVs.

3. Construction and enrichment of recombinant mEVs.

NOTE: One of the 10 most abundant proteins (identified by mass spectrometry) of Msm EVs is Cfp-2930. Given its small size (29 kDa), simple secondary structure40, localization to the membrane41, and propensity to be secreted into spent media in axenic cultures (e.g., as a culture filtrate protein; secreted by both Msm and Mtb42,43, here, it has been exploited to deliver a red fluorescent reporter and a protein of interest (EsxAMtb) into mEVs. To achieve this,

  1. Employ appropriate forward and reverse primers (Table 1; compatible to be directly cloned into a shuttle vector such as pMV261) for amplifying cfp-29 from Msm. Using ~50 ng of high molecular weight (~>20 kb) Msm genomic DNA as the template, PCR-amplify the cfp-29 gene fragment with a high-fidelity proofreading DNA polymerase (such as Phusion or Q5). Follow the manufacturer's recommendations for PCR.
    NOTE: Design necessary restriction sites into primers for easy cloning into any alternate shuttle vector of interest. PCR conditions and volume will vary with the type and brand of proof-reading DNA polymerase being used. The volume of the reaction mix will vary depending on the amount of DNA template and quantity of proofreading DNA polymerase. Follow the manufacturer's recommendations for PCR conditions, success of amplification, and elimination of non-specific annealing of primers.
  2. PCR purify the eluted amplicon with any commercially available PCR purification kit and verify amplicon length by standard agarose gel electrophoresis. Digest the purified amplicon.
    1. Estimate the amount of purified amplicon on a spectrophotometer. Use at least 2 µg of cfp-29 amplicon for digestion.
    2. Digest first with BstB1 at 65 oC for 1 h (type and quantity of buffer and enzyme-as per the manufacturer's recommendations), bring the reaction temperature down to RT, and then digest with HindIII for 1 h at 37 oC (type and quantity of buffer and enzyme-as per the manufacturer's recommendations).
    3. PCR purify and elute the digested amplicon in 50 µL of autoclaved nuclease-free ddw.
    4. Estimate the concentration and yield of the digested amplicon using a spectrophotometer. Store at -20 oC until ligation setup. NOTE: Post PCR, verify the amplicon length (~798 + 50 bp) and yield by electrophoresing 10 µL of the PCR-reaction mix on a 1% agarose gel.Although double digestion is not possible with this combination of enzymes, a compatible buffer will prevent repeated PCR purification and subsequent loss of digested amplicon. The concentration of digested amplicon varies with the kit used for PCR purification. It also varies with the length (in bp) of any alternative vectors of choice.
  3. Employ the forward and reverse primers (Table 1), a proofreading DNA polymerase, and ~50 ng of Mtb genomic DNA, PCR amplify esxA- or esxA-3X FLAG-tag specific amplicon. Use ~5 ng of appropriate plasmid DNA to PCR amplify mCherry. Plasmid and sequence details are in Supplementary File 1.
    NOTE: Use a Glycine, Glycine, Glycine, Glycine, Serine44,45(G4S) linker between cfp-29 and mCherry/esxA/esxA-3X FLAG; before the start of mCherry, the G4S linker helps mCherry to not undergo spurious non-functional folds (including those driven by Cfp-29). Refer to cfp-29, hsp60 promoter, mCherry, and esxA sequences in Supplementary File 1. Plasmids serving as templates for mCherry are available at different plasmid repositories/banks. Different versions (slightly altered sequences) of mCherry are available that will require altered forward and reverse primer sequences. The primers (Table 1) aid in amplifying the mCherry mentioned in Supplementary File 1. Fusion of the N-terminus of mCherry/esxA/esxA::3XFLAG to the C-terminal end of Cfp-29 works well.
  4. Digest 1 µg of DNA of the mCherry/esxA/esxA::3XFLAG amplicons and purify digested DNA.
    1. Double digest each amplicon with HindIII and HpaI for 1 h at 37 oC (or as per the manufacturer's recommendations).
    2. Use a commercially available PCR purification kit and the manufacturer's recommendations for purifying the digested amplicon. Elute the digested amplicon in 50 µL of autoclaved nuclease-free ddw.
    3. Estimate the concentration and yield of the digested amplicon using a spectrophotometer. Store at -20 oC until ligation setup.
  5. Digest 2 µg of pMV261-KanR (Supplementary File 1) or a suitable cloning vector with the enzyme(s) of choice.
    1. Digest first with BstB1 at 65 oC for 1 h (type and quantity of buffer and enzyme-as per the manufacturer's recommendations), bring the reaction temperature down to RT, and then digest with HindIII for 1 h at 37 oC (type and quantity of buffer and enzyme-as per the manufacturer's recommendations).
    2. Gel purify and elute in 50 µL of autoclaved nuclease-free ddw.
    3. Estimate the concentration and yield of the digested vector using a spectrophotometer. Store at -20 oC until ligation setup.
      NOTE: One-step two-fragment cloning is possible with the above primers for pMV261. Any alternate shuttle vector that survives as an episome will work. Integrative plasmids will also work, but recombinant protein yield will be relatively less per cell basis.
  6. Ligate and transform into a compatible strain of E. coli.
    1. For ligation, use 125 ng of the vector. Use appropriately digested mCherry/esxA/esxA::3XFLAG amplicons at a 1:3 molar ratio. Perform ligation overnight using T4 DNA Ligase (quantity as per the manufacturer's recommendations) at 16 °C in a refrigerated circulating water bath.
      NOTE: Use appropriate controls such as vector only with and without T4 DNA Ligase for evaluating the efficiency of digestion and predicting the efficiency of cloning success.
    2. Transformation
      1. Thaw NEB5α chemically competent cells aliquots (~100 µL per transformation) on ice for 15 min. Gently mix twice with a sterile pipette tip. Add ligation mix (up to 20 µL) to the cold competent cells.
      2. Gently mix pipette cells + ligated DNA. Incubate the mix on ice for an additional 30 min.
      3. Provide heat shock at 42 °C (in a circulating water bath) for 60 s and immediately transfer back to ice for an additional 15 min.
      4. Recover the transformed cells by adding 1 mL of the SOC broth (2% Tryptone, 0.5% Yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, and 20 mM glucose) and incubate at 37 °C for 1 h at 200 rpm.
      5. Spin down the recovered bacteria in a 1.5 mL microcentrifuge tube (3000 × g, RT, and 10 min), discard the supernatant, resuspend the pellet in 200 µL of sterile, prewarmed, freshly prepared LB media, and spread the suspension on freshly poured LB Miller agar plates containing required antibiotics at appropriate concentrations.
      6. Incubate the Petri dishes in a plate incubator preset to 37 oC.
  7. Screen (not detailed here) for potential clones, verify (by colony PCR-/restriction enzymes-based)46 and sequence (Sanger sequencing) them to confirm fusion.
  8. Extract plasmid DNA (~200 ng/1-2 µL; any commercially available kit) of the confirmed clone (E. coli background) and transform it into freshly made electro-competent cells of Msm.
  9. Preparation of Msm electrocompetent cells
    1. Freshly grow Msm (as in steps 1.2.1 and 1.2.2). Wash the freshly grown Msm as in steps 1.3.3 and 1.3.4 (except, use 7H9 + ADC + Tween-80 (rich) instead of Sauton's).
    2. Add an aliquot of the washed Msm cells to a final OD600 of ~0.05 in a sterile 500 mL Erlenmeyer flask containing 150 mL of rich media.
    3. Incubate in the incubator shaker at 200 rpm and 37 oC until the culture OD600 reaches ~0.8 to 1.0 (~12-14 h).
    4. Transfer the culture into a prechilled 400 mL centrifuge bottle and incubate on ice for 60-90 min. Then, pellet the cells down at 4 oC for 15 min at 4,000 × g.
    5. Wash the cells twice (each wash with 150 mL, at 4,000 × g, 4 oC, and 15 min) with ice-cold, sterile (autoclaved) 10% glycerol.
      NOTE: With every wash, the pellet becomes loose. Use caution while discarding the entire supernatant (after each wash). Otherwise, the majority of the cells will be lost in the discarded supernatant.
    6. Wash the cells once more with 75 mL of ice-cold, sterile 10% glycerol containing 0.005% Tween-80.
    7. Resuspend the cell pellet in 7.5 mL of 10% glycerol with 0.005% Tween-80 and aliquot into 400 µL aliquots.
      NOTE: Although Msm electrocompetent cells are competent for at least 4 months, freshly prepared electrocompetent cells give the best results. When using old competent cells, a few non-pink colonies (whites) appear as false transformants. The older the competent cells, more the white colonies.
  10. Transformation of Msm
    1. Thaw the Msm competent cells aliquot on ice.
      NOTE: Thawing at RT and transforming such cells yields less efficiency.
    2. Add 1-2 µL of plasmid DNA (~200 ng total) to the cold competent cells, mix gently with a 1 mL sterile pipette tip, and transfer into a pre-chilled sterile 2 mm electroporation cuvette.
    3. Transfer the closed cuvette with Msm competent cells + plasmid DNA mix into the elctroporator's mouse, close the lid gently and apply a pulse (exponential decay type) at 2.5 kV (voltage), 25 µF (capacitance), and 1000 Ω (resistance).
    4. Immediately add 1 mL of prewarmed sterile rich (7H9 + ADC + Tween-80) medium to the cuvette, mix gently with a 1 mL sterile pipette tip, and transfer the entire contents into a 10 mL sterile tube.
    5. Incubate the contents for 3 h in an incubator shaker set to 37 oC and 200 rpm. Spin down the contents in a microcentrifuge tube (4,000 × g, RT, and 10 min), discard the supernatant, resuspend the pellet in 200 µL of sterile pre-warmed rich medium, and spread the suspension on freshly poured 7H11 agar plates containing ADC, Tween-80, and the required antibiotics at appropriate concentrations.
      NOTE: For Msm, when required, use Hygromycin, Kanamycin, and Apramycin at the final concentrations of 50 µg/mL, 25 µg/mL, and 50 µg/mL, respectively. Msm per se is NOT resistant to these antibiotics. Use these antibiotics only when using plasmids with the appropriate resistant genes for the selection/growth of transformants/recombinant Msm colonies.
    6. Incubate the Petri dishes in a plate incubator preset to 37 oC. Typically, transformants appear between 3-5 days.
      NOTE: If a protein of interest is toxic to Msm, the transformants may emerge later or fail to emerge. In such cases, clone truncated versions of the full length.
    7. Make glycerol stocks of the emergent Msm colonies after verifying for positive clones (same as step 3.7)
  11. To enrich R-mEVs containing either mCherry or EsxA proteins, first grow R-Msm expressing either mCherry or exsA or esxA::3X FLAG by following steps 1.2.1 to 1.2.3 and then follow steps 2.1 to 2.6. to enrich R-mEVs. The R-mEVs elute into the 4th-7th fractions post density gradient spin (step 2.5). The R-mEVs pellet after the first ultracentrifugation step (2.3.1). After performing identical to step 2.3.1, confirm that the R-mEVs are visible as a dark purple to magenta 5-7 mm diameter pellet at the bottom center of the ultracentrifuge.
  12. Perform western analyses47 (not detailed here) to detect protein(s) of interest within the enriched R-mEVs.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

We use M. smegmatis (Msm) as the model mycobacterium to demonstrate the enrichment of both native and recombinant mEVs (R-mEVs). This schematically summarized mEVs enrichment protocol (Figure 1) also works for the enrichment of R-mEVs of Msm and native EVs of Mtb (with minor modifications as in protocol notes of 1.2). Visualization of the enriched mEVs requires negatively staining them under a transmission electron microscope36 (Figure 2A). Typically, Msm-specific EVs separate out in the 4th-6th 1 mL fractions of the 13 mL 6-60% density gradient (Figure 2B). Approximately 80-100 µg protein equivalent of EVs are routinely obtained from 2 L of mid-logarithmic axenic cultures of Msm. Their diameters typically range between 20 nm and 250 nm (Figure 2C).

One long-term goal of our laboratory is to evaluate if mEVs of different mycobacteria could potentially act as a subunit booster to the existing vaccine, BCG. Since enriching mEVs generated by pathogenic bacteria is time-consuming, risky, and expensive, exploiting native and recombinant EVs from avirulent mycobacteria may work as a suitable alternative. Hence, we aim to not only standardize the protocol to enrich the mEVs of Msm but also to construct and enrich its R-mEVs.

To construct R-mEVs, we first selected the top 10 abundant proteins of Msm EVs (Table 1; we identified them from detailed mass spectrometry analyses of the Msm EVs)30. We hypothesized that if a foreign protein of interest is translationally fused to any of them, it should be able to localize into mEVs. Then, we shortlisted Cfp-29 among the 10 because it is the smallest among them (~29 kDa), is membrane-localized, and is a culture filtrate protein with a relatively simple secondary structure40,41,42,43. We translationally fused mCherry's (fluorescent protein) N-terminal end to the C-terminal end of Cfp-29 and evaluated its loading/delivery into mEVs. A portion of the enriched mEVs of Msm turned pink (Figure 3), indicating Cfp-29's ability to carry a foreign protein of interest into Msm EVs.

Given this ability of Cfp-29 (Figure 3), we then evaluated EsxA (Esat-6), a major immunogenic protein37,38,39 delivery into Msm EVs. Again, we generated two independent translational fusions to the C-terminus of Cfp-29-only EsxA and EsxA + 3X FLAG tag (3X FLAG fused to the C-terminus of EsxA. As expected, we observed Mtb's EsxA in Msm EVs (lanes 5, 6, and 10, Figure 4A,B), albeit in low quantities. Interestingly, Cfp-29::EsxA::3XFLAG was much more stable (lanes 3 and 4 plus 8 and 9; Figure 4A) and accumulated at higher levels in mEVs (lanes 3 and 4 plus 8 and 9; Figure 4B). In summary, we demonstrate the design, construction, and enrichment of R-mEVs that contain a foreign protein of interest (Figure 3 and Figure 4).

Figure 1
Figure 1: Schematic representation of mycobacterial extracellular vesicle enrichment. 'Days' (in red font, top of the figure) refers to the days necessary to enrich the mEVs from Msm (specifically for protocol steps 1 and 2). "Steps" (in black font, bottom of the figure) refer to the protocol steps as described in the protocol section. For enriching mEVs from Mtb, although all steps are similar, it takes at least 10 days for the different steps of culturing (step 1) to the first step of centrifugation (step 2). Subsequent steps require identical duration (as indicated in red font). Before the density gradient, the mEVs pellet + extracellular complexes look colorless when enriching both native mEVs and R-mEVs. However, it would appear pinkish to blue (see Figure 3) when enriching mEVs containing mCherry. Post the density gradient, the mEVs would appear white (native and R-mEVs) or pink (if containing mCherry) in the density gradient tube. The colors of mEVs in the figure are only for indicating clarity and do not represent the exact colors. See Figure 3 for more clarity. Abbreviations: Msm = M. smegmatis; Mtb = M. tuberculosis; 0.45 and 0.22 µm = pore size of disposal filter units. Please click here to view a larger version of this figure.

Figure 2
Figure 2: Mycobacterial EVs are circular, concentrate with density gradients, and vary in dimensions. (A) A representative image of Msm EVs upon their visualization with negative staining and viewing under a transmission electron microscope. Scale bar = 200 nm. (B) A representative image of how mEVs appear in the ultracentrifuge tube upon performing a 6-60% density gradient. If the 6-60% gradient is not accurately layered, the positioning of the major (top open arrow) and minor (bottom open arrow) bands of mEVs can significantly alter, thus altering the 1 mL fraction number. (C) A representative image upon nanotracking analysis of enriched mEVs of Msm. Nanotracking analyses reveal the proportions and concentrations of different-sized mEVs and the total number of mEVs within the preparation. On average, with the protocol detailed here, ~1-3 × 1010 EVs are enriched from 2 L of Msm and Mtb. Please click here to view a larger version of this figure.

Figure 3
Figure 3: Different steps indicative of enrichment of mEVs expressing mCherry. (A) Representative image showing Msm axenic culture expressing Cfp-29::mCherry. (B) Representative image of the bacterial pellet post centrifugation of Msm axenic culture expressing Cfp-29::mCherry. (C) Representative image of culture filtrate concentrate obtained post concentrating the spent media of Msm axenic culture expressing Cfp-29::mCherry through centricon concentrators. (D) Representative image of mEVs + extracellular complexes pellet post ultracentrifugation of culture filtrate concentrate obtained from Msm axenic culture expressing Cfp-29::mCherry. The pellet would, however, remain colorless if the mEVs were to be either native or recombinant (upon fusion to Cfp-29) for any foreign protein(s) except mCherry. (E) Representative images of mCherry containing mEVs. Note that not all mEVs are pink, indicating that not all mEVs contain Cfp-29. Good: A representative image indicating different bands of mEVs typically obtained after enriching for Cfp-29::mCherry EVs. Since mCherry-containing EVs are denser, they separate into later fractions. Poor: A representative image indicating poor separation (the white mEVs separate out in the first/second fraction and the mCherry-containing mEVs separate out in the 10th fraction (possibly because of poor resuspension of mEVs pellet, i.e., protocol step 2.3.2). Please click here to view a larger version of this figure.

Figure 4
Figure 4: Recombinant mEVs containing EsxA (ESAT-6), an Mtb-encoded immunogen in Msm total cell lysate and Msm generated EVs. (A) Coomassie gel and (B) western analysis (detected with ESAT6-specific polyclonal antibody) images showing the accumulation of fused ExsA in both Msm total cell lysate and mEVs expressing either cfp-29::esxA::3XFLAG (+ 3XFLAG, lanes 3 and 4 (total lysate) and lanes 8 and 9 (mEVs)) or cfp-29::esxA (- 3XFLAG, lanes 5 and 6 (total lysate) and lane 10 (mEVs)). Open and filled arrows indicate accumulated Cfp-29::ExsA::3XFLAG and Cfp-29::ExsA, respectively. Please click here to view a larger version of this figure.

Primers:
Sl # Gene Primer Sequence (5' to 3') Source To clone into
1 cfp-29 Forward CAGTTCGAA(BstBI)ATGAACAACCTCTATCGC Msm genomic DNA pMV261
Reverse GAAAAGCTT(HindIII)GGGGGTCAGCGCGACAG Msm genomic DNA pMV261
2 mCherry Forward GAAAAGCTT(HindIII) ggcggcggtggctcg (G4S linker)ATGGTGAGCAAGGGCGAGGAGG Lab collection pMV261
Reverse TGTGTTAAC(HpaI)CTACTTGTACAGCTCGTCC Lab collection pMV261
3 esxA Forward GAAAAGCTT(HindIII)ggcggcggtggctcg (G4S linker) ATGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAG Mtb genomic DNA pMV261
Reverse TGTGTTAAC(HpaI)TCATGCGAACA
TCCCAGTGACGTTGCCTTCGGTCG		 Mtb genomic DNA pMV261
4 exsA-3X FLAG Forward GAAAAGCTT(HindIII)ggcggcggtggctcg (G4S linker) ATGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAG Mtb genomic DNA pMV261
Reverse TGTGTTAAC(HpaI)TCA
cttgtcgtcgtcgtccttgtagtcgatgtcgtg
gtccttgtagtcaccgtcgtggtccttgtagtc (3XFLAG) TGCGAACATCCCAGTGACGTTG
CCTTCGGTCGAAGCCATTGCCTGACC		 Mtb genomic DNA pMV261

Table 1: Primer sequences. Forward and Reverse primers for amplifying cfp-29, mCherry, esxA, and esxA::3X FLAG and cloning into shuttle vector pMV261 are listed.

Supplementary File 1: A: pMV261, its circular map, main features, and complete nucleotide sequence. Yellow highlight-hsp60 promoter nucleotide sequence; Green and cyan highlight-restriction sites into which mCherry, esxA, and esxA::3X FLAG amplicons were cloned. B, C, and D: Nucleotide sequences of cfp-29, mCherry, and esxA, respectively. Green highlight-stop codon of cfp-29, mCherry, and esxA. Please click here to download this File.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Since developing a novel TB vaccine that is superior to and can replace BCG remains a formidable challenge, as an alternative, several groups are pursuing the discovery of different subunit TB vaccines that can boost BCG's potency and extend its protective duration48,49. Given the increasing attention to bacterial EVs (bEVs) as potential subunits and as natural adjuvants50,51, consistent enrichment of sufficient quantities of mEVs for their downstream testing/analysis has become an important step. It is in consideration of these research questions that this protocol aims to enrich mEVs from axenic cultures and their recombinant versions.

During detailed mass spectrometric proteome analyses of Msm EVs, Prados-Rosales et al. identified the 10 most abundant proteins30. We further hypothesized that upon sufficient molecular engineering, one among them should be sufficient to carry a foreign protein of interest into mEVs. Interestingly, Cfp-29 stood out as the best possible option because of its various features39,40,41,42. Our data indeed show that it is sufficient enough to carry mCherry and EsxA (albeit EsxA required a small tag at its C-terminus to be more stable) and accumulate them in the mEVs. Recently, in 2021, Tang et al. demonstrated that Cfp-29 is an encapsulin with the capability to carry dye-decolorizing peroxidase (DyP)-type peroxidases40. Perhaps, Cfp-29 can carry other foreign proteins too.

We explored EsxA because it is a prominent Mtb immunogen37,38,39, can be protective as a subunit vaccine in animal model37,38,39, is small in size; and its ortholog (MSMEG_0066) is interestingly absent in Msm EVs. Although we do not discuss this here, we have successfully generated R-mEVs for a few other Mtb proteins (uniquely present in Mtb and not encoded by Msm), including Antigen 85B (Rv 1886c). At the same time, interestingly, we also failed to generate R-mEVs for a few others, including full-length Rv2660c and Rv0288, possibly because the proteins are toxic to Msm. We conclude so because, despite cloning the correct nucleotide sequences and performing repeated transformations, no tranformants of Msm emerged. Since EsxA required a 3XFLAG tag at its C-terminus end for better accumulation in mEVs, we added a 3XFLAG tag to all other Mtb-encoded proteins that we evaluated. Despite the tag, Msm did not survive, indicating some Mtb proteins remain toxic despite the tag fusion. We speculate that in these cases, cloning just the predicted epitope regions or stitching several epitopes together may pay off (currently under evaluation in our laboratory). We used a small five amino acid (four Glycine and one Serine) linker between Cfp-29 and mCherry/EsxA to minimize the negative influence on the folding of the protein of interest44,45. We predict that without this linker, the protein of interest folding would be strongly influenced by Cfp-29 folding.

This enrichment protocol is easily extendable to the enrichment of Mtb-generated EVs. We also speculate that enriching mEVs from environmental mycobacteria should be also feasible with this protocol. Despite the protocol being simple and straightforward, it still requires 7-8 days to enrich Msm-generated EVs and R-mEVs. In contrast, it requires 15-20 days for the enrichment of Mtb-generated EVs. Concentrating EVs to a smaller volume is time-consuming and expensive and we are currently exploring tangential flow filtration and other approaches to solve the 'time' issue.

Lastly, we use Sauton's and not 7H9 to enrich mEVs because the 'ADC' supplement contains high amounts of bovine serum albumin that may interfere with any downstream uses of mEVs. This protocol may be easily extendable to any other specific media (e.g., low-iron media) that has to be used to evaluate the mEVs composition. Alternatively, for certain applications, at the last step (i.e. protocol step 2.7.5), instead of HEPES buffer, one could use sterile saline when injecting the same into mice or guinea pigs for various in vivo-based analyses.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

All authors declare that this research work was conducted in the absence of any commercial or financial relationships/interests that could be construed as a potential conflict of interest.

Acknowledgments

The authors sincerely thank Prof. Sarah M. Fortune for kindly sharing M. smegmatis mc2155 stock. They also acknowledge Servier Medical Art (smart.servier.com) for providing some basic elements for Figure 1. They sincerely acknowledge the support of the rest of the lab members for their patient adjustments during the long use of the incubator shakers, centrifuges, and ultracentrifuges for mEV enrichment. They also acknowledge Mr. Surjeet Yadav, the laboratory assistant, for always making sure the necessary glassware and consumables were always available and handy. Lastly, they acknowledge the administrative, the purchase, and the finance teams of THSTI for their constant support and help in the seamless execution of the project.

Materials

Name Company Catalog Number Comments
A2 type Biosafety Cabinet Thermo Fisher Scientific, USA 1300 series
Bench top Centrifuge Eppendorf, USA 5810 R
BstB1, HindIII, HpaI NEB, USA NEB
Cell densitometer GE Healthcare, USA Ultraspec 10
Citric Acid Sigma-Aldrich, Merck, USA Sigma Aldrich
Dibasic Potassium Phosphate Sigma-Aldrich, Merck, USA Sigma Aldrich
Double Distilled Water Merck, USA ~18.2 MW/cm @ 25 oC
Electroporation cuvettes Bio-Rad, USA 2 mm
Electroporator Bio-Rad, USA Electroporator
EsxA-specific Ab Abcam, UK Rabbit polyclonal
Ferric Ammonium Citrate Sigma-Aldrich, Merck, USA Sigma Aldrich
Floor model centrifuge Thermo Fisher Scientific, USA Sorvall RC6 plus
Glassware Borosil, INDIA 1 L Erlenmeyer flasks
Glycerol Sigma-Aldrich, Merck, USA Sigma Aldrich
HEPES and Sodium Chloride Sigma-Aldrich, Merck, USA Sigma Aldrich
Incubator shakers Thermo Fisher Scientific, USA MaxQ 6000 & 8000
L-Asparagine Sigma-Aldrich, Merck, USA Sigma Aldrich
Luria Bertani Broth and Agar, Miller Hi Media, INDIA Hi Media
Magnesium Sulfate Heptahydrate Sigma-Aldrich, Merck, USA Sigma Aldrich
Magnetic stirrer Tarsons, INDIA Tarsons
mCherry-specific Ab Abcam, UK Rabbit monoclonal
Microwave LG, INDIA MC3286BLT
Middlebrook 7H9 Broth BD, USA Difco Middlebrook 7H9 Broth
Middlebrook ADC enrichment BD, USA BBL Middlebrook ADC enrichment
Nanodrop Thermo Fisher Scientific, USA Spectronic 200 UV-Vis
NEB5a NEB, USA a derivative of DH5a
Optiprep (Iodixanol) Merck, USA Available as 60% stock solution (in water)
PCR purification kit Hi Media, INDIA Hi Media
pH Meter Mettler Toledo, USA Mettler Toledo
Plasmid DNA mini kit Hi Media, INDIA Hi Media
Plate incubator Thermo Fisher Scientific, USA New Series
Plasmid pMV261 Addgene, USA *
*The   plasmid   is   no   more available in this plasmid bank		 Shuttle vector
Proof-reading DNA Polymerase Thermo Fisher Scientific, USA Phusion DNA Plus Polymerase
Q5 Proof-reading DNA Polymerase NEB, USA NEB
Refrigerated circulating water bath Thermo Fisher Scientific, USA R20
Middlebrock 7H11 Agar base BD, USA BBL Seven H11 Agar base
SOC broth Hi Media, INDIA Hi Media
Sodium Hydroxide Sigma-Aldrich, Merck, USA Sigma Aldrich
T4 DNA Ligase NEB, USA NEB
Tween-80 Sigma-Aldrich, Merck, USA Sigma Aldrich
Ultracentrifuge Beckman Coulter, USA Optima L100K
Ultracentrifuge tubes - 14 mL Beckman Coulter, USA Polyallomer type – ultra clear type in SW40Ti rotor
Ultracentrifuge tubes - 38 mL Beckman Coulter, USA Polypropylene type– cloudy type for SW28 rotor
Ultrasonics cleaning waterbath sonicator Thermo Fisher Scientific, USA Sonicator - bench top model
0.22 µm Disposable filters Thermo Fisher Scientific, USA Nunc-Nalgene
30-kDa Centricon concentrators Merck, USA Amicon Ultra centrifugal filters - Millipore
3X FLAG antibody Sigma-Aldrich, Merck, USA Sigma Aldrich
400 mL Centrifuge bottles Thermo Fisher Scientific, USA Nunc-Nalgene
50 mL Centrifuge tubes Corning, USA Sterile, pre-packed
Bacteria
Strain
Escherichia coli NEB, USA NEB 5-alpha (a derivative of DH5α).
Msm expressing cfp29::mCherry This study MC2 155
Msm expressing cfp29::esxA This study MC2 155
Msm expressing cfp29::esxA::3X FLAG This study MC2 155
Mycobacterium smegmatis (Msm) Prof. Sarah M. Fortune, Harvard Univ, USA  MC2 155

DOWNLOAD MATERIALS LIST

References

  1. Global Tuberculosis Report 2022. , https://www.who.int/publications/m/item/global-tb-report (2022).
  2. Luca, S., Mihaescu, T. History of BCG vaccine. Mædica. 8 (1), 53-58 (2013).
  3. Palmer, C. E., Long, M. W. Effects of infection with atypical mycobacteria on BCG vaccination and tuberculosis. The American Review of Respiratory Disease. 94 (4), 553-568 (1966).
  4. Brandt, L., et al. Failure of the Mycobacterium bovis BCG vaccine: some species of environmental mycobacteria block multiplication of BCG and induction of protective immunity to tuberculosis. Infection and Immunity. 70 (2), 672-678 (2002).
  5. Andersen, P., Doherty, T. M. The success and failure of BCG - implications for a novel tuberculosis vaccine. Nature Reviews. Microbiology. 3 (8), 656-662 (2005).
  6. Kumar, P. A perspective on the success and failure of BCG. Frontiers in Immunology. 12, 778028 (2021).
  7. Fine, P. E. Variation in protection by BCG: implications of and for heterologous immunity. Lancet. 346 (8986), 1339-1345 (1995).
  8. Triccas, J. A. Recombinant BCG as a vaccine vehicle to protect against tuberculosis. Bioengineered Bugs. 1 (2), 110-115 (2010).
  9. Dietrich, G., Viret, J. -F., Hess, J. Mycobacterium bovis BCG-based vaccines against tuberculosis: novel developments. Vaccine. 21 (7-8), 667-670 (2003).
  10. Singh, V. K., Srivastava, R., Srivastava, B. S. Manipulation of BCG vaccine: a double-edged sword. European Journal of Clinical Microbiology & Infectious Diseases. 35 (4), 535-543 (2016).
  11. Bastos, R. G., Borsuk, S., Seixas, F. K., Dellagostin, O. A. Recombinant Mycobacterium bovis BCG. Vaccine. 27 (47), 6495-6503 (2009).
  12. Kaufmann, S. H. E., Gengenbacher, M. Recombinant live vaccine candidates against tuberculosis. Current Opinion in Biotechnology. 23 (6), 900-907 (2012).
  13. Yuan, X., et al. A live attenuated BCG vaccine overexpressing multistage antigens Ag85B and HspX provides superior protection against Mycobacterium tuberculosis infection. Applied Microbiology and Biotechnology. 99 (24), 10587-10595 (2015).
  14. Vartak, A., Sucheck, S. J. Recent advances in subunit vaccine carriers. Vaccines. 4 (2), 12 (2016).
  15. Lindenstrøm, T., et al. Tuberculosis subunit vaccination provides long-term protective immunity characterized by multifunctional CD4 memory T cells1. The Journal of Immunology. 182 (12), 8047-8055 (2009).
  16. Liu, Y., et al. A subunit vaccine based on rH-NS induces protection against Mycobacterium tuberculosis infection by inducing the Th1 immune response and activating macrophages. Acta Biochimica et Biophysica Sinica. 48 (10), 909-922 (2016).
  17. Ning, H., et al. Subunit vaccine ESAT-6:c-di-AMP delivered by intranasal route elicits immune responses and protects against Mycobacterium tuberculosis infection. Frontiers in Cellular and Infection Microbiology. 11, 647220 (2021).
  18. Woodworth, J. S., et al. A Mycobacterium tuberculosis-specific subunit vaccine that provides synergistic immunity upon co-administration with Bacillus Calmette-Guérin. Nature Communications. 12 (1), 6658 (2021).
  19. Moyle, P. M., Toth, I. Modern subunit vaccines: development, components, and research opportunities. ChemMedChem. 8 (3), 360-376 (2013).
  20. Baxter, D. Active and passive immunity, vaccine types, excipients and licensing. Occupational Medicine. 57 (8), 552-556 (2007).
  21. Lee, W. -H., et al. Vaccination with Klebsiella pneumoniae-derived extracellular vesicles protects against bacteria-induced lethality via both humoral and cellular immunity. Experimental & Molecular Medicine. 47 (9), e183-e183 (2015).
  22. Micoli, F., et al. Comparative immunogenicity and efficacy of equivalent outer membrane vesicle and glycoconjugate vaccines against nontyphoidal Salmonella. Proceedings of the National Academy of Sciences. 115 (41), 10428-10433 (2018).
  23. Obiero, C. W., et al. A phase 2a randomized study to evaluate the safety and immunogenicity of the 1790GAHB generalized modules for membrane antigen vaccine against Shigella sonnei administered intramuscularly to adults from a shigellosis-endemic country. Frontiers in Immunology. 8, 1884 (2017).
  24. Sedaghat, M., et al. Evaluation of antibody responses to outer membrane vesicles (OMVs) and killed whole cell of Vibrio cholerae O1 El Tor in immunized mice. Iranian Journal of Microbiology. 11 (3), 212-219 (2019).
  25. Adriani, R., Mousavi Gargari, S. L., Nazarian, S., Sarvary, S., Noroozi, N. Immunogenicity of Vibrio cholerae outer membrane vesicles secreted at various environmental conditions. Vaccine. 36 (2), 322-330 (2018).
  26. Roier, S., et al. Intranasal immunization with nontypeable Haemophilus influenzae outer membrane vesicles induces cross-protective immunity in mice. PLOS ONE. 7 (8), e42664 (2012).
  27. Furuyama, N., Sircili, M. P. Outer membrane vesicles (OMVs) produced by gram-negative bacteria: structure, functions, biogenesis, and vaccine application. BioMed Research International. 2021, e1490732 (2021).
  28. Buzas, E. I. The roles of extracellular vesicles in the immune system. Nature Reviews Immunology. 23 (4), 236-250 (2022).
  29. Cai, W., et al. Bacterial outer membrane vesicles, a potential vaccine candidate in interactions with host cells based. Diagnostic Pathology. 13 (1), 95 (2018).
  30. Prados-Rosales, R., et al. Mycobacteria release active membrane vesicles that modulate immune responses in a TLR2-dependent manner in mice. The Journal of Clinical Investigation. 121 (4), 1471-1483 (2011).
  31. Bai, X., Findlow, J., Borrow, R. Recombinant protein meningococcal serogroup B vaccine combined with outer membrane vesicles. Expert Opinion on Biological Therapy. 11 (7), 969-985 (2011).
  32. Nagaputra, J. C., et al. Neisseria meningitidis native outer membrane vesicles containing different lipopolysaccharide glycoforms as adjuvants for meningococcal and nonmeningococcal antigens. Clinical and Vaccine Immunology: CVI. 21 (2), 234-242 (2014).
  33. Echeverria-Valencia, G., Flores-Villalva, S., Espitia, C. I. Virulence factors and pathogenicity of Mycobacterium. Mycobacterium - Research and Development. IntechOpen. , (2017).
  34. Prados-Rosales, R., Brown, L., Casadevall, A., Montalvo-Quirós, S., Luque-Garcia, J. L. Isolation and identification of membrane vesicle-associated proteins in Gram-positive bacteria and mycobacteria. MethodsX. 1, 124-129 (2014).
  35. Lee, J., et al. Proteomic analysis of extracellular vesicles derived from Mycobacterium tuberculosis. Proteomics. 15 (19), 3331-3337 (2015).
  36. Das, S., et al. Development of DNA aptamers to visualize release of mycobacterial membrane-derived extracellular vesicles in infected macrophages. Pharmaceuticals. 15 (1), 45 (2022).
  37. Brandt, L., Elhay, M., Rosenkrands, I., Lindblad, E. B., Andersen, P. ESAT-6 subunit vaccination against Mycobacterium tuberculosis. Infection and Immunity. 68 (2), 791-795 (2000).
  38. Kim, W. S., Kim, H., Kwon, K. W., Cho, S. -N., Shin, S. J. Immunogenicity and vaccine potential of InsB, an ESAT-6-like antigen identified in the highly virulent Mycobacterium tuberculosis Beijing K strain. Frontiers in Microbiology. 10, 220 (2019).
  39. Valizadeh, A., et al. Evaluating the performance of PPE44, HSPX, ESAT-6 and CFP-10 factors in tuberculosis subunit vaccines. Current Microbiology. 79 (9), 260 (2022).
  40. Tang, Y., et al. Cryo-EM structure of Mycobacterium smegmatis DyP-loaded encapsulin. Proceedings of the National Academy of Sciences. 118 (16), (2021).
  41. Rosenkrands, I., et al. Identification and characterization of a 29-kilodalton protein from Mycobacterium tuberculosis culture filtrate recognized by mouse memory effector cells. Infection and Immunity. 66 (6), 2728-2735 (1998).
  42. Gu, S., et al. Comprehensive proteomic profiling of the membrane constituents of a Mycobacterium tuberculosis strain. Molecular & cellular proteomics: MCP. 2 (12), 1284-1296 (2003).
  43. Xiong, Y., Chalmers, M. J., Gao, F. P., Cross, T. A., Marshall, A. G. Identification of Mycobacterium tuberculosis H37Rv integral membrane proteins by one-dimensional gel electrophoresis and liquid chromatography electrospray ionization tandem mass spectrometry. Journal of Proteome Research. 4 (3), 855-861 (2005).
  44. Chen, X., Zaro, J. L., Shen, W. -C. Fusion protein linkers: property, design and functionality. Advanced Drug Delivery Reviews. 65 (10), 1357-1369 (2013).
  45. Klein, J. S., Jiang, S., Galimidi, R. P., Keeffe, J. R., Bjorkman, P. J. Design and characterization of structured protein linkers with differing flexibilities. Protein Engineering, Design and Selection. 27 (10), 325-330 (2014).
  46. Green, M. R., Sambrook, J. Molecular cloning, a laboratory manual, 4th Edition. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (2012).
  47. Atmakuri, K., Ding, Z., Christie, P. J. VirE2, a Type IV secretion substrate, interacts with the VirD4 transfer protein at cell poles of Agrobacterium tumefaciens. MolecularMicrobiology. 49 (6), 1699-1713 (2003).
  48. Woodworth, J. S., et al. A Mycobacterium tuberculosis-specific subunit vaccine that provides synergistic immunity upon co-administration with Bacillus Calmette-Guérin. Nature Communications. 12 (1), 6658 (2021).
  49. Khademi, F., Derakhshan, M., Yousefi-Avarvand, A., Tafaghodi, M., Soleimanpour, S. Multi-stage subunit vaccines against Mycobacterium tuberculosis: an alternative to the BCG vaccine or a BCG-prime boost. Expert Review of Vaccines. 17 (1), 31-44 (2018).
  50. Prior, J. T., et al. Bacterial-derived outer membrane vesicles are potent adjuvants that drive humoral and cellular immune responses. Pharmaceutics. 13 (2), 131 (2021).
  51. Tan, K., Li, R., Huang, X., Liu, Q. Outer membrane vesicles: current status and future direction of these novel vaccine adjuvants. Frontiers in Microbiology. 9, 783 (2018).

Tags

Immunology and Infection Extracellular vesicles recombinant vesicles Esat-6 mycobacteria ExsA mCherry Cfp-29 bacteria

Erratum

Formal Correction: Erratum: Enrichment of Native and Recombinant Extracellular Vesicles of Mycobacteria
Posted by JoVE Editors on 02/01/2024. Citeable Link.

An erratum was issued for: Enrichment of Native and Recombinant Extracellular Vesicles of Mycobacteria. The Authors section was updated from:

Praapti Jayaswal1
Mohd Ilyas1
Kuljit Singh1,2
Saurabh Kumar1,3
Lovely Sisodiya1
Sapna Jain1
Rahul Mahlawat1
Nishant Sharma1
Vishal Gupta1
Krishnamohan Atmakuri1
1Bacterial Pathogenesis Laboratory, Infectious Diseases and Immunology Group, Translational Health Science and Technology Institute, NCR Biotech Science Cluster
2Clinical Microbiology Division, CSIR-Indian Institute of Integrative Medicine
3ICAR-Research Complex for Eastern Region
4Public Health Research Institute, Rutgers University

to:

Praapti Jayaswal1
Mohd Ilyas1
Kuljit Singh1,2
Saurabh Kumar1,3
Lovely Sisodiya1
Sapna Jain1
Rahul Mahlawat1
Nishant Sharma1,4
Vishal Gupta1
Krishnamohan Atmakuri1
1Bacterial Pathogenesis Laboratory, Infectious Diseases and Immunology Group, Translational Health Science and Technology Institute, NCR Biotech Science Cluster
2Clinical Microbiology Division, CSIR-Indian Institute of Integrative Medicine
3ICAR-Research Complex for Eastern Region
4Public Health Research Institute, Rutgers University

Enrichment of Native and Recombinant Extracellular Vesicles of Mycobacteria
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Jayaswal, P., Ilyas, M., Singh, K.,… More

Jayaswal, P., Ilyas, M., Singh, K., Kumar, S., Sisodiya, L., Jain, S., Mahlawat, R., Sharma, N., Gupta, V., Atmakuri, K. Enrichment of Native and Recombinant Extracellular Vesicles of Mycobacteria. J. Vis. Exp. (202), e65138, doi:10.3791/65138 (2023).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter