A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

In Planta Gene Expression and Gene Editing in Moso Bamboo Leaves

2.7K views

DOI:

10.3791/65799

August 18th, 2023

In This Article

Summary

In this study, a novel in planta gene expression and gene editing method mediated by Agrobacterium was developed in bamboo. This method greatly improved the efficiency of gene function validation in bamboo, which has significant implications for accelerating the process of bamboo breeding.

Abstract

A novel in planta gene transformation method was developed for bamboo, which avoids the need for time-consuming and labor-intensive callus induction and regeneration processes. This method involves Agrobacterium-mediated gene expression via wounding and vacuum for bamboo seedlings. It successfully demonstrated the expression of exogenous genes, such as the RUBY reporter and Cas9 gene, in bamboo leaves. The highest transformation efficiency for the accumulation of betalain in RUBY seedlings was achieved using the GV3101 strain, with a percentage of 85.2% after infection. Although the foreign DNA did not integrate into the bamboo genome, the method was efficient in expressing the exogenous genes. Furthermore, a gene editing system has also been developed with a native reporter using this method, from which an in situ mutant generated by the edited bamboo violaxanthin de-epoxidase gene (PeVDE) in bamboo leaves, with a mutation rate of 17.33%. The mutation of PeVDE resulted in decreased non-photochemical quenching (NPQ) values under high light, which can be accurately detected by a fluorometer. This makes the edited PeVDE a potential native reporter for both exogenous and endogenous genes in bamboo. With the reporter of PeVDE, a cinnamoyl-CoA reductase gene was successfully edited with a mutation rate of 8.3%. This operation avoids the process of tissue culture or callus induction, which is quick and efficient for expressing exogenous genes and endogenous gene editing in bamboo. This method can improve the efficiency of gene function verification and will help reveal the molecular mechanisms of key metabolic pathways in bamboo.

Introduction

The investigation of gene function in bamboo holds great promise for the advanced understanding of bamboo and unlocking its potential for genetic modification. An effective way of this can be achieved through the process of Agrobacterium-mediated infection in bamboo leaves, whereby the T-DNA fragment containing exogenous genes is introduced into the cells, subsequently leading to the expression of the genes within the leaf cells.

Bamboo is a valuable and renewable resource with a wide range of applications in manufacturing, art, and research. Bamboo possesses excellent wood properties such as high mechanical strength, toughness, moderate stiffness, and flexibility1, which is now widely used in a variety of household and industrial supplies, including toothbrushes, straws, buttons, disposable tableware, underground pipelines, and cooling tower fillers for thermal power generation. Therefore, bamboo breeding plays a crucial role in obtaining bamboo varieties with excellent wood properties for replacing plastics and reducing plastic usage, protecting the environment, and tackling climate change, as well as generating significant economic value.

However, traditional bamboo breeding faces challenges due to the lengthy vegetative growth stage and uncertain flowering period. Although molecular breeding techniques have been developed and applied to bamboo breeding, the process of bamboo gene transformation is time-consuming, labor-intensive, and complicated due to the callus induction and regeneration processes2,3,4,5. Stable genetic transformation often requires Agrobacterium-mediated methods, which involve tissue culture processes such as callus induction and regeneration. However, bamboo has a low ability for callus regeneration, greatly limiting the application of stable genetic transformation in bamboo. After Agrobacterium infects plant cells, the T-DNA fragment enters the plant cells, with the majority of T-DNA fragments remaining non-integrated in the cells, resulting in transient expression. Only a small portion of T-DNA fragments randomly integrate into its chromosome, leading to stable expression. The transient expression levels show an accumulation curve that can vary for each gene expressed from an Agrobacterium-delivered T-DNA. In most cases, the highest expression levels occur 3-4 days after infiltration and quickly decrease after 5-6 days6,7. Previous studies have shown that more than 1/3rd of mutations in gene-edited plants obtained without selection pressure for resistance come from the transient expression of CRISPR/Cas9, while the remaining less than 2/3rd come from stable expression after DNA integration into the genome8. This indicates that T-DNA integration into the plant genome is not necessary for gene editing. Moreover, selection pressure for resistance significantly inhibits the growth of non-transgenic cells, directly affecting the regeneration process of infected explants. Therefore, by using transient expression without selection pressure for resistance in bamboo, it is possible to achieve non-integrated expression of exogenous genes and study gene function directly in plant organs. Hence, an easy and time-saving method can be developed for exogenous gene expression and editing in bamboo9.

The developed exogenous gene expression and gene editing method is characterized by its simplicity, cost-effectiveness, and the absence of expensive equipment or complex procedures9. In this method, the bamboo endogenous violaxanthin de-epoxidase gene (PeVDE) was used as the reporter for exogenous gene expression without selection pressure. This is because the edited PeVDE in bamboo leaves reduces the photoprotection ability under high light and demonstrates a decrease in the non-photochemical quenching (NPQ) value, which can be detected through chlorophyll fluorescence imaging. To demonstrate the effectiveness of this method, another bamboo endogenous gene, the cinnamoyl-CoA reductase gene (PeCCR5)9, was knocked out using this system and successfully generated mutants of this gene. This technique can be used for the functional characterization of genes that have functions in bamboo leaves. By overexpressing these genes transiently in bamboo leaves, their expression levels can be enhanced, or by gene editing, their expression can be knocked down, allowing for the study of downstream gene expression levels, leaf phenotypes, and product contents. This provides a more efficient and feasible approach for gene function research in bamboo. This technique can be applied to the functional characterization of genes that function in bamboo leaves. By overexpressing these genes transiently in bamboo leaves, their expression levels can be enhanced, or by gene editing, their expression can be knocked down, allowing for the study of downstream gene expression levels, leaf phenotypes, and product contents. Additionally, it is important to note that, due to extensive polyploidization, the majority of commercially important genes in bamboo genomes are present in multiple copies, resulting in genetic redundancy. This poses a challenge for performing multiplex genome editing in bamboo. Prior to the application of stable genetic transformation or gene editing techniques, it is crucial to quickly validate gene functions. In addressing the issue of multiple gene copies, one approach is to analyze transcriptome expression profiles to identify genes that are actively expressed during specific stages. Furthermore, targeting the conserved functional domains of these gene copies allows for the design of common target sequences or the incorporation of multiple target sites into the same CRISPR/Cas9 vector, enabling the simultaneous knockout of these genes. This provides a more efficient and feasible approach for gene function research in bamboo.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Preparation of bamboo seedlings

  1. Prepare moso bamboo (Phyllostachys edulis) seedlings using seeds harvested in Guilin, Guangxi, China. Begin by soaking the seeds in water for 2-3 days, making sure to change the water daily. Next, create a substrate by mixing soil and vermiculite in a ratio of 3:1.
  2. Sow the soaked seeds into the substrate for germination. Maintain the seedlings under laboratory conditions, keeping the temperature between 18-25 °C. Ensure a 16 h light/8 h dark photoperiod with a light intensity of 250-350 µmol/m2/s during the light phase.
  3. Maintain a relative humidity of approximately 60%. For Agrobacterium-infection, use seedlings that are 15 days old and have a height of 2-10 cm, which is the best stage for transformation.
    NOTE: Because bamboo flowering is unpredictable, seeds are not available every year. The seeds are usually stored for 2-3 years at 4 °C in a dry environment and can still maintain a viability of over 20%.

2. Preparation of plasmids and  Agrobacterium

  1. Plasmids: To validate the transient expression effect, employ the pHDE-35S::RUBY construct containing a visible reporter gene driven by the CaMV 35S promoter10. For gene editing, use the pCambia1300-Ubi::Cas9 construct, which carries the Cas9 gene driven by the maize Ubi promoter11. Insert the sgRNA guiding sequences of PeVDE and other target genes between the two AarI sites in the pCambia1300-Ubi::Cas9 construct9.
  2. Insert the CRISPR/Cas9 guide RNA sequences between the two AarI restriction endonuclease sites of the pCambia1300-Ubi::Cas9 construct, including PeVDE and PeCCR5 target genes.
  3. Add GGCA to the 5' end of the 20-nucleotide sequence and synthesize a single-stranded DNA sequence. Reverse complement the 20-nucleotide sequence and add AAAC to the 5' end, then synthesize another single-stranded DNA sequence.
  4. Dilute both single-stranded DNA sequences to a concentration of 10 nM/L in diluted water, mix thoroughly, and heat at 95 °C for 5 min. Allow the mixture to cool to room temperature, resulting in the formation of double-stranded adapters.
  5. Connect the adapters with the linear pCambia1300-Ubi::Cas9 fragment digested by AarI endonuclease using T4 DNA ligase and sequence the constructed CRISPR/Cas9 vector to obtain the desired gene-targeting construct.
  6. To transform plasmids into Agrobacterium, use the freeze-thaw method as follows: Mix 1 µL of the plasmids (concentration: 10 - 1,000 ng/µL) with 100 µL of Agrobacterium-competent cells (translation efficiency: > 1 x 104 colony-forming-units/µg) and gently mix them. Place the mixture on ice for 5 min. Transfer the mixture to liquid nitrogen for 5 min.
  7. Thaw the mixture in a 37 °C water bath for 5 min. Add 500 µL of Luria-Bertani (LB) medium to the mixture and incubate it on a shaking incubator at 28 °C at 200 rpm for 2-3 h. For the pHDE-35S::RUBY plasmids, introduce them individually into the AGL1, GV3101, LBA4044, and EHA105 strains of Agrobacterium tumefaciens (A. tumefaciens)12. For the CRISPR/Cas9 plasmids, introduce them into the GV3101 strain of A. tumefaciens.
  8. Grow Agrobacterium in yeast extract peptone (YEP) medium (10 g beef extract, 10 g yeast extract, and 5 g NaCl per L) with the corresponding antibiotics (spectinomycin for 35S::RUBY and kanamycin for CRISPR/Cas9) at 28 °C. The single colonies were observed 36-48 h after cultivation.
  9. Pick and transfer the colonies into liquid YEP medium (with corresponding antibiotics) for further growth. After 24-36 h, use the primers of RUBY-F and RUBY-R (Table 1) to perform PCR to confirm the successful transfer of plasmids into Agrobacterium.
  10. Transfer 1 mL of the successfully transformed Agrobacterium into 100 mL of fresh liquid YEP medium (with corresponding antibiotics) and then grow overnight at 28 °C to an OD600 of 0.8.
  11. Centrifuge the bacterial suspension at 4,000 x g for 5 min at 4 °C, wash the bacterial pellet once with suspensions infiltration medium (10 mM MgCl2 and 10 mM MES-KOH [pH 5.6]), and then centrifuge again. Resuspend the bacterial pellet in a suspension infiltration medium to an OD600 of 0.6 for bamboo transformation.

3. Agrobacterium -mediated in planta transformation system

  1. Prepare for transformation; carefully remove the seedlings with soil-attached roots from the substrate, ensuring the roots remain intact. Wrap the seedlings with tin foil to maintain moisture and prevent soil detachment (Figure 1A).
  2. Transfer the wrapped seedlings to an environment with higher humidity (relative air humidity >90%) and lower illumination (intensity less than 50 µmol/m2/s) for a duration of 2 h.
  3. Using a sharp needle from a syringe, wound the upper part of curled immature leaves (approximately 1-2 cm from the top) of the bamboo seedlings once or twice (as indicated by the red triangles in Figure 1A).
  4. Afterward, dip the wounded upper part of the seedlings into suspensions of Agrobacterium. Perform the entire process, from wounding to dipping into Agrobacterium rapidly, as the fresh wound will increase inoculation efficiency.
  5. Immediately transfer the seedlings to a vacuum chamber with a pressure of 25-27 mmHg for 2 min (Figure 1B).
  6. After vacuuming, carefully unwrap the seedlings and replant them into the substrate. Place the seedlings in dim light or darkness (<50 µmol/m2/s) with high humidity (RH>90%) at room temperature (18-25 °C) for 2 days. Subsequently, culture the seedlings under normal growth conditions, watering them every 5-7 days. Observe their phenotypes to provide materials for subsequent experiments.

4. Designing single guide RNAs (sgRNAs) for gene editing

  1. Identify a protospacer adjacent motif (PAM) site located near a specific and conserved domain of the target gene sequence. Ensure that the specific PAM sequence is NGG in this CRISPR/Cas9 system. Verify the on-target specificity of the selected sequence by performing a BlastN search against the bamboo genome database. Ensure that the sgRNA is unique, especially in the upstream region and close to the PAM9,11.
    NOTE: This comparison will effectively reduce potential off-target sites in the genome affected by the gene-editing process.
  2. Design two sgRNAs (sgRNA-1 and sgRNA-2) on the first exon of the PeVDE gene13. Include AgeI restriction sites upstream of the PAM in sgRNA-1 and XbaI restriction sites upstream of the PAM in sgRNA-2. Design one sgRNA on the fourth exon of the PeCCR5 gene, which encodes the conserved motif of KNWYCYGK. This motif is critical for the catalysis of CCRs14.
  3. Design a 20 nucleotide spacer sequence adjacent to the PAM site. This spacer sequence will guide the Cas9 enzyme to the target site for DNA cleavage and subsequent gene editing.
    ​NOTE: It is advisable to choose a target region upstream of the endonuclease enzyme cleavage site within the PAM site. This will facilitate the validation of gene editing efficiency.

5. Primer design and PCR

  1. Manually design specific primers for amplification of the PeVDE and PeCCR5 fragments. Design the upstream and downstream primers to be located at least 100 bp outside the target site, with a length difference of over 100 bp to allow for distinct band separation during electrophoresis. Design primers for amplification of RUBY within the first 500 bp of the gene. A list of all primers used is provided in Table 1.
  2. Use a high-fidelity DNA polymerase for PCR. In this case, utilize DNA polymerase with high fidelity and efficient amplification in gene cloning.
  3. Prepare the PCR reaction mixture as follows: 5x buffer (Mg2+ Plus): 4 µL; dNTP mixture (2.5 mM each): 1.6 µL; Forward and reverse primers (10 pmol each): 1 µL each; bamboo genome DNA (approximately 50 ng); DNA Polymerase (2.5 U/µL): 0.2 µL; Dilute water to a total volume of 20 µL.
  4. Follow the PCR running conditions: Initial denaturation at 98 °C for 5 min; Denaturation at 98 °C for 10 s; Annealing at 56 °C for 5 s; Extension at 72 °C for 30 s; Repeat denaturation to extension for 32 cycles; Final extension at 72 °C for 5 min; Hold at 4 °C indefinitely.
    ​NOTE: PCR conditions are provided as an example and may need to be optimized for specific applications or targets.

6. DNA extraction, endonuclease enzyme digestion, and sequencing

  1. Separate the region with lower NPQ values from fresh bamboo leaf blades using scissors, as identified by the imaging-PAM fluorometer (refer to step 7.4). Freeze the leaf samples with liquid nitrogen and transfer the frozen leaf samples into a mortar. Grind the samples into a fine powder using a pestle, adding enough liquid nitrogen during the grinding process. This step helps in releasing the cellular content, including DNA.
  2. Extract genomic DNA from the powdered leaf using the Cetyltrimethylammonium Ammonium Bromide (CTAB) method. Add 50 mg of leaf powder samples to 800 µL of a 2% CTAB solution. Mix the sample thoroughly and incubate at 65 °C for 30 min, with gentle shaking every 5 min.
  3. Add an equal volume of chloroform/isoamyl alcohol (24:1, v/v) and vigorously shake the mixture. After centrifugation at 8,000 g for 8 min, transfer the supernatant to a new tube.
  4. Add an equal volume of chloroform/isoamyl alcohol and repeat step 6.3. Add an equal volume of ice-cold isopropanol, and invert the tube several times before being placed at -20 °C for 30 min. After centrifugation at 8,000 x g for 5 min, discard the supernatant.
  5. Wash the DNA pellet 2x with 75% ethanol at 4 °C, then dissolve in 50 µL of water.
  6. Amplify the genomic DNA containing the target site of the target genes from both wild-type and Agrobacterium-infected bamboo leaves with the protocol in step 5.4.
  7. Perform endonuclease enzyme digestion of the PCR products. Select a specific enzyme that recognizes the desired restriction sites within the amplified DNA fragments. Use AgeI and XbaI endonucleases for digestion.
  8. Prepare a reaction mixture consisting of AgeI or XbaI (20 units/µL)- 1 µL, 1 µg PCR products, 10x buffer- 5 µL, and add water to a total volume of 50 µL. Incubate at 37 °C for 1 h.
  9. Analyze the proportion of digested DNA fragments using gel electrophoresis. Compare the digested fragments from the wild-type and Agrobacterium-infected samples to assess gene editing efficiency.
  10. Tag the transposase adapter TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG and GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG sequences to the 5' end of the forward and reverse primers, respectively, for the amplification of PeVDE and PeCCR5 fragments9,15. Use the protocol described in step 5.4 for amplification. Prepare the PCR products (before digestion) for deep sequencing.

7. Measurement of chlorophyll fluorescence of NPQ values in leaves

  1. Prior to the measurements, expose the bamboo seedlings to high light intensity conditions of 1200 µmol/m2/s for 2 h. This exposure increases the amount of absorbed light quantum and activates the photoprotection system in the leaves.
  2. Use an imaging-PAM fluorometer to measure the in vivo PS II chlorophyll fluorescence of bamboo leaves. Set the actinic light intensity to 800 µmol/m2/s for 6 min fluorescence measurements. During this period, apply a saturating pulse every 30 s to obtain chlorophyll fluorescence curves. The stable values of the curves will be used for calculations13.
  3. Calculate the non-photochemical quenching (NPQ) using the formula:
    NPQ = (Fm - Fm') / Fm'
    where Fm represents the maximum fluorescence in the dark-adapted state, and Fm' represents the maximum fluorescence in any light-adapted state.
  4. Monitor the NPQ values from the visual interface of the imaging software. The software allows real-time analysis and display of the fluorescence data, including the NPQ values.

Access restricted. Please log in or start a trial to view this content.

Results

Agrobacterium-mediated in planta gene expression in bamboo leaves
The RUBY reporter gene has been demonstrated to be effective in visualizing transient gene expression due to its ability to produce vivid red betalain from tyrosine10. In this study, Agrobacterium-mediated transformation was utilized to transiently express the exogenous RUBY gene in bamboo leaves (Figure 1). At  the 3rd days af...

Access restricted. Please log in or start a trial to view this content.

Discussion

This method significantly reduces the time required compared to traditional genetic transformation methods, which typically take 1-2 years, and achieves transient expression of exogenous genes and gene editing of endogenous genes within 5 days. However, this method has limitations as it can only transform a small proportion of cells, and the gene-edited leaves are chimeric and lack the ability to regenerate into complete plants. Nevertheless, this in planta gene expression and gene editing technology provides a ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that they have no competing interests.

Acknowledgements

The authors would like to thank the National Key Research and Development Program of China (Grant No. 2021YFD2200502), the National Natural Science Foundation of China (Grant No. 31971736) for the financial support.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
35S::RUBYAddgene, United States160908Plamid construct
Agrobacterium competent cells of GV3101, EHA105,LBA4404, and AGL1Biomed, ChinaBC304-01, BC303-01, BC301-01, and BC302-01For Agrobacterium infection
CTABSigma-Aldrich, United States57-09-0DNA extraction
Imaging-PAM fluorometerWalz, Effeltrich, GermanyDetect chlorophyll fluorescence of bamboo leaves
ImagingWinWalz, Effeltrich, GermanySoftware for Imaging-PAM fluorometer
Paq CI or Aar INEB, United StatesR0745SIncorporate the target sequence onto the CRISPR/Cas9 vector.
PrimeSTAR Max DNA polymeraseTakara, JapanR045QFor gene cloning
T4 DNA ligaseNEB, United StatesM0202VIncorporate the target sequence onto the CRISPR/Cas9 vector.

References

  1. Jiang, Z. H. World Bamboo and Rattan (in Chinese). , Liaoning Science and Technology Publishing House. Shenyang, China. (2002).
  2. Ye, S., et al. An efficient plant regeneration and transformation system of ma bamboo (Dendrocalamus latiflorus Munro) started from young shoot as explant. Frontiers in Plant Science. 8, 1298(2017).
  3. Ye, S., et al. Robust CRISPR/Cas9 mediated genome editing and its application in manipulating plant height in the first generation of hexaploid Ma bamboo (Dendrocalamus latiflorus Munro). Plant Biotechnology Journal. 18 (7), 1501-1503 (2020).
  4. Xiang, M., et al. Production of purple Ma bamboo (Dendrocalamus latiflorus Munro) with enhanced drought and cold stress tolerance by engineering anthocyanin biosynthesis. Planta. 254 (3), 50(2021).
  5. Huang, B., et al. An efficient genetic transformation and CRISPR/Cas9-based genome editing system for moso bamboo (Phyllostachys edulis). Frontiers in Plant Science. 13, 822022(2022).
  6. Lee, M. W., Yang, Y. Transient expression assay by agroinfiltration of leaves. Methods in Molecular Biology. 323, 225-229 (2006).
  7. Canto, T. Transient expression systems in plants: potentialities and constraints. Advances in Experimental Medicine and Biology. 896, 287-301 (2016).
  8. Chen, L., et al. A method for the production and expedient screening of CRISPR/Cas9-mediated non-transgenic mutant plants. Horticulture Research. 5, 13(2018).
  9. Sun, H., et al. A new biotechnology for in-planta gene editing and its application in promoting flavonoid biosynthesis in bamboo leaves. Plant Methods. 19 (1), 20(2023).
  10. He, Y., Zhang, T., Sun, H., Zhan, H., Zhao, Y. A reporter for noninvasively monitoring gene expression and plant transformation. Horticulture Research. 7 (1), 152(2020).
  11. Wang, C., Shen, L., Fu, Y., Yan, C., Wang, K. A simple CRISPR/Cas9 system for multiplex genome editing in rice. Journal of Genetics and Genomics. 42 (12), 703-706 (2015).
  12. McCormick, S., et al. Leaf disc transformation of cultivated tomato (L. esculentum) using Agrobacterium tumefaciens. Plant Cell Reports. 5 (2), 81-84 (1986).
  13. Lou, Y., et al. a violaxanthin de-epoxidase gene from moso bamboo, confers photoprotection ability in transgenic Arabidopsis under high light. Frontiers in Plant Science. 13, 927949(2022).
  14. Zhou, R., et al. Distinct cinnamoyl CoA reductases involved in parallel routes to lignin in Medicago truncatula. Proceedings of the National Academy of Sciences of the United States of America. 107 (41), 17803-17808 (2010).
  15. De Roeck, A., et al. Deleterious ABCA7 mutations and transcript rescue mechanisms in early onset Alzheimer's disease. Acta Neuropathologica. 134 (3), 475-487 (2017).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

In Planta TransformationBamboo Gene EditingAgrobacterium InfectionCRISPR Cas9RUBY ReporterPeVDE MutationVacuum InfiltrationChlorophyll Fluorescence