Cellules endothéliales co-culture de maturation de la médiation de l'homme les cellules souches embryonnaires à des cellules productrices d'insuline du pancréas dans une approche différenciation dirigée

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

La présente étude décrit une approche différenciation dirigée dans l'induction de la différenciation du pancréas de cellules souches embryonnaires humaines. D'une grande importance est le fait que des cellules endothéliales de co-culture de maturation de la médiation sur les cellules souches embryonnaires humaines dérivées des progéniteurs pancréatiques en cellules exprimant l'insuline.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Les cellules souches embryonnaires (ESC) ont deux caractéristiques principales: elles peuvent être indéfiniment propagées in vitro dans un état ​​indifférencié et elles sont pluripotentes, ayant ainsi le potentiel de se différencier en plusieurs lignées. Ces propriétés font CES extrêmement attractif pour la thérapie cellulaire à base et les applications de traitement de régénération 1. Toutefois, pour son plein potentiel à réaliser les cellules doivent être différenciées en phénotypes matures et fonctionnelles, ce qui est une tâche ardue. Une approche prometteuse dans l'induction de la différenciation cellulaire est à suivre de près imiter le chemin de l'organogenèse dans le cadre in vitro. Le développement du pancréas est connu pour se produire dans des stades spécifiques 2, à commencer par l'endoderme, qui peut se développer dans plusieurs organes, y compris le foie et le pancréas. L'induction endoderme peut être obtenue par modulation de la voie nodale par addition de l'activine A 3 en combinaison avec plusieurs facteurs de croissance 4-7 in vitro par addition d'Cyclopamine 8. La maturation du pancréas est médiée par plusieurs événements parallèles dont l'inhibition de la signalisation Notch; l'agrégation des progéniteurs pancréatiques en 3-dimensionnelles grappes; induction de la vascularisation; pour n'en nommer que quelques-uns. De loin le plus de succès dans la maturation in vitro de l'ESC dérivés des cellules progénitrices du pancréas ont été atteints par l'inhibition de la signalisation Notch par la supplémentation DAPT 9. Malgré son succès, il en résulte un faible rendement de l'phénotype mature avec des fonctionnalités réduites. Une zone moins étudié est l'effet de signalisation des cellules endothéliales dans la maturation du pancréas, ce qui est de plus en plus apprécié comme un facteur important qui contribue à la maturation in vivo des îlots pancréatiques 10,11.

L'étude actuelle explore un tel effet de endothelial de signalisation cellulaire dans la maturation de l'homme ESC dérivés des cellules progénitrices pancréatiques productrices d'insuline dans l'îlot des cellules semblables à. Nous rapportons un protocole multi-stade de différenciation dirigée où les CES de l'homme sont d'abord induite par l'activine vers l'endoderme A avec l'inhibition de la voie de la PI3K. Spécification de cellules pancréatiques endodermiques est réalisée par l'inhibition de la signalisation par Sonic Hedgehog cyclopamine avec l'induction rétinoïde par addition d'acide rétinoïque. La dernière étape de maturation est induite par la signalisation cellulaire endothéliale réalisée par une configuration co-culture. Alors que plusieurs cellules endothéliales ont été testés dans la co-culture, ici, nous présentons nos données avec des cellules de rat cardiaques microvasculaires endothéliales (RHMVEC), principalement pour la facilité de l'analyse.

Protocol

1. L'entretien des cellules

  1. CSEh H1 (WiCell) ont été maintenues sur CSEh qualifiés Matrigel puits revêtus avec mTeSR1 médias, avec les médias changent tous les jours. Les puits ont été revêtus par une solution diluée matrigel, préparée par addition de 300 ul de matrigel CSEh dans 25 ml de DMEM: F12. 1 ml de cette solution matrigel a été ajouté à chaque puits d'une plaque de six puits, ou 400 pi ajouté à chaque puits d'une plaque 12 puits et on laisse manteau pendant 1 heure à température ambiante. Les cellules ont été repiquées au mécaniquement un facteur de division de 1:4 en grattant colonies fois qu'ils ont atteint entre 1 et 1,5 mm de diamètre.
  2. RHMVEC (technologies CVE) a été maintenue dans MCDB-131 médias avec les médias changent tous les jours. Les cellules ont été divisés par trypsinisation fois 80% de confluence a été atteint à un rapport de division de 1:3. Les cellules endothéliales entre les passages 3 et 7 ont été utilisés pour cette étude.

2. Préparation des solutions stock

  1. Activine A a été reconstitué à 50 ug / ml dans P stérileBS contenant 0,1% de sérum albumine bovine. La solution a été aliquotés et conservés à -20 ° C.
  2. FEM a été reconstitué à 500 ug / ml dans l'acide acétique stérile de 10 mM. La solution a été aliquotés et conservés à -20 ° C.
  3. L'insuline a été reconstitué à 10 mg / ml en ajoutant acidifié H 2 O (pH ≤ 2), préparé par addition de 0,1 ml d'acide acétique glacial à 10 ml d'eau.
  4. DAPT a été reconstitué dans du DMSO à 18 mg / ml. Il a en outre été diluée à 300 uM de concentration dans un milieu DMEM: F12, aliquotés et conservés à -20 ° C.
  5. KAAD-cyclopamine a été reconstitué dans du DMSO à 5mg/ml. Il a également été dilué à 2 uM de concentration dans un milieu DMEM: F12, aliquotés et conservés à -20 ° C.
  6. All-trans rétinoïque a été reconstitué à 2,7 mg / ml dans de l'éthanol à 95%. Il a en outre été dilués à la concentration 2 mM dans du DMEM: F12, aliquotés et conservés à -80 ° C.

3. Endoderme définitif (DE) et les cellules progénitrices du pancréas (PP) à induction

  1. Une fois hColonies ESC atteint entre 1 et 1,5 mm de diamètre, l'induction DE été effectuée par addition du DMEM: F12 supplémenté avec B27, 0,2% de BSA, 100 ng / ml et une activine A wortmannine uM pendant 4 jours (jour 0-jour 4) avec des milieux changent tous les jours.
  2. Après l'induction DE était complète, l'induction progénitrices du pancréas a été induite en changeant les médias pour DMEM: F12 supplémenté avec B27, 0,2% de BSA et KAAD-cyclopamine à 0,2 uM de concentration pendant 24 heures (Jour 4 Jour 5).
  3. Après 24 heures les médias a été changé pour DMEM: F12 supplémenté avec B27, 0,2% de BSA, KAAD-cyclopamine à concentration de 0,2 uM et acide tout-trans rétinoïque une concentration de 2 uM pendant 3 jours avec les médias changent tous les jours (Jour 5 Jour 8) .

4. La maturation du pancréas

  1. Après l'induction de PP, tous les groupes ont été modifiées pour les milieux de maturation composé de DMEM: F12 supplémenté avec B27, 0,2% de BSA, 10 mM Nicotinamide, 25 pg / ml d'insuline, 30 nM Na 2 SeO 3 pg et 50 / ml de transferrine pour 2 days avec les médias changent tous les jours (Jour 8 Jour 10).
  2. Après 2 jours dans un milieu de maturation, l'étape de maturation finale est effectuée en parallèle en utilisant plusieurs conditions différentes pour effectuer des comparaisons. Différenciation a été induite dans les conditions suivantes: (i) à l'aide cran inhibiteur de DAPT (ii) à l'aide de co-culture des médias seulement, sans les cellules endothéliales que le contrôle et (iii) à l'aide de contact co-culture avec des cellules RHMVEC. Les cellules ont été maintenues dans les médias DAPT ou de co-culture pendant une semaine (Jour 10-Jour 17) avec les médias changent tous les jours.
    1. Médias DAPT a été préparé par les milieux de maturation complétant avec 30 uM DAPT. Les cellules de ces groupes ont d'abord été exposée à compléter MCDB131 pendant 24 heures, puis exposée aux médias DAPT pendant 6 jours (jour 11 jours 17).
    2. Co-culture multimédia a été préparé par complétant MCDB 131-support avec B27, 0,2% de BSA, 10 mM de nicotinamide, 10 ng / ml EGF, 1 pg / ml d'hydrocortisone, 10 mg EndoGro, 90 pg / ml d'héparine. Pour la condition contrôle des médias les cellules différenciées ont été exposésà MCDB-131 milieu complet pendant 24 heures (jour 10-Day 11), après quoi les médias a été changé à la co-culture des médias pendant 6 jours (jour 11 jours 17) (pas de cellules endothéliales).
    3. En cas de contact co-culture l'état, un million de RHMVEC a été ajouté à des cellules différenciées dans complètes MCDB-131 médias (technologies VEC) pour 24 heures (jour 10-Jour 11) pour permettre la fixation. Après les médias 24 heures a été changé à la co-culture des médias pendant 6 jours (jour 11 jours 17) avec les médias changent tous les jours.

5. qRT-PCR Analyse

  1. À la fin de chaque étape de la différenciation (endoderme; progénitrices du pancréas; îlot maturité) ont été lysées et l'ARN a été extrait en utilisant l'ARN NucleoSpin kit d'extraction II selon les instructions du fabricant.
  2. ARN de qualité a été analysée en vérifiant absorbance ARN à 260 nm et 280 nm, suivi par la quantification d'ARN en utilisant un spectrophotomètre SmartSpec plus.
  3. La transcription inverse a été réalisée à l'aide ImProm II k transcription inverseil selon les instructions du fabricant. Toutes les réactions ont été réalisées avec 100 ng d'ARN.
  4. qRT-PCR a été réalisée en utilisant le système de Mx3005P QPCR (Agilent) et Brilliant II SYBR Green QPCR Master Mix selon les instructions du fabricant. Les amorces utilisées sont énumérées dans le tableau 1. L'étape d'initialisation a été effectuée à 50 ° C pendant 2 minutes, suivie par 95 ° C pendant 10 minutes. 50 cycles d'amplification ont été réalisées comme suit: 95 ° C pendant 30 secondes, 54 ° C pendant 30 secondes et 72 ° C pendant 1 minute.
  5. Changement pli de l'expression des ARNm cible sur des cellules indifférenciées a été calculée à partir de valeurs de CT en utilisant les formules suivantes:
    ΔCT (Marker i) = CT (Marker i) - CT (GAPDH)
    Δ ΔCT (Marker i) = ΔCT (Marker i) (Exemple) - ΔCT (Marker i) (cellules indifférenciées)
    Expression relative (Marker i) = 2-ΔΔCT(Marqueur de i)

6. Immunocytochimie

  1. À la fin de chaque étape de la différenciation (endoderme; progénitrices du pancréas; îlot mature) cellules ont été fixées dans du formol à 4% pendant 15 minutes à température ambiante.
  2. Cellules ont été perméabilisées fixes en utilisant 0,25% de Triton X-100 (TX) pendant 15 minutes.
  3. Non-spécifique de coloration a été bloquée par une incubation dans le sérum âne de 10% en 0,05% TX pendant 30 minutes.
  4. D'incubation d'anticorps primaire a été réalisée pendant une nuit à 4 ° C dans un tampon de blocage une dilution d'anticorps recommandée (voir tableau 1).
  5. Les cellules ont été lavées avec 0,05% de TX trois fois pendant 5 minutes.
  6. D'incubation d'anticorps secondaire a été effectuée pendant une heure à température ambiante dans l'obscurité avec des anticorps appropriés dilués dans un tampon de blocage.
  7. Les cellules ont été lavées avec 0,05% de TX trois fois pendant 5 minutes.
  8. Coloration nucléaire a été réalisée par incubation avec Hoescht tache au 1:1000 dilution en PBSpendant 5 minutes, suivie de 3 lavages avec du PBS.
  9. Cellules fixées et colorées ont été imagées par Olympus IX81 microscope inversé et Metamorph logiciel d'imagerie.

7. Les résultats représentatifs

Ajout de l'activine A et Wortmannin à CSEh indifférenciées pendant 4 jours induit endoderme définitif tel que confirmé par qRT-PCR analyse des marqueurs DE Sox17, CXCR4, et Foxa2 et immunomarquage pour Sox17 comme illustré à la figure 2. Différenciation de cellules souches pancréatiques après l'addition d'acide rétinoïque et cyclopamine a été confirmée par qRT-PCR de marqueurs progénitrices pancréatiques et immunocoloration de PDX1 comme illustré à la figure 3.

Au stade final de différenciation, contactez la co-culture avec des cellules RHMVEC fortement incités régulation à la hausse de l'expression d'insuline dans les CSEh dérivées de cellules souches pancréatiques. L'efficacité de la différenciation induite co-culture a été analysé par la coopérationmparing avec la condition de contrôle en utilisant DAPT. DAPT a été utilisé comme un contrôle positif, car il est actuellement l'une des méthodes les plus couramment utilisés pour parvenir à la maturation du pancréas. Depuis la co-culture a été effectuée dans un milieu modifiés complétées par des facteurs de soutien des cellules endothéliales, un contrôle supplémentaire a été réalisée avec les médias en l'absence de cellules endothéliales afin de vérifier l'effet des médias sur la différenciation. Les détails de cette analyse sont présentés dans la figure 4.

Figure 1.
Figure 1. Multi-étape du protocole de différenciation des CSEh en cellules productrices d'insuline exprimant.

Figure 2.
Figure 2. Induction endoderme définitif de cellules souches embryonnaires humaines. A) qRT-PCR de marqueurs dans les cellules représentatives DE CSEh exposés à l'activine A et Wortmannin pendant 4 jours. Résultats ar e normalisé par rapport à CSEh indifférenciée. B) Sox17 coloration (vert) et DAPI (bleu) montrent une expression nucléaire de Sox17. La barre d'échelle: 50 um.

Figure 3.
Figure 3. Induction progénitrices du pancréas de la cellule souche embryonnaire de cellules dérivées endoderme. A) qRT-PCR de marqueurs dans les cellules pancréatiques début de CSEh dérivées endoderme exposés à l'acide rétinoïque et cyclopamine pendant 4 jours après l'induction DE. Les résultats normalisés par rapport à CSEh indifférenciée. B) PDX1 coloration (violette) et DAPI (bleu) montrent une expression nucléaire de PDX1. La barre d'échelle: 50 um.

">

Figure 4.
Figure 4. Stade de maturation du pancréas A) qRT-PCR analyse des hormones pancréatiques dans les CSEh après la maturation du pancréas en utilisant DAPT, contacter les médias de co-culture ou de co-culture (contrôle). Les résultats normalisés par rapport à CSEh indifférenciée. p valeurs obtenues par test t de Student. B) La co-culture avec Dil-Ac-LDL marqué RHMVEC (Rouge) montrent les régions où EC attachent à la plaque, si il ya des espaces vides (en haut), RHMVEC autre peut être trouvée en contact direct avec la différenciation ESC (en bas). C) C-peptide (vert) de coloration pour des cellules différenciées en utilisant la méthode de co-culture. La barre d'échelle: 12,5 um (Haut) et 50 um (Bas) D) Immunomarquage de RHMVEC ne démontre aucune expression de l'insuline dans le RHMVEC.

Marqueur Primer1 (5 'à 3') </ Td> Primer2 (5 'à 3') Réf
Sox17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
GLUCAGON AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
INSULINE AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

Primaires Tableau 1. Utilisé pour des réactions qPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Au cours du développement du pancréas, de différenciation des cellules pancréatiques sont en étroite proximité avec les cellules endothéliales de l'aorte; outre, les îlots pancréatiques sont densément vascularisé de promouvoir l'échange rapide de glucose dans le sang et les hormones des îlots de Langerhans. Compte tenu de ces faits, il n'est pas surprenant que les cellules endothéliales jouent un rôle important dans le processus d'organogenèse du pancréas. Bien que l'importance des cellules endothéliales au cours du développement du pancréas est de plus en plus apprécié, son rôle dans la différenciation in vitro de cellules embryonnaires est moins étudié. Dans notre précédent rapport, nous avons établi le rôle positif des cellules endothéliales sur la maturation des cellules du pancréas souches embryonnaires de souris 13. Dans l'étude actuelle, nous étudions l'effet de la signalisation des cellules endothéliales sur la différenciation des cellules souches embryonnaires humaines.

Plusieurs cellules endothéliales ont été utilisés dans ce protocole, tous ce qui a entraîné althou effet similaire globalegh avec des variations dans l'efficacité de la différenciation. Dans le présent rapport, nous présentons l'effet de la co-culture de CSEh dérivées de cellules souches pancréatiques avec des cellules de rat cardiaques microvasculaires endothéliales (RHMVEC). Cellules endothéliales peut être commodément visualisées par coloration du LDL-AC, qui est spécifique uniquement à des cellules endothéliales. Co-culture de la différenciation avec les CES pré-teint les cellules endothéliales a montré que tandis que la plupart des cellules endothéliales étaient viables en culture pendant une période prolongée de temps, le RHMEV disparaissent progressivement au bout de 4 jours et ne pouvait plus être détectée au bout de 6 jours de maturation. Absence de l'RHMVEC simplifie l'analyse en éliminant la nécessité pour le tri, donc a été choisi pour l'optimisation du protocole de co-culture.

Bien que la présente étude indique clairement l'effet positif des cellules endothéliales de la maturation du pancréas induisant, le mécanisme exact de l'induction telle est encore inconnue et étant actuellement étudiés dans notre laboratoire. Un Femécanismes plausibles w pourrait être (i) l'effet de molécules sécrétées cellulaires (ii) l'inhibition médiée par l'endothélium des cellules de signalisation Notch (iii) le rôle de la matrice extracellulaire sécrétée par les cellules endothéliales. Alors que la première catégorie ne nécessite pas de contact cellule-cellule, un tel contact est obligatoire pour la deuxième et troisième catégorie. Par conséquent nous avons effectué une analyse préliminaire en utilisant différentes configurations de co-culture: (i) de contact co-culture (ii) transwell co-culture et (iii) de culture conditionné médias. Il a été observé que le contact de co-culture a entraîné une différenciation maximale, à en juger par l'expression d'insuline, suivie par transwell co-culture, tandis que la culture conditionné médias a entraîné un effet minime sur l'expression d'insuline (données non présentées). Ces analyses indiquent que tandis que la cellule-cellule de contact est important, il pourrait y avoir quelques éphémères molécules sécrétées qui sont importants aussi bien.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Nous n'avons rien à communiquer.

Acknowledgements

Nous reconnaissons le soutien de prix NIH Innovateur New DP2 116520 et ORAU Ralph Powe junior Prix Amélioration de la Faculté.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics