الملاحظة المباشرة من الحمض النووي الانزيمات تكرار استخدام الحمض النووي جزيء واحدة تمتد الفحص

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

نحن تصف طريقة لمراقبة حقيقية تكرار وقت جزيئات الحمض النووي الفردية بوساطة بروتينات للنظام عاثية تكرارها.

Cite this Article

Copy Citation | Download Citations

Kulczyk, A. W., Tanner, N. A., Loparo, J. J., Richardson, C. C., van Oijen, A. M. Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay. J. Vis. Exp. (37), e1689, doi:10.3791/1689 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

نحن تصف طريقة لمراقبة حقيقية تكرار وقت جزيئات الحمض النووي الفردية بوساطة بروتينات للنظام عاثية تكرارها. تم تعديل خطي λ الحمض النووي لديهم البيوتين على نهاية واحدة حبلا ، وشاردة digoxigenin على الطرف الآخر من نفس حبلا. ويرد في نهاية biotinylated إلى ساترة الزجاج functionalized ونهاية digoxigeninated إلى حبة صغيرة. تجميع هذه الحبال حبة الحمض النووي على سطح خلية تدفق يسمح ليتم تطبيقها على تدفق الصفحي لممارسة القوة اسحب على حبة. نتيجة لذلك ، ويمتد على مقربة من الحمض النووي وموازية لسطح ساترة في القوة التي يحددها معدل التدفق (الشكل 1). ويتم قياس طول الحمض النووي عن طريق رصد موقف حبة. وتستخدم طول الخلافات بين الحمض النووي المفرد الذين تقطعت بهم السبل ، ومضاعفة للحصول على معلومات في الوقت الحقيقي على النشاط المتماثل من البروتينات عند مفترق الطرق. قياس موقف يسمح حبة التحديد الدقيق لمعدلات وprocessivities من الحمض النووي الفك والبلمرة (الشكل 2).

Protocol

1. الحمض النووي المتماثل قالب

الحمض النووي للتفاعل هي DNA λ خطي تعديلها من قبل من الصلب [أليغنوكليوتيد] لتشكيل الشوكة تكرارها. بالإضافة إلى ذلك ، تعلق البيوتين إلى نهاية واحدة حبلا من الحمض النووي λ ، وتعلق شاردة digoxigenin إلى الطرف الآخر من نفس حبلا 1.

المواد : الجراثيم λ الحمض النووي ، [أليغنوكليوتيد] : biotinylated ذراع الشوكة (A : 5' - البيوتين AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC - 3 ') ، ذراع λ - التكميلية شوكة (B : 5' - GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA - 3') ، تفرع التمهيدي (C : 5 ' - 3 - TGCCATATCTGAAATCCTCCCTGC ') ، في نهاية digoxigenin λ - التكميلية (D : 5' - AGGTCG CCGCCCAAAAAAAAAAAA - digoxigenin - 3') ، يغاز DNA T4 ، T4 كيناز عديد النوكليوتيد ، وكتلة حرارية.

  1. Phosphorylate ينتهي 5 '[أليغنوكليوتيد] باء ودال به T4 كيناز عديد النوكليوتيد.
  2. يصلب [أليغنوكليوتيد] A ، B ، C وعلى الحمض النووي λ في خطوة واحدة عن طريق إضافة فائض بمقدار 10 أضعاف من [أليغنوكليوتيد] ألف وباء ، والفائض 100 - C حظيرة قليل النوكليوتيد في T4 DNA يغاز العازلة.
  3. حرارة الخليط إلى 65 درجة مئوية في كتلة الحرارة. يسخن مرة واحدة ، وتحويل الحرارة خارج كتلة والسماح لتبريد البطيء يصلب بشكل صحيح [أليغنوكليوتيد].
  4. إضافة T4 يغاز الحمض النووي لاحتضان والخليط في درجة حرارة الغرفة لمدة 2 ساعة. وسوف تحفز T4 يغاز DNA الصحيح انضمام [أليغنوكليوتيد] ألف وباء ، والحمض النووي λ.
  5. أخيرا ، يصلب D قليل النوكليوتيد على الحمض النووي القالب المتماثل بإضافة 100 أضعاف فائض قليل النوكليوتيد D فيما يتعلق الحمض النووي DNA لتر في T4 يغاز العازلة.
  6. احتضان الخليط في 45 درجة مئوية لمدة 30 دقيقة في كتلة الحرارة ، وتبرد ببطء إلى درجة حرارة الغرفة من خلال تحويل الحرارة خارج كتلة.
  7. تكرار الحمض النووي النهائي قالب جاهز الآن للاستخدام. نقوم بتخزين القالب عند تركيز قدره 1.4 نيوتن متر عند 4 درجات مئوية لعدة أسابيع.

2. الخرز

functionalized والخرز مع جزء فاب مع خصوصية لdigoxigenin. يمكن ثم يعلقونها على القالب 2 تناسخ الدنا.

المواد : Tosyl الخرز تفعيلها ، α - digoxigenin فاب شظية ، والاحتياطي : 0.1 M H3BO3 الرقم الهيدروجيني 9.5 ، B الاحتياطي : 0.1 M PBS الرقم الهيدروجيني 7.4 ، 0.1 ٪ ث / ت جيش صرب البوسنة ، العازلة C : 0.2 M - تريس حمض الهيدروكلوريك 8.5 درجة الحموضة (25 درجة C) ، 0.1 ٪ ث / ت جيش صرب البوسنة ، فاصل المغناطيسي ، الدوار.

  1. Resuspend محلول المخزون من الخرز ونقل قسامة صغيرة في الأنبوب إيبندورف. وضع أنبوب داخل فتحة الفاصل المغناطيسي واحتضان حتى حل مسح وإزالة ثم طاف بواسطة pipetting.
  2. إضافة العازلة والتي سيتم تنشيط المجموعات tosyl للاقتران الأضداد. المزيج بلطف وإزالة pipetting العازلة مع فاصل المغناطيسي.
  3. إضافة جزء فاب والخرز resuspend مرة أخرى في المخزن ألف ، مزيج دقيق ، واحتضان 16-24 ساعة عند 37 درجة مئوية باستخدام المدورة. بعد مرور فترة الحضانة ، وحبات منفصلة باستخدام الفاصل المغناطيسي وإزالة العازلة.
  4. تغسل حبات بإضافة العازلة وباء في احتضان 4 درجة مئوية لمدة 5 دقائق. إزالة العازلة باستخدام فاصل المغناطيسي. تكرار الغسيل مرتين.
  5. إضافة العازلة واحتضان C عند 37 درجة مئوية لمدة 4 ساعات لمنع جماعات tosyl الحرة. حبات منفصلة باستخدام فاصل المغنطيسي وإزالة العازلة.
  6. تغسل مرتين في B العازلة وقسامة للاستخدام. ويمكن تخزين حبات عند 4 درجة مئوية لمدة 1 سنة أو أطول من دون خسارة كبيرة للجودة (محلول يحتوي على مخزوننا 1 -- 2x10 9 حبات / مل).

3. Functionalized Coverslips

السماح للمرفق من الحمض النووي للساترة الزجاج ، والزجاج functionalized لأول مرة مع aminosilane ، الذي يقترن ثم إلى جزيئات PEG biotinylated. طلاء هذا يساعد على الحد من التفاعلات غير محددة من الحمض النووي والبروتينات المتماثل مع سطح 3،4.

المواد : coverslips زجاج الجرار يلطخ ، 3 - aminopropyltriethoxysilane ، استر ميثوكسي - PEG5k - NHS ، البيوتين PEG5k NHSester ، الأسيتون ، KOH 1M ، والإيثانول ، فرن sonicator باث ،

  1. بدقة تنظيف الزجاج coverslips عن طريق وضعها في تلطيخ الجرار وملء الجرار مع الايثانول. يصوتن لمدة 30 دقيقة ، شطف خارج الجرار وملء مع KOH M 1. كرر كل من يغسل.
  2. للتفاعل functionalization أولا ، كل أثر للمياه يجب أن يتم إزالتها. ملء الجرار مع الأسيتون ويصوتن لمدة 10 دقيقة. وملء فارغة مرة أخرى مع الأسيتون.
  3. إعداد 2 ٪ V / V حل كاشف سيلاني في الأسيتون. إضافة إلى تلطيخ الجرار وتستنهض الهمم لمدة 2 دقيقة. هذا رد فعل الأزواج المجموعة alkoxy من aminosilane على الزجاج ، وترك رد الفعل للأمين اقتران الخطوة المقبلة. إخماد التفاعل مع وجود فائض كبير من المياه.
  4. تجفيف coverslips بواسطة الخبز لهم في 110 درجة؛ C في الفرن لمدة 30 دقيقة.
  5. إعداد ميثوكسي 50:1 : البيوتين PEG الخليط في 100 درجة الحموضة 8.2 مم 3 NaHCO. تهدف لPEG ث / ت حوالي 0.2 ٪ biotinylated.
  6. ماصة 100 ميكرولتر من الخليط على PEG ساترة a silanized الجافة ومكان آخر ساترة على القمة. وبما في ذلك هل تسمح ساترة الزجاج العازل للcoverslips.
  7. لاحتضان coverslips في حل PEG لمدة 3 ساعات ، ثم فصل كل زوج من coverslips على نطاق واسع ، ويغسل بالماء. توخي الحذر للحفاظ على الجانب coverslips functionalized تصل كما سيتم المغلفة مرة واحدة فقط مع الجانب PEG.
  8. تجفيف coverslips مع الهواء وتخزينها تحت الفراغ في مجفف. أسطح تظل ثابتة لمدة شهر على الأقل ، حتى يمكن إجراء عشرات coverslips في دفعة واستخدامها عند الحاجة.

4. تدفق غرفة التحضير

يتم إجراء التجربة باستخدام غرفة تدفق بسيطة شيدت مع ساترة functionalized ، الشريط على الوجهين ، وشريحة الكوارتز الأنبوب. غرفة واحدة مستعدة لتدفق كل تجربة واحدة جزيء 2،4.

المواد : الشريط على الوجهين ، شفرة الحلاقة ، مرر الكوارتز مع ثقوب للأنابيب الإيبوكسي السريعة الجافة ، ساترة Functionalized ، streptavidin حل (25 ميكرولتر من 1 ملغ / مل في برنامج تلفزيوني) ، الأنابيب ، ومنع العازلة (5X : 20 ملم تريس الحموضة 7.5 ، 2 مم EDTA ، 50 مم كلوريد الصوديوم ، و 0.2 ملغ / مل جيش صرب البوسنة ، 0.005 ٪ توين - 20) ، عازلة العمل (1X : 20 ملم ، تريس حمض الهيدروكلوريك درجة الحموضة 7.5 ، 2 مم EDTA ، 50 مم كلوريد الصوديوم).

  1. تبدأ عن طريق خلط ووضع 5 مل من حجب العازلة و 20 مل من العمل العازلة في مجفف لإزالة أي فقاعات هواء لخطوات لاحقة.
  2. اتخاذ ساترة الربط بين functionalized وانتشار 125 من الحل streptavidin PBS - المخفف على السطح. اترك هذا لاحتضان لمدة 20 دقيقة في درجة حرارة الغرفة في حين تستعد أجزاء أخرى من الغرفة ، والسماح لربط streptavidin biotins السطح.
  3. قطع قطعة من الشريط على الوجهين ، لتتناسب مع حجم الشريحة الكوارتز. علامة الموقف من الثقوب أنابيب على الشريط بحيث يمكن استخلاص الخطوط العريضة للغرفة تدفق على الشريط.
  4. 3 جعل القناة مركز ملم واسعة وتحتوي على كل من المستطيلات الثقوب. نستخدم غرف مع اثنين من تدفق مدخل ومخرج قناتين Y الشكل.
  5. قطع على طول الخطوط العريضة تعادل جعل على التوالي ، وخفض نظيف للتأكد من عدم يبرز لاصقة في القناة.
  6. تنظيف الأسيتون الكوارتز بدقة باستخدام الإيثانول أو لإزالة اللاصق من البناء تدفق الخلية السابقة.
  7. العثور على أفضل محاذاة مخطط القناة ، وإزالة جانب واحد من دعم لاصقة والمكان بعناية الشريط على الشريحة الكوارتز. كن حذرا لمحاذاة الشريط بشكل صحيح ، والثقوب مدخل ومخرج ضرورة أن تبقى الافراج.
  8. قطع أطوال الأنابيب لمدخل ومخرج الخلية التدفق. فهو يساعد على خفض نهاية الأنبوب بنحو زاوية 30 درجة بحيث الأنبوب لن يضغط على شقة أسفل القاعة. وضع أنابيب على نوع من الدعم (رفوف أنبوب على سبيل المثال) لتعليق عليها لمرفق سهل الى خلية تدفق في الخطوات المقبلة.
  9. شطف ساترة streptavidin المغلفة جيدا بالماء والجافة باستخدام الهواء المضغوط. تذكر أن functionalized جانب واحد فقط. إزالة الجانب الآخر من الشريط النسخ ومكان على الشريحة الكوارتز وساترة.
  10. اضغط برفق على ساترة لطرد الهواء المحبوس في أي لاصقة. هذا سوف يساعد على تجنب أي فقاعات هواء الدخول في قناة التدفق.
  11. الختم على جانبي الغرفة مع الايبوكسي. تضاف قطع الأنابيب في الثقوب من الكوارتز والختم في مكان مع الايبوكسي. هذا يحتاج لتجف لبضع دقائق.
  12. الجاف مرة واحدة ، تبدأ حظر السطح عن طريق سحب بعض degassed عازلة تمنع من خلال واحدة من الأنابيب. إبرة عيار 21 يناسب تماما داخل الأنابيب 0.76 ملم. طرد عدة مرات لإزالة فقاعات الهواء ، والسماح للغرفة لاحتضان لمدة ساعة على الأقل النصف.

5. المفرد جزيء المتماثل التجربة

مرة واحدة وقد تم إعداد قالب الحمض النووي والخرز functionalized ، وغرفة تدفق مستعد ، يمكن إجراء تجربة أحادية الجزيء.

المواد : أعدت غرفة التدفق ، وحجب العازلة (5X : 20 ملم ، تريس حمض الهيدروكلوريك درجة الحموضة 7.5 ، 2 مم EDTA ، 50 مم كلوريد الصوديوم ، 1 ملغ / مل جيش صرب البوسنة ، 0.025 ٪ توين - 20) ، عازلة العامل (1X : 20 ملم ، تريس حمض الهيدروكلوريك الرقم الهيدروجيني 7.5 ، 2 مم EDTA ، 50 مم كلوريد الصوديوم) ، ومخازن T7 المتماثل مع أو بدون 10MM MgCl 2 (1X : 40 مم ، تريس حمض الهيدروكلوريك درجة الحموضة 7.5 ، K - 50 ملي الغلوتامات ، EDTA 2 ملم ، و 100 ميكروغرام / مل جيش صرب البوسنة ، و 10 ملي DTT و 600 ميكرومتر dNTPs) ، والبروتينات النسخ المتماثل ، المجهر الضوئي المقلوب مع الهدف 10X ، كاميرا CCD ، مغناطيس دائم الأرضية النادرة ، ومضخة الحقن ، airspring ، منار الألياف ، والكمبيوتر مع برنامج الحصول على الصور.

  1. بعد أن تم حظر تدفق الخلية ، وانها مستعدة لبدء التجربة.
  2. أخذ خلية تدفق ووضعه على المسرح المجهر. تعقد غرفة في مكان مع مقاطع المرحلةوتأكد أن يتم وضع قناة التدفق في المواءمة مع كاميرا CCD.
  3. منفذ توصيل أنابيب تدفق الخلية إلى airspring باستخدام أنابيب قطرها أكبر موصل أو إبرة. يستخدم airspring لتحقيق الاستقرار في تدفق أي مخالفات. يتم تعبئة أنبوب بلاستيكي 50 مل مع 45ml من الماء. وختم غطاء أنبوب مع الايبوكسي. واخترقت ثلاث فتحات في الغطاء ، ويتم إدراج ثلاث قطع من أنابيب داخل الأنبوب. باستخدام الايبوكسي ، ومختومة ثم أنابيب إلى غطاء ، ومنع أي تدخل أو الهواء من الفرار. توصيل airspring إلى ضخ حقنة ، ومنفذ للأنابيب من الخلية التدفق.
  4. وضع أنابيب مدخل الخلية في عرقلة تدفق العازلة وسحب على حقنة لإزالة أي الهواء في الأنبوب. وسوف نفض الغبار لطيف من الأنبوب مساعدة مخرج واضح أي فقاعات الهواء المحتبسة في الخلية التدفق.
  5. بمجرد أن تمت إزالة جميع فقاعات الهواء ، وكتلة واحدة من أنابيب مدخل بإبرة واحدة من الأنابيب منفذ عن طريق الانحناء أنه بحلول عام 1800 وتأمين الأنبوب بشريط لاصق.
  6. تمييع القالب الحمض النووي الأسهم إلى 22:00 في 1 مل من degassed العازلة حظر. تدفق الى غرفة بسعر معتدل للسماح بتدفق جيد تغطية السطح من الحمض النووي (0،01-0،05 مل / دقيقة لمدة 20 دقيقة تعمل بشكل جيد). يمكن أن تختلف هذه القائمة على مدى العديد من جزيئات الحمض النووي الموجودة على السطح في كل دفعة من coverslips أو كم هي المطلوبة للتجربة.
  7. تمييع الحل الأسهم حبة ل4x10 - 2 6 حبات / مل في 1 مل من degassed العازلة حظر. تدفق الى غرفة في 0،01-0،05 مل / دقيقة لمدة 15 دقيقة.
  8. مرة واحدة تضاف الخرز ، وتحويل تدفق خارج الغرفة والسماح للوصول إلى التوازن. ثم أغلق منفذ أنابيب على حد سواء. أغلق أية تغييرات على أنابيب دون الغرفة ستقوم تسبب تقلبات الضغط الذي سيمارس قوة القوي على الخرز والقص وجزيئات الحمض النووي المربوطة.
  9. كتلة مدخل الأنبوب الذي تم استخدامه لتحميل الخرز مع إبرة ، وتبدأ بغسل خلية تدفق باستخدام المدخل الثاني مع حل 1X degassed العازلة للحظر في المخزن العمل. يغسل على نطاق واسع بمعدل 0،01-0،05 مل / دقيقة. تستنهض الهمم يدويا من خلال استغلال مرحلة لإزالة أي الخرز nonspecifically عالقا على السطح ( التنصت ).
  10. حالما يتم إزالة كافية الخرز مجانا ، وتحويل تدفق قبالة الغرفة والسماح للوصول إلى التوازن. إغلاق أنبوب منفذ مفتوح وتبديل الخزان مدخل إلى حل البروتين ، وفتح منفذ ببطء لتجنب تغيرات الضغط السريع
  11. يمكنك معرفة ما اذا كان يتم المربوطة الخرز على الحمض النووي عن طريق تغيير اتجاه تدفق ( DNA ).
  12. الآن ، يمكن إجراء التفاعل الأنزيمي. التجارب الرائدة لتوليف الجديلة جعل من حل 20nM gp4 helicase والحل 20nM من gp5 بوليميريز (المنقى ومعقدة لها مع processivity thioredoxin عامل) في تكرار T7 degassed العازلة التي لا تحتوي على MgCl 2.
  13. تدفق الحل البروتين الى غرفة في معدل تدفق المعتدلة ملزم للسماح للكفاءة الحمض النووي. نستخدم 0.037 مل / دقيقة لمدة 8 دقائق ، وبعد ذلك. 0.012 مل / دقيقة لمدة 7 دقائق
  14. غسل الغرفة العازلة مع degassed دون تكرار T7 MgCl 2 لإزالة البروتينات الحرة. معدل 0.037 مل / دقيقة لل30-10 دقيقة يعمل بشكل جيد.
  15. بعد غسلها ، والنسخ T7 العازلة مع تدفق MgCl (2) وتبدأ الحصول على البيانات. استخدام معدل تدفق 0.012 مل / دقيقة الموافق 3 قوة السحب PN على الحبال الحمض النووي في ظل ظروف وصفها في هذا البروتوكول.
  16. وضع مغناطيس دائم الأرضية النادرة فوق خلية تدفق قبل التصوير لمنع التفاعلات غير محددة بين الخرز والسطحية.
  17. عرض الحقل مع هدف 10X وكاميرا CCD. التركيز باستخدام حبة المربوطة.
  18. موقف منار الألياف بزاوية 10 درجة بين الإصابة وموازية لمرحلة المجهر قرب المجهر. وتستخدم الإضاءة الداكنة مجال لزيادة التباين في التصوير حبة.
  19. الحصول على البيانات لمدة 20 30 دقيقة بمعدل بطيء الإطار (عادة 2-4 هرتز).

6. ممثل النتائج

في تجربة ناجحة يجب أن تكون قادرة على مراقبة أكثر من 100 في وقت واحد الخرز ( الرائد حبلا التوليف ). وينبغي أن تسفر هذه التجربة الرائدة التي تعرض العديد من آثار تركيب الحمض النووي حبلا.

تحليل البيانات :

من أجل قياس معدلات وprocessivities من الحمض النووي الفك والبلمرة ، لا بد من تحديد دقيق للمواقع الخرز. يمكنك تحقيق ذلك من خلال تركيب هذه المواقف مع وظائف غاوسي 2 الأبعاد. ويمكن بعد ذلك يتم استخراج المسارات التي تتبع موقف حبة في كل الإطار باستخدام برنامج تتبع (على سبيل المثال DiaTrack). أنت الآن على استعداد لرسم تصور مسارات بواسطة حبة موقف بوصفها وظيفة من الوقت باستخدام أي رسم ذلكftware (مثل المنشأ). للحصول على بيانات أسعار ، وصالح المؤامرات مع الانحدار الخطي وحساب المنحدر. لprocessivity ، وتحديد الطول الإجمالي من الحمض النووي من البداية الى النهاية لحدث تقصير (الشكل 3). سيكون كل من هذه الأرقام تحتاج إلى تحويلها إلى basepairs. لتحويل الحركة إلى حبة basepairs ، تحتاج أولا لقياس طول جزيء الحمض النووي λ امتدت على رد فعل معدل التدفق. ومن المعروف منذ مدة من الحمض النووي λ (48502 سنة مضت) ، يمكنك معايرة عدد من أزواج القاعدة / بكسل في القوة التجريبية. لزيادة الدقة ، وطرح من آثار الفائدة تتبع خط الأساس لحبة الحبل الذي لا يمكن تغييره إنزيمي. الجمع بين جميع القياسات واحد وسعر قطعة والتوزيعات processivity. احتواء البيانات باستخدام وظائف والتمويه واحد الأسي ، على التوالي (الشكل 3).

الشكل 1
الشكل 1. احدة جزيء الإعداد التجريبية. (أ) تعلق على الوجهين λ الحمض النووي (48.5 كيلوبايت) على سطح الخلية عبر تدفق 5 'نهاية واحدة حبلا باستخدام التفاعل streptavidin البيوتين ، و3' مرفقة نهاية حبلا نفسه باستخدام حبة digoxigenin مكافحة digoxigenin التفاعل. وشكلت لتكرار معبي الشوكة في نهاية المقابلة لحبة للسماح التحميل من بوليميريز. (ب) وامتدت الخرزة الدنا التجميعات باستخدام التدفق الصفحي من العازلة والتقط باستخدام المجهر واسعة المجال البصري. من خلال تتبع مواقف الخرز مع مرور الوقت ، مع الحفاظ على قوة ثابتة وتمتد ، ويمكن رصد أطوال يبني الحمض النووي. (ج) لمحة تمديد ssDNA (دائرة شغلها) وdsDNA (دائرة مفتوحة) في إطار قوات منخفضة. طول خط متقطع يظهر البلورات من الحمض النووي DS - λ كاملا ، و 16.3 ميكرون. الفرق كبير بين ssDNA في طول وdsDNA على القوات حول PN 3 يسمح الملاحظة المباشرة للتحويلات بين SS - dsDNA والتي رصد التغيرات في طول الحمض النووي. التصور المتزامن لأعداد كبيرة من الحمض النووي إلى جانب الخرز يسمح لدراسة replisomes فردية كثيرة في تجربة واحدة.

الشكل 2
الشكل 2 بروتينات الجراثيم T7 المتماثل : بوليميريز الحمض النووي (المعقدة وgp5 thioredoxin) والحمض النووي helicase (gp4) توليف حبلا الحمض النووي الرائدة في حضور deoxyribonucleotides والمغنيسيوم. ويرافق هذه العملية من خلال تقصير حبلا الحمض النووي متخلفة بسبب اللف. تحويل dsDNA تغييرات في الموقف ssDNA للحبة. قياس موقف يسمح حبة التحديد الدقيق لمعدل وprocessivity من تكرار الحمض النووي.

الشكل 3
الشكل 3. مثال نموذجي للبيانات من جزيء واحد الرائدة في الجديلة تجربة التوليف. Processivity من تكرار الحمض النووي يساوي طولها الإجمالي من الحمض النووي من البداية الى النهاية لحدث تقصير. يتم الحصول على معدل تكرار الحمض النووي عن طريق تركيب مؤامرة مع الانحدار الخطي وحساب المنحدر. معدل معارض أقحم processivity والتوزيعات التي تم الحصول عليها من خلال الجمع بين البيانات من عدد من القياسات. تم تركيب البيانات باستخدام وظائف والتمويه واحد الأسي ، على التوالي.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

من المهم التأكد من أن قوة السحب التي تمارس على تدفق الصفحي الخرز التي لا تؤثر على الأنشطة الأنزيمية للبروتينات تكرارها. على سبيل المثال ، قوة PN 3 الذي يتوافق مع معدل تدفق 0.012 مل / دقيقة لا تؤثر على تكرار حبلا الحمض النووي الرائدة. ومع ذلك فإنه لا يؤثر على الأنشطة الأنزيمية التي تحدث أثناء تركيب الحمض النووي منسقة ، وبالتالي له أن ينخفض ​​إلى 1.5 PN. يمكن أن تكون قوة السحب السيطرة عليها بسهولة من خلال تغيير معدل التدفق أو عرض القناة تدفق 5.

فحص الحمض النووي التي تمتد بطول توظف الخلافات بين الحمض النووي المزدوج والمفرد الذين تقطعت بهم السبل. في تجربة وصفها هنا تحويل dsDNA لssDNA يحدث نتيجة لتجميع حبلا الرائدة (الشكل 2). يجب أن نتذكر أن ssDNA أقصر من dsDNA فقط في انخفاض القوات تمتد أدناه PN 6 (الشكل 1).

ويمكن تحسين هذا الأسلوب هو تعديل متخلفة حبلا من القالب النسخ عن طريق ربط حبة الثانية لنهاية 3' التابعة لها. سوف تسمح هذه التناوب الملاحظة المباشرة للأنشطة الأنزيمية التي تجري في كل فروع من الحمض النووي.

وبصرف النظر عن الدراسات من التوليف حبلا الرائدة وتكرارها منسقة ، وقد تمتد فحص الحمض النووي لاستخدامها بنجاح لدراسة واحدة جزيء حركية λ نوكلياز خارجية ، وديناميات تبادل بوليميريز 5،6 أثناء النسخ المتماثل. من حيث المبدأ ، يمكن استخدام هذا الأسلوب لدراسة أي انزيم معالجة الحمض النووي.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

وقد ساعد تطور الحمض النووي التي تمتد مقايسة بلايني بول جونغ بونغ لي ، وسمير حمدان. ويؤيد هذا العمل من قبل المعاهد الوطنية للصحة منح لتشارلز ريتشاردسون (GM54397) ، وأنطوان فان Oijen (GM077248).

Materials

Name Company Catalog Number Comments
Bacteriophage λ DNA New England Biolabs N3011L
DNA Oligonucleotides Integrated DNA Technologies
T4 DNA Ligase New England Biolabs M0202L
T4 Polynucleotide Kinase New England Biolabs M0201L
α-digoxigenin Fab Roche Group 11214667001
Tosyl Activated Beads Invitrogen 142-03
Magnetic Separator Invitrogen Dynal MPC
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Inverted Optical Microscope with 10X Objective Olympus Corporation Olympus IX-51
Permament rare-earth magnet National Imports www.rare-earth-magnets.com
CCD Camera QImaging Rolera-XR Fast 139
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
Fiber Illuminator Thorlabs Inc. OSL1

DOWNLOAD MATERIALS LIST

References

  1. Lee, J. B. DNA primase acts as a molecular brake in DNA replication. Nature. 439, 621-624 (2006).
  2. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. Methods Mol Biol. 521, 397-410 (2009).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing single-molecule DNA replication with fluorescence microscopy. J Vis Exp. (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. van Oijen, A. M. Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder. Science. 301, 1235-1238 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics