A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Agrobacterium tumefaciens-Mediated Genetic Engineering of Green Microalgae, Chlorella vulgaris

5.3K views

⸱

DOI:

10.3791/65382

⸱

October 27th, 2023

In This Article

Summary

This protocol outlines the utilization of Agrobacterium tumefaciens-mediated transformation (AMT) for integrating gene(s) of interest into the nuclear genome of the green microalgae Chlorella vulgaris, leading to the production of stable transformants.

Abstract

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit the capacity for gene transfer to a diverse array of species. Numerous microalgae species lack well-established methods for reliably integrating genes of interest into their nuclear genome. To harness the potential benefits of microalgal biotechnology, simple and efficient genome manipulation tools are crucial. Herein, an optimized AMT protocol is presented for the industrial microalgae species Chlorella vulgaris, utilizing the reporter green fluorescent protein (mGFP5) and the antibiotic resistance marker for Hygromycin B. Mutants are selected through plating on Tris-Acetate-Phosphate (TAP) media containing Hygromycin B and cefotaxime. Expression of mGFP5 is quantified via fluorescence after over ten generations of subculturing, indicating the stable transformation of the T-DNA cassette. This protocol allows for the reliable generation of multiple transgenic C. vulgaris colonies in under two weeks, employing the commercially available pCAMBIA1302 plant expression vector.

Introduction

Agrobacterium tumefaciens, a gram-negative soil-borne bacterium, possesses a unique interkingdom gene transfer ability, earning it the title "natural genetic engineer"1. This bacterium can transfer DNA (T-DNA) from a tumor-inducing plasmid (Ti-Plasmid) into host cells through a Type IV secretion system, resulting in the integration and expression of the T-DNA within the host genome1,2,3,4. In the natural setting, this process leads to tumor formation in plants, commonly known as crown gall disease. However, Agrobacterium can also transfer T-DNA into various other organisms, including yeast, fungi, algae, sea urchin embryos, and even human cells under laboratory conditions5,6,7,8.

Exploiting this natural system, Agrobacterium tumefaciens-mediated transformation (AMT) enables the random integration of gene(s) of interest into a host cell's nuclear genome by modifying the T-DNA region of the Ti-plasmid. For this purpose, a widely used AMT plant expression vector is pCAMBIA13029. Researchers can employ simple cloning workflows in E. coli before transferring the desired vector into A. tumefaciens for subsequent transfer to the host of interest.

Green microalgae are eukaryotes that share many similarities with land plants but are highly recalcitrant to genetic modification. However, genetic transformation plays a crucial role in both fundamental and biotechnological research of microalgae. In several microalgae species, particularly Chlamydomonas reinhardtii, genetic transformation via AMT has successfully introduced transgenes such as human interleukin-2 (hIL-2), the severe acute respiratory syndrome coronavirus 2 receptor-binding domain (SARS-CoV-2 RBD), and two antimicrobial peptides (AMPs)10,11,12,13. Among these, Chlorella vulgaris, a less fastidious and fast-growing green algae species, holds significant potential for the sustainable production of carbohydrates, proteins, nutraceuticals, pigments, and other high-value compounds14. However, the lack of reliable tools for creating transgenic strains of C. vulgaris hampers its commercial progress. Since there have been only a limited number of published works utilizing AMT in C. vulgaris15, and given the considerable differences between plant and microalgae cultivation, optimizing the AMT protocol becomes essential.

In this study, researchers inserted green fluorescent protein (mGFP5) downstream of the Cauliflower Mosaic Virus (CamV) 35S promoter and added a histidine tag to use it as a reporter gene for protein expression. Transformants were selected using Hygromycin B, and after subculturing for over twenty generations, the transformation remained stable. The pCAMBIA1302 plasmid employed in this work can be readily adapted to contain any gene of interest. Furthermore, the method and materials presented can be adjusted for other green algae species with an active CamV35S promoter, as this promoter is used for Hygromycin selection.

Access restricted. Please log in or start a trial to view this content.

Protocol

All media and solutions must be autoclaved prior to use unless otherwise stated. All centrifuge tubes, pipette tips, etc., should be sterile or autoclaved before use. For easy reference, the media recipes used in this protocol are listed in Table 1.

1. Preparation of A. tumefaciens electrocompetent cells

  1. Inoculate Agrobacterium (AGL-1) into a 25 mL sterile shaker flask of LB media (supplemented with rifampicin, 20 mg/L-1) from a frozen glycerol stock and grow overnight at 28-30 °C and 150 rpm.
    ​NOTE: The Agrobacterium strain AGL-1 is (see Table of Materials) resistant to rifampicin, ampicillin, chloramphenicol, and streptomycin and can be obtained from several suppliers.
  2. The following day, dilute the culture 1,00,000-fold by adding 0.5 µL of the overnight culture to 50 mL autoclaved ultra-pure water and spread 10 µL of this diluted culture on an LB plate, and then incubate at 28-30 °C for 1-3 days.
  3. Pick a colony and start a 20 mL overnight culture in LB with rifampicin at 28-30 °C.
  4. The next day, inoculate 500 mL LB media (no antibiotic) in a shaker flask with 9 mL of the overnight culture and grow at 28-30 °C until the OD600 reaches 0.5.
  5. Divide the culture evenly into ten 50 mL centrifuge tubes and chill on ice for 30 min. Pre-cool the centrifuge to 4 °C.
  6. Centrifuge the tubes at 4 °C and 4000 x g for 15 min. Subsequently, remove as much supernatant as possible using a pipette and resuspend the pellet in each tube in 50 mL of ice-cold water.
  7. Centrifuge the cells at 4 °C and 4000 x g for 15 min. Remove the supernatant and resuspend the pellet in 25 mL of ice-cold water in each tube.
  8. Centrifuge the cells at 4 °C and 4000 x g for 15 min. Remove the supernatant and resuspend the pellet in 1 mL of ice-cold 10% (w/v) glycerol in each tube.
  9. Combine all tubes into one 50 mL tube and centrifuge the cells at 4 °C and 4000 x g for 15 min. Remove the supernatant and resuspend the pellet in 400 µL ice-cold 10% (w/v) glycerol. The cell concentration should be about 1-3 x 1010 cells/mL.
  10. Distribute the cells as 50 µL aliquots in sterile prechilled microtubes. Freeze in liquid nitrogen and store in a -80 °C freezer.

2. Electroporation of A. tumefaciens

  1. Add 50 µL of AGL-1 A. tumefaciens electrocompetent cells into a prechilled 0.1 mm cuvette and add 2 µL of pCAMBIA1302 or similar plasmid (conc 15 ng/µL) (see Table of Materials).
  2. Electroporate at 2400 V using an electroporator (200 Ω, capacitance extender 250 µFD, capacitance 25 µFD, exponential decay, see Table of Materials). The time constant should be >4.5 ms for successful electroporation with exponential decay.
  3. Immediately add 1 mL of LB media to the cuvette and gently pipette up and down to mix. Transfer the 1 mL of resuspended cells into a 1.5 mL microtube and incubate it at 28-30 °C for at least 1 h to recover.
  4. Plate the cells on LB agar containing the appropriate antibiotic (i.e., 50 mg/L of kanamycin for pCAMBIA1302 for prokaryotic selection).
  5. Incubate at 28-30 °C for 2-3 days.
  6. Select one colony, grow overnight in LB with the appropriate selection (50 mg/L of kanamycin for pCAMBIA1302), and cryopreserve the plasmid-containing strain using 50% glycerol at -80 °C for future use.

3. AMT of C. vulgaris

NOTE: Prepare C. vulgaris (UTEX 395, see Table of Materials) and A. tumefaciens cultures in parallel for co-cultivation. C. vulgaris cultures should be started 3 days before preparing A. tumefaciens cultures. Protocol was modified based on that published by Kumar et al.7.

  1. Prepare C. vulgaris culture
    1. C. vulgaris is traditionally stored on slants or maintained in log-phase cultures in illuminated conditions. From a log phase culture at OD600 = 1.0, spread 0.5 mL onto a Tris-Acetate-Phosphate (TAP, see Table 1) agar plates (1.2% w/v agar A) and grow for 5 days at 25 °C with illumination (50 µE/m2s). This will yield approximately 5 x 106 cells.
  2. Prepare A. tumefaciens culture
    1. Grow A. tumefaciens AGL-1 pCAMBIA1302 strain in a shaker flask by inoculating 10 mL of LB media supplemented with 15 mM glucose, 20 mg/L rifampicin, and 50 mg/L kanamycin (see Table of Materials) using the glycerol stock. Incubate at 28-30 °C and 250 rpm overnight.
    2. Inoculate 1 mL of overnight culture into 50 mL of LB with 15 mM glucose, 20 mg/L rifampicin, and 50 mg/L kanamycin and incubate at 28-30 °C and 250 rpm until the OD600 reaches 1.0.
  3. Cocultivate C. vulgaris and A. tumefaciens
    1. To prepare the A. tumefaciens culture for co-cultivation, transfer the grown culture to a 50 mL tube and centrifuge at 4000 x g for 30 min at room temperature. Remove the supernatant using a pipette and wash the cells twice with the induction medium.
      NOTE: The induction media used is TAP media adjusted to pH 5.5 and supplemented with F/2 medium trace metals and vitamins with 200 µM acetosyringone (AS, see Table of Materials). Resuspend the cells in induction media such that OD600 = 0.5.
    2. To prepare the C. vulgaris culture for co-cultivation, add 25 mL of induction media to the C. vulgaris plate containing ~ 5 x 106 cells. Transfer to a 50 mL tube. Centrifuge the cells at 4000 x g for 15 min at room temperature and discard the supernatant.
    3. Mix the algal cell pellet with 200 µL of the bacterial suspension (OD600: 0.5) and incubate them in a rotary shaker at 21-25 °C at 150 rpm for 1 h.
    4. Spread the mixed culture (200 µL) onto induction media plates supplemented with 15 mM glucose and incubate at 21-25 °C in the dark for 3 days.
    5. After 3 days, use 10 mL of TAP media supplemented with 400 mg/L cefotaxime or 20 mg/L of tetracycline (see Table of Materials) to collect the microalgae and incubate in the dark at 21-25 °C for 2 days to eliminate A. tumefaciens from the culture.
    6. Plate 500 µL of the culture onto selective media, e.g., TAP media supplemented with 20-70 mg/L of Hygromycin B (when using pCAMBIA1302) and 400 mg/L-1 cefotaxime or 20 mg/L of tetracycline. Incubate 21-25 °C in the dark for 2 days before placing them in an illuminated chamber.
      NOTE: Resistant colonies will appear 5-7 days after light exposure.
    7. Pick single colonies from the transformation plate and re-streak them on TAP agar plates supplemented with 400 mg/L of cefotaxime or 20 mg/L of tetracycline and 20-70 mg/L of Hygromycin B.

4. Colony PCR (cPCR) to confirm gene integration in C. vulgaris transformants

  1. Extract genomic DNA from a C. vulgaris transformant after subculturing at least twice from a single colony using a plant genomic DNA extraction kit (see Table of Materials). Using this as a template for PCR, design primers for the mgfp5 region of the T-DNA (mgfp5-Fwd: 5' CCCATCTCATAAATAACGTC 3', and M13-Rev: 5' CAGGAAACAGCTATGAC 3').
    1. Using a Q5 high-fidelity DNA polymerase master mix kit (see Table of Materials), perform polymerase chain reaction (PCR) to validate transgene integration.
      NOTE: The following conditions were used for the present study: 98 °C for 3 min; 35 cycles (98 °C for 10 s, 57 °C for 30 s, 72 °C for 1 min); 72 °C for 5min. Use pCAMBIA1302 as a positive control and wild-type C. vulgaris genomic DNA as a negative control.
  2. To confirm that there is no pCAMBIA1302 present in the sample due to residual contamination by A. tumefaciens, use colony PCR. Add a small amount of transformant cells to 10 µL of sterile water and boil at 98 °C for 15 min. Use this as a template for PCR.
    1. Design primers for a region outside of the T-DNA on pCAMBIA1302 (B1-Fwd: 5'AGTAAAGGAGAAGAACTTTTC 3' and B1-Rev: 5'CCTGATGCGGTATTTTCTC 3').
      NOTE: The following conditions were used for the present study: 94 °C for 3 min; 30 cycles (94 °C for 30 s, 48 °C for 30 s, 68 °C for 5 min); 68 °C for 7 min. Use a boiled colony of A. tumefaciens AGL-1 (pCAMBIA1302) as a positive control and a boiled colony of wild-type C. vulgaris as a negative control.
  3. To confirm that there is no A. tumerfaciens contamination present in the sample, use colony PCR. Add a small amount of transformant cells to 10 µL of sterile water and boil at 98 °C for 15 min. Use this as a template for PCR.
    1. Design primers for the virE2 gene contained on the AGL-1 virulence plasmid (virE2-Fwd: 5' AGGGAGCCCTACCCG 3' and virE2-Rev: 5' GAACCAGCCTGGAGTTCG 3').
      NOTE: The following conditions were used for the present study: 94 °C for 3 min; 30 cycles (94 °C for 30 s, 53 °C for 30 s, 68 °C for 3 min); 68 °C for 7 min. Use a boiled colony of A. tumefaciens AGL-1 (pCAMBIA1302) as a positive control and a boiled colony of wild-type C. vulgaris as a negative control.
  4. Run PCR samples on a DNA agarose gel along with a ladder (1 Kbp DNA ladder, see Table of Materials) to confirm the size of the resulting fragments16.

5. Measuring the fluorescence of transformants

  1. Inoculate each transformant from a log-phase maintenance culture or TAP agar slant into 50 mL of TAP supplemented with 200 mg/L-1 cefotaxime and 25 mg/L-1 Hygromycin B such that the starting OD600 = 0.1. Inoculate one culture with wild-type C. vulgaris and only 200 mg/L-1 cefotaxime as the negative control. Incubate at 25 °C at 150 rpm with 150 µmol/m2s of photosynthetically active light (see Table of Materials).
  2. Every 24 h, take a 300 µL of sample and measure the absorbance and fluorescence (excitation 488 nm, emission 526 nm) in a 96-well plate reader or UV/Vis spectrometer and fluorometer (see Table of Materials). Use a black plate with a transparent bottom for simultaneous measurements.

6. Crude protein extraction, protein purification, and SDS-PAGE electrophoresis

  1. Inoculate transformant (#50) from a log-phase maintenance culture into 300 mL of TAP supplemented with 200 mg/L-1 cefotaxime and 25 mg/L-1 Hygromycin B to reach the OD680 = 0.1. Inoculate one culture with wild-type C. vulgaris and only 200 mg/L-1 cefotaxime as the negative control. Incubate at 25 °C at 150 rpm with 150 µmol/m2s of photosynthetically active light.
  2. Extract the crude protein sample from the transformant (#50) and wild-type strains using 5 mL lysis buffer (see Table 1), followed by sonication for 4 min.
  3. Purify crude protein sample with a Ni-NTA resin through 5 mL polypropylene columns (see Table of Materials).
  4. Lyophilize the 15 mL purified protein samples and resuspend them in 1 mL lysis buffer for SDS-PAGE analysis17.

Access restricted. Please log in or start a trial to view this content.

Results

To show successful transformation using the method above, C. vulgaris was cocultured with either AGL-1 containing the pCAMBIA1302 plasmid or without the plasmid (wild-type and plated on TAP agar supplemented with Hygromycin B and cefotaxime (Figure 1A). The leftmost plate shows the transformed colonies capable of growth on Hygromycin B/cefotaxime plates, and the middle plate shows that wild-type AGL-1 cannot grow on the Hygromycin B/cefotaxime plates. The rightmost plate shows that ...

Access restricted. Please log in or start a trial to view this content.

Discussion

The efficiency of transformation is associated with several different parameters. The choice of A. tumefaciens strains used for AMT is crucial. AGL-1 is one of the most invasive strains discovered and, for this reason, has been routinely used in plant AMT. Supplementing the induction media with glucose (15-20 mM) is also important for AMT efficiency. Considering C. vulgaris can grow in both phototrophic and heterotrophic conditions, glucose or other carbon sources are often omitted from microalgae media...

Access restricted. Please log in or start a trial to view this content.

Disclosures

No conflicts of interest were declared.

Acknowledgements

The authors would like to thank Prof. Paul Hooykaas for kindly providing the pCAMBIA1302 vector and Agrobacterium tumefaciens AGL1 from the Institute of Biology Leiden, Leiden University, the Netherlands. The authors would also like to thank Eva Colic for her help in growing the fluorescent transformants. This work was funded by the Natural Sciences and Engineering Research Council of Canada and the Mitacs Accelerate program.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1 Kb Plus DNA ladderFroggaBioDM015
AcetosyringoneFisher ScientificD26665G
Agrobacterium tumefaciensGold BiotechnologiesStrain: AGL-1; Gift from Prof. Paul HooykaasGenotype: C58 RecA (RifR/CarbR) pTiBo542DT-DNA
BiotinEnzo Life Sciences89151-400
CaCl2·2H2OVWRBDH9224-1KG
CefotaximeAK ScientificJ90010
Chlorella vulgarisUniversity of Texas at Austin Culture Collection of AlgaeStrain: UTEX 395Wildtype strain
CoCl2·6H2OSigma AldrichC8661-25G
CuSO4·5H2OEMD MilliporeCX2185-1
FeCl3·6H2OVWRBDH9234-500G
Gene Pulser Xcell ElectroporatorBio-Rad1652662Main unit equipped with PC module.
GeneJET Plant Genome Purification KitThermo ScientificK0791
Glacial acetic acidVWRCABDH3093-2.2P
GlycerolBioBasicGB0232
HEPES BufferSigma AldrichH-3375
Hygromycin BFisher ScientificAAJ6068103
K2HPO4VWRBDH9266-500G
KanamycinGold BiotechnologiesK-250-25
KH2PO4VWRBDH9268-500G
MgSO4·7H2OVWR97062-134
MnCl2·4H2OJT BakerBAKR2540-01
Na2CO3VWRBDH7971-1
Na2EDTA·2H2OJT Baker8993-01
Na2MoO4·2H2OJT BakerBAKR3764-01
NaClVWRBDH7257-7
NaH2PO4 H2OMillipore SigmaCA80058-650
NaNO3 VWRBDH4574-500G
NEBExpress Ni ResinNewEngland BioLabsNEB #S1427
NH4ClVWRBDH9208-500G
pCAMBIA1302Leiden UniversityGift from Prof. Paul HooykaaspBR322, KanR, pVS1, T-DNA(CaMV 35S/HygR/CaMV polyA, CaMV 35S promoter/mgpf5-6xhis/NOS terminator)
Polypropylene Columns (5 mL)QIAGEN34964
Precision Plus Protein Unstained Protein Standards, Strep-tagged recombinant, 1 mLBio-Rad1610363
RifampicinMillipore SigmaR3501-1G
SunBlaster LED Strip Light 48 Inch SunBlaster210000000906
Synergy 4 Microplate UV/Vis spectrometer BioTEKS4MLFPTA
TetracyclineThermo Scientific ChemicalsCAAAJ61714-14
TGX Stain-Free FastCast Acrylamide Kit, 12%Bio-Rad1610185
ThiamineTCI AmericaT0181-100G
Tris BaseFisher ScientificBP152-500
TryptoneBioBasicTG217(G211)
Vitamin B12 (cyanocobalamin)Enzo Life Sciences89151-436
Yeast ExtractBioBasicG0961
ZnSO4·7H2OJT Baker4382-01

References

  1. Smith, E. F., Townsend, C. O. A plant tumor of bacterial origin. Science. 25 (643), 671-673 (1907).
  2. Chilton, M. D., et al. Stable incorporation of plasmid DNA into higher plant cells: The molecular basis of tumorigenesis. Cell. 11 (2), 263-271 (1977).
  3. De Cleene, M., De Ley, J. The host range of crown gall. The Botanical Review. 42, 389-466 (1976).
  4. Hooykaas, P. J., Schilperoort, R. A. Agrobacterium and plant genetic engineering. Plant Molecular Biology. 19, 15-38 (1992).
  5. Bundock, P., den Dulk-Ras, A., Beijersbergen, A., Hooykaas, P. J. J. Transkingdom T-DNA transfer from Agrobacterium tumefaciens to Saccharomyces cerevisiae. The European Molecular Biology Organization. 14 (13), 3206-3214 (1995).
  6. Piers, K. L., Heath, J. D., Liang, X., Stephens, K. M., Nester, E. W. Agrobacteriumtumefaciens-mediated transformation of yeast. Proceedings of the National Academy of Sciences of the United States of America. 93 (4), 1613-1618 (1996).
  7. Kumar, S. V., Misquitta, R. W., Reddy, V. S., Rao, B. J., Rajam, M. V. Genetic transformation of the green alga-Chlamydomonas reinhardtii by Agrobacteriumtumefaciens. Plant Science. 166 (3), 731-738 (2004).
  8. de Groot, M. J., Bundock, P., Hooykaas, P. J., Beijersbergen, A. G. Agrobacteriumtumefaciens-mediated transformation of filamentous fungi. Nature Biotechnology. 16 (9), 839-842 (1998).
  9. Hajdukiewicz, P., Svab, Z., Maliga, P. The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Molecular Biology. 25 (6), 989-994 (1994).
  10. Dehghani, J., Adibkia, K., Movafeghi, A., Pourseif, M. M., Omidi, Y. Designing a new generation of expression toolkits for engineering of green microalgae; robust production of human interleukin-2. BioImpacts. 10 (4), 259-268 (2020).
  11. Berndt, A. J., Smalley, T. N., Ren, B., Simkovsky, R., Badary, A., Sproles, A. E., Fields, F. J., Torres-Tiji, Y., Heredia, V., Mayfield, S. P. Recombinant production of a functional SARS-CoV-2 spike receptor binding domain in the green algae Chlamydomonas reinhardtii. PLoS One. 16, e0257089(2021).
  12. Li, A., Huang, R., Wang, C., Hu, Q., Li, H., Li, X. Expression of anti-lipopolysaccharide factor isoform 3 in Chlamydomonas reinhardtii showing high antimicrobial activity. Marine Drugs. 19 (5), 239(2021).
  13. Xue, B., Dong, C. M., Hu, H. H., Dong, B., Fan, Z. C. Chlamydomonas reinhardtii-expressed multimer of ToAMP4 inhibits the growth of bacteria of both Gram-positive and Gram-negative. Process Biochemistry. 91, 311-318 (2020).
  14. Khan, M. I., Shin, J. H., Kim, J. D. The promising future of microalgae: current status, challenges, and optimization of a sustainable and renewable industry for biofuels, feed, and other products. Microbial Cell Factories. 17, 36(2018).
  15. Cha, T. S., Yee, W., Aziz, A. Assessment of factors affecting Agrobacterium-mediated genetic transformation of the unicellular green alga, Chlorella vulgaris. World Journal of Microbiology and Biotechnology. 28, 1771-1779 (2012).
  16. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. Journal of Visualized Experiments. (62), e3923(2012).
  17. A Guide to Polyacrylamide Gel Electrophoresis and Detection. Bulletin 6040, Rev C. , Bio-Rad Laboratories Inc. Accessed March (2023).
  18. NEBExpress Ni Resin Gravity Flow Typical Protocol. , New England Biolabs Inc. Accessed March https://international.neb.com/protocols/2019/09/10/nebexpress-ni-resin-gravity-flow-typical-protocol (2023).
  19. Ward, V. C. A., Rehmann, L. Fast media optimization for mixotrophic cultivation of Chlorella vulgaris. Scientific Reports. 9, 19262(2019).
  20. Morton, E. R., Fuqua, C. Laboratory maintenance of Agrobacterium. Current Protocols in Microbiology. Chapter 1: Unit 3D.1. , (2012).
  21. Haddadi, F., Abd Aziz, M., Abdullah, S. N., Tan, S. G., Kamaladini, H. An efficient Agrobacterium-mediated transformation of strawberry cv. Camarosa by a dual plasmid system. Molecules. 20 (3), 3647-3666 (2015).
  22. Wang, X., Ryu, D., Houtkooper, R. H., Auwerx, J. Antibiotic use and abuse: a threat to mitochondria and chloroplasts with impact on research, health, and environment. Bioessays. 37 (10), 1045-1053 (2015).
  23. Gelvin, S. B. Plant DNA repair and Agrobacterium T-DNA integration. International Journal of Molecular Sciences. 22 (16), 8458(2021).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Microalgal TransformationAMT ProtocolGreen Fluorescent ProteinHygromycin B SelectionPlant Expression VectorStable TransformationMicroalgal Biotechnology