Reação em Cadeia da Polimerase: Protocolo Basic Plus Estratégias de solução de problemas e otimização

Biology
 

Summary

PCR emergiu como uma técnica comum em muitos laboratórios de biologia molecular. Desde aqui está um guia rápido para vários protocolos convencionais de PCR. Porque cada reacção é uma experiência única, as condições óptimas necessárias para gerar um produto variar. Compreender as variáveis ​​em uma reação vai aumentar muito a eficiência de resolução de problemas, aumentando assim a chance de obter o resultado desejado.

Cite this Article

Copy Citation | Download Citations

Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998, doi:10.3791/3998 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Nas ciências biológicas tem havido avanços tecnológicos que elevaram a disciplina em épocas de ouro da descoberta. Por exemplo, o campo da microbiologia foi transformada com o advento de microscópio Anton van Leeuwenhoek, que permitiu que os cientistas visualizar procariotas, pela primeira vez. O desenvolvimento da reação em cadeia da polimerase (PCR) é uma dessas inovações que mudaram o curso da ciência molecular com o seu impacto abrangendo subdisciplinas incontáveis ​​na biologia. O processo teórico foi descrito por Keppe e colaboradores em 1971, no entanto, era mais de 14 anos até que o procedimento de PCR completa foi descrito e aplicado experimentalmente por Kary Mullis, enquanto ao Cetus Corporation, em 1985. Automatização e refinamento desta técnica progrediu com a introdução de uma polimerase de ADN termicamente estável a partir do Thermus aquaticus bactéria, consequentemente, o nome da polimerase de DNA Taq.

A PCR é um powetécnica de amplificação rful que pode gerar um grande suprimento de um segmento específico de ADN (ie, um fragmento amplificado) a partir de apenas uma pequena quantidade de material de partida (isto é, o modelo de DNA ou sequência alvo). Embora simples e geralmente sem problemas, existem armadilhas que dificultam a reação produzindo resultados falsos. Quando PCR falhar pode levar a muitos produtos não específicos de ADN de tamanhos variados que aparecem como uma escada ou mancha de bandas no gel de agarose. Às vezes produtos não formam em tudo. Outro problema potencial ocorre quando as mutações são intencionalmente introduzido nos amplicons, resultando em uma população heterogénea de produtos de PCR. Falhas de PCR pode se tornar frustrante a menos paciência e resolução de problemas cuidado são utilizados para classificar e resolver o problema (s). Este protocolo descreve os princípios básicos de PCR, fornece uma metodologia que irá resultar em amplificação de sequências de a maioria dos alvos, e apresenta estratégias para optimizar uma reacção. Ao seguir este guia de PCR, students deve ser capaz de:

  • Configure reações e condições ciclos térmicos para um experimento de PCR convencional
  • Compreender a função dos componentes de reação diversas e seu efeito global sobre um experimento de PCR
  • Projetar e otimizar um experimento de PCR para qualquer modelo de DNA
  • Solucionar problemas de experiências fracassadas de PCR

Protocol

1. Projetando Primers

Projetando iniciadores adequados é essencial para o sucesso de um experimento de PCR. Ao conceber um conjunto de iniciadores para uma região específica do ADN desejado para a amplificação, um primer deve recozer à cadeia mais, o que, por convenção, é orientado na direcção 5 '→ 3' (também conhecido como o sentido ou filamento nontemplate) ea outro iniciador deve complementar a cadeia de menos, que é orientada no 3 '→ 5' (anti-sentido ou cadeia molde). Existem alguns problemas comuns que surgem aquando da concepção iniciadores: 1) auto-recozimento dos iniciadores resultando na formação de estruturas secundárias, tais como loops hairpin (Figura 1a), 2) de primers de recozimento para o outro, em vez de molde do ADN, criação de primers dímeros (Figura 1b), 3) drasticamente diferentes temperaturas de fusão (T m) para cada primer, tornando-se difícil selecionar uma temperatura de recozimento que com todo oow ambos os primers de forma eficiente se ligar a sua seqüência alvo durante themal ciclismo (Figura 1c) (Consulte as seções CÁLCULO temperatura de fusão (T m) e Modificações condições cíclicas para mais informações sobre T m s).

  1. Abaixo está uma lista de características que devem ser considerados ao projetar primers.
    1. Comprimento do primer deve ser 15-30 resíduos de nucleótidos (bases).
    2. Conteúdo de GC óptima deve variar entre 40-60%.
    3. A extremidade 3 'dos ​​iniciadores deve conter um G ou C, a fim de fixar o primer e prevenir "respiração" das extremidades, aumentando a eficiência de escorva. "Respiração" DNA ocorre quando termina não ficar recozido, mas desgastar ou se separaram. Os três ligações de hidrogénio em pares GC ajudar a prevenir a respiração, mas também aumentam a temperatura de fusão dos iniciadores.
    4. Extremidades 3 'de um conjunto de iniciadores, que inclui um primer filamento de adição e um primer vertente menos, não deve ser c omplementary uns aos outros, nem pode a extremidade 3 'de um iniciador único ser complementares a sequências de outros na primeira demão. Estes dois cenários resultar na formação de dímeros de iniciadores e as estruturas loop de hairpin, respectivamente.
    5. Ótimas temperaturas de fusão (T m) para primers faixa entre 52-58 ° C, embora essa faixa pode ser ampliada para 45-65 ° C. O m T final para ambos os iniciadores devem diferir por não mais do que 5 ° C.
    6. Di-nucleotídeos repete (por exemplo, GCGCGCGCGC ou ATATATATAT) ou corridas única base (por exemplo, ou AAAAA CCCCC) devem ser evitados, pois podem causar deslizamento ao longo do segmento preparado de estruturas de DNA e ou grampo de laço para se formar. Se inevitável devido à natureza do molde de ADN, em seguida, incluir apenas repete ou base única é executado com um máximo de 4 bases.

Notas:

  1. Existem muitos programas de computador projetados para ajudar na elaboração de pares de primers. NCBI ferramenta de design Primerw.ncbi.nlm.nih.gov / ferramentas / primer da explosão-/ "target =" _blank "> http://www.ncbi.nlm.nih.gov/tools/primer-blast/ e Primer3 http://frodo .wi.mit.edu/primer3 / são sites recomendados para esta finalidade.
  2. A fim de evitar a amplificação de pseudogenes relacionados ou homólogos, poderia ser útil para executar uma explosão no NCBI para verificar a especificidade dos iniciadores alvo.

2. Materiais e Reagentes

  1. Ao configurar uma experiência de PCR, é importante a ser preparada. Usar luvas para evitar a contaminação da mistura de reacção ou os reagentes. Incluir um controlo negativo, e se possível um controlo positivo.
  2. Organizar todos os reagentes necessários para o experimento de PCR em um balde de gelo recém-cheia, e deixe-os descongelar completamente antes de configurar uma reação (Figura 2). Manter os reagentes no gelo durante todo o experimento.
    • Reagentes PCR padrão incluem umaconjunto de iniciadores apropriados para o gene alvo desejado ou segmento de DNA a ser amplificada, a polimerase do ADN, um tampão para a polimerase de ADN específico, desoxinucleótidos (dNTPs), molde de ADN, e água estéril.
    • Os reagentes adicionais podem incluir sal de magnésio Mg 2 + (a uma concentração final de 0,5 a 5,0 mM), K sal de potássio + (a uma concentração final de 35 a 100 mM), dimetilsulfóxido (DMSO; a uma concentração final de 1-10% ), formamida (a uma concentração final de 1,25-10%), albumina de soro bovino (a uma concentração final de 10-100 ug / ml), e betaína (a uma concentração final de 0,5 M a 2,5 M). Aditivos são discutidos na seção de resolução de problemas.
  3. Organizar equipamentos de laboratório sobre a bancada.
    • Os materiais incluem tubos de PCR e cápsulas, um suporte para tubos de PCR, um marcador de etanol-resistentes, e um conjunto de micropipetas que dispensam entre 1 - 10 ul (P10), 2 - 20 uL (P20), 20-200 ul (P200)e 200 - 1000 ul (P1000), bem como um termociclador.
    • Quando da criação de vários experimentos de PCR que todos usam os mesmos reagentes, podem ser escalados apropriadamente e combinadas em uma mistura de mestre (Master Mix). Este passo pode ser feito de uma estéril tubo de microcentrífuga de 1,8 ml (ver Notas).
    • Para a análise dos fragmentos amplificados resultantes de uma experiência de PCR, os reagentes e equipamento para a electroforese em gel de agarose é necessária. Para o tamanho aproximado de um produto de PCR, um adequado, disponível comercialmente de tamanho padrão de peso molecular é necessária.

3. Configurando uma mistura de reação

  1. Comece fazendo uma tabela de reagentes que serão adicionados à mistura de reacção (ver Tabela 1).
  2. Em seguida, o rótulo de PCR tubo (s) com o marcador de etanol-resistente.
  3. Volumes de reacção irá variar dependendo das concentrações dos reagentes de imagens. As concentrações finais(CF) para uma reacção de 50 uL típico são as seguintes.
    • X tampão (normalmente fornecido pelo fabricante da polimerase de ADN; pode conter 15 mM MgCl2). Adicionar 5 ul de tampão 10X por reacção.
    • 200 dNTPs iM (50 mM de cada um dos quatro nucleótidos). Adicionar 1 ml de 10 mM de dNTPs por reacção (dATP, dCTP, dTTP e dGTP a 2,5 mM são cada).
    • 1,5 mM de Mg2 +. Adicionar apenas se não estiver presente no tampão 10X ou como necessário para a optimização de PCR. Por exemplo, para obter a 4,0 mM Mg 2 + necessária para a produção óptima de amplicão um segmento de ADN conservada 566 pb encontrada em um Mycobacteriophage descaracterizado adicionar 8 uL de 25 mM de MgCl2 para a reacção (Figura 3).
    • 20-50 pmol de cada iniciador. Adicionar 1 ml de cada iniciador 20 uM.
    • Adicionar 10 4 a 10 7 moléculas (ou cerca de 1 a 1000 ng) do molde de DNA. Adicionar 0,5 ul de 2NG / & mu; L DNA genômico Mycobacteriophage.
    • Adicionar 0,5 a 2,5 unidades de polimerase de ADN por reacção 50 uL (Ver as recomendações do fabricante) Por exemplo, adicionar 0,5 ul de Sigma 0,5 Unidades / uL polimerase de ADN Taq.
    • Adicionar QS água destilada estéril para se obter um volume de 50 ul final por reacção como pré-determinado na tabela de reagentes (QS é uma abreviatura para América quantum satis significando a quantidade que é necessária). Assim, 33 ul por reacção é necessária para levar o volume até 50 uL. No entanto, deve notar-se que a água é adicionado primeiro, mas requer inicialmente fazendo uma tabela de reagentes e determinar os volumes de todos os outros reagentes adicionados à reacção.

4. Básica protocolo de PCR

  1. Colocar uma placa de 96 poços para o balde de gelo como um suporte para os 0,2 ml de finos tubos de paredes de PCR. Permitir que os reagentes da PCR para ser adicionado no frio de 0,2 ml de finos tubos PCR de parede irá ajudar a evitar nucleasatividade de condicionamento e inespecífica.
  2. Pipetar os seguintes reagentes de PCR, na seguinte ordem em um tubo de 0,2 ml de PCR de parede fina (Figura 4): água estéril, tampão de PCR 10x, dNTPs, MgCl2, iniciadores, e ADN molde (Ver Tabela 1). Uma vez que experiências deve ter pelo menos um controlo negativo, e, possivelmente, um controlo positivo, é benéfico para configurar uma mistura de Mestrado em um tubo de microcentrífuga de 1,8 ml (ver explicação em Notas).
  3. Em alguns separadas 0,2 ml finas tubos de parede de PCR (Figura 4) adicionar todos os reagentes com a excepção de ADN molde para um controlo negativo (aumentar a água para compensar o volume em falta). Além disso, outra reacção (se os reagentes estão disponíveis) deve conter um controlo positivo usando ADN molde e iniciadores previamente conhecidos ou para amplificar sob as mesmas condições experimentais como os tubos de PCR.
  4. Taq polimerase de ADN é normalmente armazenado em glicerol a 50%solução e para a dispersão completa na mistura de reacção requer suave a mistura dos reagentes de PCR por pipetagem de cima e para baixo, pelo menos, 20 vezes. A micropipeta deve ser ajustado para cerca de metade do volume de reação da mistura principal ao misturar, e os cuidados devem ser tomados para evitar a introdução de bolhas.
  5. Colocar tampas nos tubos de 0,2 ml finas paredes de PCR e colocá-las no termociclador (Figura 5). Uma vez que a tampa para o termociclador está firmemente fechada iniciar o programa (ver Tabela 2).
  6. Quando o programa tiver terminado, os 0,2 ml de finos tubos de paredes de PCR pode ser removido e armazenado a 4 ° C. Os produtos de PCR pode ser detectado através do carregamento alíquotas de cada reacção em poços de um gel de agarose, em seguida, a coloração do ADN que tenha migrado para a electroforese em gel a seguir com brometo de etídio. Se um produto de PCR está presente, o brometo de etídio irá intercalar entre as bases das cadeias de ADN, permitindo que as bandas a ser visualizado com um iluminador de UV. </ Li>

Notas:

  1. Ao configurar múltiplas experiências de PCR, é vantajoso para a montagem de uma mistura de reagentes comuns a todas as reacções (isto é, mistura de Master). Normalmente, o cocktail contém uma solução de DNA polimerase, dNTPs, tampão de reacção, e água montado dentro de um tubo de microcentrífuga de 1,8 ml. A quantidade de cada reagente adicionado à mistura de Master é equivalente ao número total de reacções mais 10% arredondada para o mais próximo de reacção todo. Por exemplo, se há 10 x 0,1 = 1 de reacção, em seguida, (10 + 1) x 5 uL de tampão 10X é igual a 55 uL de tampão 10X para a Mistura Principal. Os reagentes na mistura de mestre são muito bem misturados suavemente por bombeamento o êmbolo de uma micropipeta para cima e para baixo cerca de 20 vezes, como descrito acima. Cada tubo de PCR recebe uma alíquota da mistura principal para o qual o molde de ADN, quaisquer iniciadores requeridos, e experimentais específicos reagentes são então adicionados (ver Tabelas 1 e 7).
  2. O followisite ng oferece uma calculadora para a determinação do número de cópias de um DNA modelo ( http://www.uri.edu/research/gsc/resources/cndna.html ). O número total de cópias de ADN de cadeia dupla pode ser calculada usando a seguinte equação:
    Número de cópias do DNA = (quantidade de DNA (ng) x 6.022x10 23) / (comprimento de ADN x 1x10 9 ng / ml x 650 Daltons)
    Cálculo do número de cópias de ADN é utilizado para determinar a quantidade de molde é necessária por reacção.
  3. Os falsos positivos podem ocorrer como uma consequência da transferência a partir outra reacção de PCR, que iria ser visualizado como múltiplos produtos indesejados sobre um gel de agarose após electroforese. Portanto, é prudente utilizar a técnica adequada, inclua um controle negativo (eo controlo positivo quando possível).
  4. Enquanto o brometo de etídio é o mais comum f manchaou ácidos nucléicos existem várias alternativas mais seguras e menos tóxicos. O site a seguir descreve algumas das alternativas, incluindo azul de metileno, violeta cristal, Cofre SYBR e Gel Vermelho, juntamente com descrições de como usar e detectar o produto final ( http://bitesizebio.com/articles/ethidium-bromide-the- alternativas / ).
  5. Enquanto a maioria das máquinas modernas de PCR usar tubos de 0,2 ml, alguns modelos podem exigir reações em tubos de 0,5 ml. Consulte o manual do termocicladores para determinar o tubo de tamanho apropriado.

5. Temperatura de fusão cálculo (T m)

  1. Conhecendo a temperatura de fusão (Tm) dos iniciadores é imperativo para uma experiência de PCR com êxito. Embora haja diversos calculadoras T m disponível, é importante notar que estes cálculos são uma estimativa do real T m, devido à falta de informações específicas sobre uma determinada reação e suposições feitas nos algoritmos para as calculadoras T m próprios. Contudo, os modelos vizinhos mais próximos termodinâmicas são preferíveis em relação ao cálculo mais convencional: T m ≈ 4 (GC) + 2 (AT). O ex-lhe dará mais precisa estimativa T m, porque leva em conta a energia de empilhamento dos pares de bases vizinhas. O último é usado com mais freqüência, porque os cálculos são simples e pode ser feito rapidamente com a mão. Consulte a seção Solução de problemas para obter informações sobre como as várias condições de PCR e aditivos afetam a temperatura de fusão.
    Para o cálculo dos valores de T m por modelos vizinhos mais próximos termodinâmicos, uma das calculadoras recomenda-se:
    http://www6.appliedbiosystems.com/support/techtools/calc/
    edu / ~ zimmer / oligoTMcalc.html "target =" _blank "> http://www.cnr.berkeley.edu/ ~ zimmer / oligoTMcalc.html
    http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
    http://www.finnzymes.com/tm_determination.html~~V
    http://mobyle.pasteur.fr/cgi-bin/portal.py? # formas :: fusão

6. Criação de condições de termociclagem

  1. Cyclers PCR térmicas rapidamente calor e deixar arrefecer a mistura de reacção, permitindo induzida pelo calor desnaturação de ADN duplex (separação de cadeias), recozimento dos iniciadores para os fios de mais e menos do molde de ADN, e alongamento do produto de PCR. Vezes ciclismo são calculadas com base no tamanho do modelo e do conteúdo de GC do DNA. O Formul geralum começa com um passo de desnaturação inicial a 94 ° C a 98 ° C, dependendo da temperatura óptima para a actividade de ADN polimerase e conteúdo de GC do DNA molde. Uma reacção típica irá começar com uma desnaturação minutos uma a 94 ° C. Quaisquer mais de 3 minutos podem inactivar a polimerase de ADN, destruindo a sua actividade enzimática. Um método, conhecido como de arranque a quente PCR, drasticamente prolonga o tempo de desnaturação inicial a partir de 3 minutos até 9 minutos. Com de arranque a quente de PCR, a polimerase de ADN é adicionado após o passo de desnaturação inicial exagerada está terminado. Esta modificação do protocolo evita a inactivação da enzima susceptível de polimerase de DNA. Consulte a seção Solução de problemas deste protocolo para obter mais informações sobre hot start PCR e outros métodos alternativos.
  2. O passo seguinte é para definir a termociclador de dar início ao primeiro de 25 a 35 voltas de um ciclo de temperatura de três passos (Tabela 2). Embora o aumento do número de ciclos de acima de 35 irá resultar numamaior quantidade de produtos de PCR, rodadas muitas vezes resulta no enriquecimento de produtos secundários indesejáveis. Os três passos de temperatura em um único ciclo realizar três tarefas: o primeiro passo desnatura o modelo (e em ciclos posteriores, os amplicões bem), o segundo passo permite óptima de recozimento dos iniciadores, eo terceiro passo permite a DNA polimerase para se ligar a o molde de ADN e sintetizar o produto de PCR. A duração ea temperatura de cada passo dentro de um ciclo pode ser alterada para optimizar a produção do fragmento amplificado desejado.
    O tempo para o passo de desnaturação é mantido o mais curto possível. Geralmente 10 a 60 segundos é suficiente para a maioria dos modelos de ADN. O tempo de desnaturação e de temperatura pode variar, dependendo do conteúdo de GC do DNA molde, bem como a taxa de rampa, que é o tempo que leva o termociclador para alterar a partir de uma temperatura para a próxima. A temperatura para esta etapa é geralmente a mesma que a utilizada para a fase de desnaturação inicial(Passo # 1 acima; por exemplo, 94 ° C).
    Um segundo passo de recozimento 30 segue dentro do ciclo, a uma temperatura definida cerca de 5 ° C abaixo da Tm aparente dos iniciadores (idealmente entre 52 ° C a 58 ° C).
    O ciclo termina com um passo de elongação. A temperatura depende da polimerase de ADN seleccionado para a experiência. Por exemplo, a Taq DNA polimerase tem uma temperatura de alongamento óptimo de 70 ° C a 80 ° C e requer um minuto para alongar as primeiras 2 kb, em seguida, requer um minuto adicional para cada adicionais 1 kb amplificado. Pfu polimerase de ADN é uma outra enzima termoestável que tem uma temperatura de alongamento óptimo de 75 ° C. Pfu polimerase de ADN é recomendado para utilização em PCR e reacções de extensão de iniciadores que requerem alta fidelidade e requer 2 minutos para cada 1 kb a ser amplificada. Ver as recomendações do fabricante para temperaturas de alongamento e hora exacta alongamento indicados para cada polimerase de ADN específica.
  3. Taq DNA polimerase, permite a adição de um resíduo de adenina para o extremidades 3 'de todos os produtos de PCR. Esta modificação é mediada pela actividade de transferase terminal de Taq DNA polimerase e é útil para subsequentes procedimentos de clonagem molecular que requerem uma saliência 3'-.
  4. Terminada a reacção é realizada por arrefecimento da mistura para 4 ° C e / ou pela adição de EDTA para uma concentração final de 10 mM.

7. Considerações importantes Quando Solução de problemas PCR

Se as condições de PCR padrão não produzem o fragmento amplificado desejado, PCR optimização é necessário para atingir os melhores resultados. O rigor de uma reacção pode ser modulada de tal modo que a especificidade é ajustado por meio de variáveis ​​que alteram (por exemplo, reagenteconcentrações, condições de bicicleta) que afetam o resultado do perfil de amplicon. Por exemplo, se a reacção não é suficientemente rigorosas, muitos amplicões espúrios será gerado com comprimentos variáveis. Se a reacção é muito rigorosas, nenhum produto será produzido. Reações de PCR para solução de problemas pode ser um esforço frustrante às vezes. No entanto, a análise cuidadosa e uma boa compreensão dos reagentes utilizados numa experiência de PCR pode reduzir a quantidade de tempo e ensaios necessários para obter os resultados desejados. De todas as considerações que rigor impacto PCR, titulação de Mg 2 + e / ou manipulação de temperaturas de recozimento provavelmente irá resolver a maioria dos problemas. No entanto, antes de mudar qualquer coisa, ter certeza de que um resultado errôneo não foi devido a erro humano. Comece confirmando todos os reagentes foram adicionados a uma reacção específica e que os reagentes não estavam contaminadas. Também tomamos nota do resultado errado, e faça as seguintes perguntas: Os dímeros de primers visíveis no gel após electrophoresistência (corrida como estes pequenos grupos <100 b perto da parte inferior da pista)? Existem produtos não específicos (bandas que migram com um tamanho diferente do que o produto desejado)? Houve uma falta de qualquer produto? É o ADN alvo num plasmídeo ou num extracto de ADN genómico? Além disso, é aconselhável analisar o conteúdo GC do amplicon desejado.

  1. Primeiro, determine se algum dos reagentes da PCR são catastróficos para a sua reação. Isto pode ser conseguido através da preparação de novos reagentes (por exemplo, frescas existências de trabalho, diluições novas), e então sistematicamente a adição de um novo reagente de cada vez para misturas de reacção. Este processo irá determinar qual o reagente foi o culpado para o experimento fracassado PCR. No caso de DNA muito antiga, que muitas vezes se acumula inibidores, tem sido demonstrado que a adição de albumina de soro bovino pode ajudar a aliviar o problema.
  2. Dímeros de iniciadores podem formar quando os primers preferencialmente auto anneal ou recozimento para o outro iniciador na reacção. Se isto ocorrer, uma pequenaproduto de menos de 100 pb aparecerá no gel de agarose. Comece alterando a proporção de molde para primer; se a concentração de primer é em excesso extremo sobre a concentração de modelo, em seguida, os iniciadores será mais provável para recozer a si próprios ou uns aos outros ao longo do molde de ADN. Adicionando DMSO e ou usando um hot start método de ciclagem térmica pode resolver o problema. No final, pode ser necessário conceber novos primers.
  3. Produtos não específicos são produzidos quando rigor PCR é excessivamente baixa, resultando em bandas não específicas de PCR com comprimentos variáveis. Isto produz um efeito escada em um gel de agarose. Em seguida, é aconselhável escolher condições de PCR que aumentam rigor. Uma mancha de vários tamanhos também podem resultar de primers desenhados para sequências altamente repetitivas quando amplificar DNA genômico. No entanto, os mesmos iniciadores podem amplificar uma sequência alvo num plasmídeo sem encontrar o mesmo problema.
  4. A falta de produtos de PCR é provavelmente devido a condições de reacçãoque são muito rigorosos. Dímeros de iniciadores e as estruturas loop de hairpin que formam com os iniciadores ou no DNA modelo desnaturado pode também evitar a amplificação de produtos de PCR porque estas moléculas podem não mais pares de bases com o homólogo de ADN desejado.
  5. Se o conteúdo de GC não tenha sido analisado, é o tempo para o fazer. PCR de regiões ricas em GC (conteúdo GC> 60%) representam alguns dos maiores desafios para a PCR. No entanto, existem muitos aditivos que têm sido utilizados para ajudar a aliviar os desafios.

8. Manipulando PCR Reagentes

A compreensão da função dos reagentes utilizados em PCR convencional é crítico quando primeiro decidir a melhor forma de alterar as condições de reacção para se obter o produto desejado. Sucesso simplesmente pode confiar na alteração da concentração de MgCl2, KCl, dNTPs, iniciadores, o DNA molde, ou polimerase de ADN. No entanto, a concentração errado de tais reagentes pode levar a resultados falsos, diminuindo a stringency da reacção. Ao solucionar PCR, apenas um reagente deve ser manipulada de cada vez. No entanto, pode ser prudente para titular o reagente manipulado.

  1. Sal de magnésio Mg 2 + (concentração de reacção final de 0,5 a 5,0 mM)
    Polimerases de ADN termoestáveis ​​requerem a presença de magnésio para actuar como um cofactor durante o processo de reacção. Alterando a concentração de magnésio é um dos mais fáceis de manipular com reagentes talvez o maior impacto sobre o rigor da PCR. Em geral, o rendimento do produto de PCR irá aumentar com a adição de maiores concentrações de Mg 2 +. No entanto, o aumento da concentração de Mg 2 + também irá diminuir a especificidade ea fidelidade do DNA polimerase. A maioria dos fabricantes incluem uma solução de cloreto de magnésio (MgCl2), juntamente com a polimerase de ADN e uma solução tampão 10X PCR. As soluções de 10 X tampão de PCR pode conter 15 mM de MgCl2, o que é suficiente para uma PCR típicoreacção, ou pode ser adicionado separadamente a uma concentração optimizado para uma reacção particular. Mg 2 + não é consumida na reação, mas a reação não pode continuar sem ele estar presente. Quando há muito Mg 2 +, pode evitar a desnaturação completa do molde de ADN através da estabilização da vertente duplex. Mg 2 + demais também pode estabilizar espúria emparelhamento dos primers para sites de modelos incorretos e especificidade diminuição resultando em produtos desejados de PCR. Quando não é suficiente Mg 2 +, a reacção não se realiza, resultando em nenhum produto de PCR.
  2. Sal de potássio K + (concentração de reacção final de 35 a 100 mM)
    Produtos mais de PCR (10 a 40 kb) benefício da redução de sal de potássio (KCl) a partir da sua concentração reacção normal 50 mM, muitas vezes em conjunto com a adição de DMSO e / ou glicerol. Se o fragmento amplificado desejado é abaixo de 1000 pb e longos produtos não específicos são formando, especificity pode ser melhorada por titulação de KCl, aumentando a concentração em incrementos de 10 mM até 100 mM. Aumentando a concentração de sal permite moléculas mais curtas de ADN para desnaturar preferencialmente a moléculas mais longos de ADN.
  3. Desoxinucleótidos 5'-trifosfatos (concentração de reacção final de 20 e 200 iM cada)
    Desoxinucleotídeos 5'-trifosfatos (dNTPs) pode causar problemas para PCR se eles não estão nas concentrações adequadas equivalentes (ou seja, [A] = [T] = [C] = [G]) e / ou devido à sua instabilidade a partir de repetidas congelamento e descongelamento. A concentração de dNTP habitual é de 50 uM de cada um dos quatro dNTPs. No entanto, a PCR pode tolerar concentrações entre 20 e 200 uM cada. Concentrações mais baixas de dNTPs pode aumentar tanto a especificidade ea fidelidade da reacção enquanto que as concentrações excessivas dNTP pode efectivamente inibir PCR. No entanto, para mais longos PCR de fragmentos, uma maior concentração de dNTP pode ser necessária. Uma grande alteração na concentração de dNTP podem necessitar de um correspondente mudança na concentração de Mg2 +.
  4. Térmicas estáveis ​​polimerases de ADN
    Enzimas de PCR e buffers associados a essas enzimas têm percorreu um longo caminho desde a Taq DNA polimerase inicial foi empregada pela primeira vez. Assim, a escolha de uma enzima apropriada pode ser útil para a obtenção de produtos amplicon desejados. Por exemplo, o uso de Taq DNA polimerase pode ser preferível a Pfu polimerase de ADN se processabilidade e / ou a adição de um resíduo de adenina para as extremidades 3 'do produto de PCR é desejada. A adição de um 3 '-adenina tornou-se uma estratégia útil para produtos de clonagem de PCR em vectores de AT whit 3' saliências timina. No entanto, se a fidelidade é mais importante uma enzima tal como Pfu pode ser uma melhor escolha. Vários fabricantes têm uma série de polimerases de DNA específicos projetados para necessidades específicas. Dê uma olhada nas condições de reação e as características do amplicon desejado, e então igualar o experimento de PCR com o DNA adequado polymerase. A maioria dos fabricantes têm tabelas que ajuda a seleção DNA polimerase por características listagem como fidelidade, produtividade, velocidade, comprimento alvo ideais, e se ele é útil para a GC amplificação rico ou hot start PCR.
  5. ADN molde
    Qualidade ea pureza do ADN irá ter um efeito substancial sobre a probabilidade de uma experiência de PCR com êxito. ADN e as concentrações de RNA pode ser determinada usando suas medições de densidade óptica a 260 nm (DO 260). A massa de ácidos nucleicos purificados, em solução é calculada a 50 ug / ml de DNA de cadeia dupla ou 40 ug / ml para ambos os RNA ou DNA de cadeia simples em uma OD 260 = 1,0. Contaminantes de extracção de ADN são inibidores comuns em PCR e devem ser cuidadosamente evitada. Os inibidores de DNA comuns de extracção de PCR incluem proteína, RNA, solventes orgânicos, e detergentes. Usando o máximo de absorção de ácidos nucleicos OD 260 comparada com a de proteínas OD280 (OD 260/280), é possível determinestimativa e um da pureza do ADN extraído. Idealmente, a proporção de OD 260/280 está entre 1,8 e 2,0. Baixa OD 260/280 é indicativa de proteína e / ou contaminação solvente que, com toda a probabilidade, irá ser problemático para a PCR.
    Para além da qualidade do ADN molde, a optimização da quantidade de ADN pode beneficiar grandemente o resultado de uma experiência de PCR. Embora seja conveniente para determinar a quantidade em uL ng /, que é muitas vezes a saída para nanospectrophotometers modernos, a unidade relevante para uma experiência de PCR com êxito é o número de moléculas. Isto é, o número de cópias do DNA molde conter uma sequência complementar para os iniciadores de PCR? Moléculas alvo óptimas são entre 10 abril-10 julho moléculas e pode ser calculada como foi descrito nas notas acima.

9. Reagentes aditivos

Reagentes aditivos podem produzir resultados quando tudo mais falhar. Compreender os reagentese que eles são utilizados para é crítica na determinação de quais os reagentes podem ser mais eficazes na aquisição do produto de PCR desejado. Adição de reagentes para a reacção é complicada pelo facto de que a manipulação de um reagente pode ter impacto na concentração de utilização de um outro reagente. Para além dos reagentes listados abaixo, de propriedade aditivos disponíveis comercialmente estão disponíveis a partir de muitas empresas de biotecnologia.

10. Aditivos que beneficiam Modelos rico em GC

  1. Dimetilsulfóxido (concentração final de DMSO de reacção de 1-10%)
    Em experiências de PCR em que o ADN molde é particularmente rico em GC (conteúdo de GC> 60%), adicionando o DMSO pode melhorar a reacção por perturbar emparelhamento de bases e eficazmente reduzir a Tm. Algumas calculadoras T m incluir uma entrada de variável para a adição de a concentração de DMSO desejado na experiência de PCR. No entanto, a adição de mais do que 2% de DMSO podem exigir a adição de polimerase de DNA mais como tem sido demonstradatrado para inibir a polimerase de ADN Taq.
  2. Formamida (concentração de reacção final de 1,25-10%)
    Tal como DMSO, formamida também rompe emparelhamento de bases, aumentando o rigor do primer de recozimento, o que resulta em menos de escorva não-específica e eficiência de amplificação aumentada. Formamida também tem sido demonstrado ser um potenciador para modelos de rico em GC.
  3. 7-desaza-2'-desoxiguanosina-5'-trifosfato (concentração de reacção final de dc 7 GTP; 3 dc 7 GTP: 1 dGTP 50 mM)
    Usando 3 partes, ou 37,5 mM, da base de guanosina analógico dc 7 GTP em conjunto com uma parte, ou 12,5 mM, dGTP desestabilize a formação de estruturas secundárias no produto. À medida que o DNA fragmento amplificado ou modelo é desnaturado, será frequentemente formar estruturas secundárias, tais como malhas apertadas. Incorporação de dc 7 GTP no amplicão de ADN irá proibir formação destas estruturas aberrantes.

Nota:

7 GTP atenua o sinal de coloração com brometo de etídio, que é por isso que é utilizado em uma proporção de 3:1 com dGTP.

  1. Betaína (concentração de reacção final de 0,5 M a 2,5 M)
    Betaína (N, N, N-trimethylglycine) é um análogo de ácido zwitteriónico amino que reduz e pode mesmo eliminar o DNA dependência da temperatura de fusão da composição de nucleótidos. É usado como um aditivo para auxiliar a amplificação por PCR de GC alvos ricos. Betaína é muitas vezes utilizados em combinação com DMSO e pode aumentar consideravelmente as possibilidades de ADN alvo de amplificação com conteúdo de GC elevado.

11. Aditivos que ajudam a PCR na presença de inibidores

  1. Detergentes não iónicos funcionam de modo a suprimir a formação da estrutura secundária e ajudar a estabilizar a polimerase de ADN. Detergentes não iónicos tais como Triton X-100, Tween 20, ou NP-40 podem ser utilizados em concentrações de reacção de 0,1 a 1%, a fim de aumentar a produção de amplicão. No entanto, concentrções acima de 1% pode ser inibidora para PCR. A presença de detergentes não iônicos diminui rigor PCR, levando potencialmente a formação do produto espúrio. No entanto, seu uso também vai neutralizar o inibidor afeta de SDS, ocasionalmente um contaminante de protocolos de extração de DNA.
  2. A adição de proteínas específicas, tais como albumina de soro bovino (BSA) utilizados em 400 ng / uL e / ou proteína do gene T4 32 a 150 ng / uL auxílio de PCR na presença de inibidores tais como FeCl3, hemina, ácido fúlvico, ácido húmico, ácido tânico, ou extratos de fezes, água doce e água do mar. No entanto, alguns inibidores de PCR, incluindo sais biliares, bilirrubina, EDTA, NaCl, SDS, ou Triton X-100, não são atenuadas por adição quer de BSA ou T4 gene 32 de proteína.

12. Modificações Condições Ciclismo

  1. Optimizar a temperatura de recozimento irá aumentar a qualquer reacção de PCR e deve ser considerado em combinação com outros aditivos e / ou juntamente com outros mo difications às condições de ciclismo. Assim, a fim de calcular a temperatura óptima de recozimento a seguinte equação é empregue:
    T a OPT = 0,3 T + 0,7 m Primer T Produto m -14,9
    T Primer m é calculada como a Tm do par menos estável usando a equação:
    T Primer m = ((AH ​​/ (ΔS + R x ln (c / 4))) -273,15 + 16,6 log [K +] Onde AH é a soma das mudanças vizinhos mais próximos de entalpia para híbridos; ΔS é a soma do alterações vizinhos mais próximos entropia; R é a constante dos gases (1,99 cal K-1 mol-1); C é a concentração de primer; e [K +] é a concentração de potássio.
    A última equação pode ser computado usando uma das calculadoras T m listados no seguinte site:
    rs / fusão / sup_mat / servers_list.html "target =" _blank "> http://protein.bio.puc.cl/cardex/servers/melting/sup_mat/servers_list.html
    T de produto m é calculada como se segue:
    Produto T m = 0,41 (% GC) + 16,6 log [K +] - comprimento 675/product
    Para a maioria das reações de PCR a concentração de potássio ([K +]) vai ser de 50 mm.
  2. Hot Start PCR é uma modificação versátil em que o tempo de desnaturação inicial é aumentada drasticamente (Tabela 4). Esta modificação pode ser incorporado com ou sem outras modificações condições de ciclismo. Além disso, é muitas vezes usado em conjunto com aditivos para a formação de amplicão temperamental. Na verdade, a quente de início de PCR é cada vez mais incluído como um aspecto regular das condições de ciclismo gerais. De arranque a quente tem sido demonstrada para aumentar o rendimento amplicão, enquanto o aumento da especificidade e fidelidade da reacção.A lógica por trás quente início PCR é eliminar de dimeros de iniciadores e não-específico de escorvamento que pode resultar como consequência da configuração da reacção abaixo da Tm. Assim, uma reacção típica de início quente aquece a amostra a uma temperatura acima da Tm óptima, pelo menos, a 60 ° C antes de qualquer amplificação é capaz de ocorrer. Em geral, a polimerase de ADN é retido a partir da reacção durante o período inicial, o tempo, alongada de desnaturação. Embora os outros componentes da reacção são por vezes omitidos em vez da polimerase de ADN, aqui vai concentrar-se na DNA polimerase. Existem vários métodos que permitem que o ADN-polimerase para permanecer inactivo ou fisicamente separados até que o período de desnaturação inicial foi concluída, incluindo a utilização de uma barreira de cera sólida, os anticorpos anti-DNA polimerase, e proteínas acessórias. Alternativamente, a polimerase de ADN podem ser simplesmente adicionados à reacção após o ciclo de desnaturação inicial está completa.
  3. Touchdown PCR (TD-PCR) édestina-se a tirar um pouco do trabalho da suposição fora das limitações de cálculo T m por variação das temperaturas calculadas de recozimento. O conceito é conceber duas fases de condições de ciclismo (Tabela 5). A primeira fase emprega sucessivamente mais baixas temperaturas de recozimento em cada ciclo de segundo (tradicionalmente 1,0 ° C), a partir de 10 ° C acima e terminando na calculada T m ou ligeiramente abaixo. A fase dois utiliza o padrão 3-passo de condições a temperatura de recozimento definir a 5 ° C abaixo da Tm calculada por mais 20 a 25 ciclos. A função da primeira fase deve aliviar mispriming, conferindo uma vantagem de 4 vezes para o produto correcto. Assim, depois de 10 ciclos, uma vantagem 410-vezes produziria 4096 cópias do produto correcto sobre qualquer priming espúrio.
    • Stepdown PCR é semelhante ao TD-PCR com incrementos de menos na primeira fase de escorvamento. Como um exemplo, a primeira fase reduz as temperaturas de recozimento cadasegundo ciclo em 3 ° C, começando a 10 ° C acima e terminando no 2 ° C abaixo do calculado T m. Tal como TD-PCR, fase dois utiliza o padrão 3-passo de condições a temperatura de recozimento definir a 5 ° C abaixo da Tm calculada por mais 20 a 25 ciclos. Isto permitiria que o produto correcto uma vantagem 256 vezes em relação a produtos de priming falsos.
    • Abrandamento PCR é simplesmente uma modificação da TD-PCR e foi bem sucedido para amplificar extremamente rico em GC (acima de 83%) sequências (tabela 6). O conceito leva em conta uma característica relativamente novo associado com modernos termocicladores, que permite o ajuste da velocidade de rampa, bem como a taxa de arrefecimento. O protocolo utiliza também dc 7 GTP para reduzir 2 formação da estrutura ° que poderiam inibir a reacção. A velocidade de rampa é reduzido para 2,5 ° C s -1, com uma taxa de arrefecimento de 1,5 ° C s -1 para os ciclos de recozimento. A primeira fase começa com um umanealing temperatura de 70 ° C e reduz a temperatura de recozimento de 1 ° C a cada 3 rodadas até atingir 58 ° C. A segunda fase, em seguida, continua com uma temperatura de recozimento de 58 ° C durante um período adicional de 15 ciclos.
  4. Nested-PCR é uma ferramenta poderosa usada para eliminar os produtos espúrios. A utilização de iniciadores encaixados é particularmente útil quando existem vários genes parálogas em um único genoma, ou quando existe baixo número de cópias de uma sequência alvo dentro de uma população heterogénea de sequências ortólogos. O procedimento básico envolve dois conjuntos de iniciadores que amplificam uma região única de DNA. Os primários exteriores escarranchar o segmento de interesse e são usados ​​para gerar produtos de PCR que são muitas vezes não específica em 20 a 30 ciclos. Uma pequena alíquota, geralmente cerca de 5 uL da reacção de 50 uL primeira, é então utilizado como o ADN molde por mais 20 a 30 ciclos de amplificação, utilizando o segundo conjunto de iniciadores que hibridizam para uma relação localização internapara o primeiro conjunto.

Outros protocolos de PCR são mais especializados e ir além do escopo deste artigo. Exemplos incluem RACE-PCR, Multiplex-PCR, Vectorette-PCR quantitativo,-PCR, e RT-PCR.

13. Os resultados representativos

Os resultados representativos de PCR foram gerados seguindo os protocolos de base de PCR acima descrito. Os resultados incorporar diversas estratégias de resolução de problemas para demonstrar o efeito de vários reagentes e condições de reacção. Genes da levedura Saccharomyces cerevisiae nascente e de um Mycobacteriophage descaracterizada foram amplificados nestas experiências. O padrão de 3-passo PCR protocolo apresentado na Tabela 2 foi utilizado para todas as três experiências descritas abaixo.

Antes de montar o experimento PCR, o DNA genômico de S. tanto cerevisiae ea Mycobacteriophage foram quantificados e diluído para uma concentração que alow entre 10 4 e 10 7 moléculas de ADN por reacção. Os stocks de trabalho foram preparadas como se segue. Uma preparação de ADN genómico de levedura rendeu 10 4 ng / uL. Uma diluição a 10 ng / ul foi gerado pela adição de 48 uL em 452 ul de tampão TE pH 8,0. Uma vez que o S. genoma cerevisiae é de cerca de 12,5 Mb, 10 ng conter 7,41 X 10 5 moléculas. A preparação de ADN genómico Mycobacteriophage rendeu 313 ng / uL. Uma diluição a 2 ng / uL foi gerado pela adição de 6,4 ul em 993,6 ul de tampão TE pH 8,0. Este ADN do fago é de cerca de 67 Kb. Assim, 1 ng contém 2,73 X 10 7 moléculas, que se encontra no limite superior do DNA geralmente utilizado para uma PCR. Os stocks de trabalho foram então usados ​​para gerar as soluções mestre Mix descritas na Tabela 7. Experiências variadas condições de ciclismo como descrito abaixo.

Na Figura 3a DNA, genómico de S. cerevisiae foi utilizado como um modelo para amplificaro gene GAL3, que codifica uma proteína envolvida no metabolismo de galactose. A meta para este experimento foi determinar a ótima concentração de Mg 2 + para este conjunto de reagentes. N MgCl 2 estava presente no tampão de PCR original e teve de ser suplementado nas concentrações indicadas com uma gama testada a partir de 0,0 mM a 5,0 mM. Como mostrado na figura, um produto de PCR do tamanho esperado (2098 pb) aparece a partir de um 2 + Mg concentração de 2,5 mM (pista 6) com uma concentração óptima de 4,0 mM (pista 9). A concentração recomendada fornecido pelo fabricante foi de 1,5 mM, o que é o valor previsto no buffers típicos de PCR. Talvez surpreendentemente, a concentração necessária à formação do produto neste experimento excedido esse valor.

Um modelo de DNA diferente foi utilizado para a experiência apresentada na Figura 3b. O ADN genómico a partir de um Mycobacteriophage foi usado para amplificar um segmento de ADN conservada 566 pb.Tal como o experimento anterior, o óptimo Mg 2 + concentração teve de ser determinado. Como mostrado na Figura 3b, a amplificação do produto de PCR desejado requer, pelo menos, 2,0 mM de Mg 2 + (pista 5). Embora não houvesse mais variabilidade na quantidade de produto formado em concentrações crescentes de MgCl2, o produto mais PCR foi observada a 4 mM Mg 2 + (pista 9), a mesma concentração observada para o gene de levedura GAL3.

Note-se que nas experiências apresentadas nas Figuras 3A e 3B, uma banda discreta foi obtido usando as condições de ciclismo pensados ​​para ser óptima em função das temperaturas de primers de recozimento. Especificamente, a temperatura de desnaturação foi de 95 ° C com uma temperatura de recozimento de 61 ° C, ea extensão foi realizada durante 1 minuto a 72 ° C durante 30 ciclos. A extensão final de 5 minutos foi então feito a 72 ° C. Para a terceira experiência apresentada na Figura 3c Figura 3c, o que era uma banda discreta na Figura 3a, torna-se uma mancha de produtos não específicos sob estas condições sub-óptimas de ciclismo. Além disso, com o rigor global da reacção reduzida, uma menor quantidade de Mg 2 + é necessário para formar um fragmento amplificado.

Todos os três experiências ilustram que, quando Mg 2 + são concentrações muito baixas, não há produção amplicon. Estes resultados também demonstram que, quando as duas condições de ciclismosão correctamente concebida e os reagentes são em concentrações óptimas, o experimento PCR produz um fragmento amplificado discreta correspondente ao tamanho esperado. Os resultados mostram a importância da realização de experimentos de PCR em um rigor suficientemente elevada (por exemplo, bandas discretas contra um esfregaço). Além disso, as experiências indicam que a mudança de um parâmetro pode influenciar um outro parâmetro, afectando assim o resultado da reacção.

Reagente Concentração das soluções de reserva Volume 13X **
Mix Master
Concentração Final
Estéril de H2O QS para 50 uL QS para 650 uL
Tampão de PCR 10X 5 ul 65 ul 1X
dNTP 10 mM 1 ml 13 ul 200 uM
MgCl 2 25 mM 3 ul 39 ul 1,5 mM
Primer para a frente 20 mM = 20 pmol / uL 1 ml 13 ul 20 pmol
Reverter Primer 20 mM = 20 pmol / uL 1 ml 13 ul 20 pmol
ADN molde Variável Variável Variável ~ 10 5 moléculas
Taq DNA polimerase 5 Unidades / * ul 0,5 ul 6,5 ul 2,5 unidades
50 uL / ​​Reacção

Reagentes Tabela 1. PCR na ordem em que devem ser adicionados.

* Unidades podem variar entre os fabricantes

** Adicionar todos os reagentes para a Mistura Principal excluindo qualquer necessidade de titulação ou que pode ser variável para a reacção. A Mistura Principal representado na tabela acima é calculada para 11 reacções mais 2 reacções adicionais para acomodar pipeta de transferência de perda assegurando que não é suficiente para alíquota de cada tubo de reacção.

Padrão 3 passo-PCR Ciclismo
Etapa do Ciclo Temperatura Tempo Número de Ciclos
Desnaturação inicial 94 ° C a 98 ° C 1 minuto 1
Desnaturação
Recozimento
Extensão
94 ° C
5 ° C abaixo de T m
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplicon e DNA polimerase dependente
25-35
Extensão final 70 & dpor exemplo; C a 80 ° C 5 minutos 1
Segure * 4 ° C 1

Tabela 2. Padrão 3 passo Ciclismo PCR.

* Os cyclers mais térmicas têm a capacidade para fazer uma pausa a 4 ° C indefinidamente no final dos ciclos.

70 ° C a 80 ° C
2-step PCR Ciclismo
Etapa do Ciclo Temperatura Tempo Número de Ciclos
Desnaturação inicial 94 ° C a 98 ° C 1 minuto 1
Desnaturação
Recozimento / Extensão
10 a 60 segundos
Amplicon e DNA polimerase dependente
25-35
Extensão final 70 ° C a 80 ° C 5 minutos 1

Tabela 3. 2-passo bicicleta PCR.

Hot Start PCR Ciclismo
Etapa do Ciclo Temperatura Tempo Ciclos
Desnaturação inicial 60 ° C a 95 ° C 5 minutos, em seguida, adicionar polimerase de ADN 1
Desnaturação
Recozimento
Extensão
94 ° C
5 ° C abaixo de T m
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplicon e DNA polimerase dependente
25-35
Extensão final 70 ° C a 80 ° C 5 minutos 1

Tabela 4. Hot Start bicicleta PCR.

Touchdown PCR Ciclismo
Etapa do Ciclo Temperatura Tempo Ciclos
Desnaturação inicial 94 ° C a 98 ° C 1
Desnaturação
Recozimento
Extensão
94 ° C
X = 10 ° C acima de T m
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplicon e DNA polimerase dependente
2
Desnaturação
Recozimento


Extensão
94 ° C
X-1 ° C reduzir 1 ° C, ciclo todos os outros
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplicon e polimerase dependente
28
Desnaturação
Recozimento
Extensão 94 ° C
5 ° C abaixo de T m
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplicon e DNA polimerase dependente
20-25
Extensão final 70 ° C a 80 ° C 5 minutos 1

Tabela 5. Touchdown PCR Ciclismo.

Abrandamento PCR Ciclismo
Etapa do Ciclo Temtempe Tempo Ciclos
Desnaturação inicial 94 ° C a 98 ° C 1 minuto 1
Desnaturação
Recozimento
Extensão
94 ° C
X ° C = 10 ° C acima de T m
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplicon e polimerase dependente
2
Desnaturação
Recozimento


Extensão
94 ° C
X-1 ° C reduzir 1 ° C, ciclo todos os outros
70 ° C a 80 ° C *
10 a 60 segundos
30 segundos
Amplicon e polimerase dependente
28
Desnaturação
Recozimento
Extensão
94 ° C
5 ° C abaixo de T m
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplicon e polimerase dependente
20-25
Extensão final 70 ° C a 80 ° C 5 minutos 1

Tabela 6. Abrandamento PCR Ciclismo.

* Para abrandamento PCR, a velocidade rampa é reduzido para 2,5 ° C s -1, com uma taxa de arrefecimento de 1,5 ° C s -1 para os ciclos de recozimento.

Solução stock Volume adicionado a 50 ul de reacção 13 X Mix Master Yeast 13 X Phage Mix Master Concentração Final
Estéril de H2O qs para 50 uL = uL 31 ou 30,5 qs para 650 uL = 396,5 qs para 520 uL = uL 403
Tampão de PCR 10X 5 ul 65 ul 65 ul 1X
10 mM 1 ml 13 ul 13 ul 200 uM
MgCl 2 Titulação Adicionados a cada reacção Adicionados a cada reacção Adicionados a cada reacção Variável ver titulação
Primer para a frente 20 mM = 20 pmol / uL 1 ml 13 ul 13 ul 20 pmol
Reverter Primer 20 mM = 20 pmol / uL 1 ml 13 ul 13 ul 20 pmol
ADN molde 2 fago ng / uL ou 10 Levedura ng / uL 0,5 Phage ul ou 1 uL de Levedura 6,5 ul 13 ul ~ 10 7 moléculas fago ou ~ 10 Levedura 5 moléculas
Polimerase 0,5 unidades / ** uL 0,5 ul 6,5 ul 6,5 ul 0,5 unidades / reação
40 uL + 10 (titulação) uL / ​​Reacção TITULAÇÃO
[MgCl 2] 0,00 mM 0,5 mM 1,0 mM 1,5 mM 2,0 mM 2,5 mM 3,0 mM 3,5 mM 4,0 mM 4,5 mM 5,0 mM
MgCl 2 0,00 ul 1,00 ul 2,00 ul 3,0 ul 4,00 ul 5,00 ul 6,00 ul 7,00 ul 8,00 ul 9,00 ul 10,00 ul
H 2 S 10,00 ul 9,00 ul 8,00 ul 7,00 ul 6,00 ul 5,00 ul 4,00 ul 3,00 ul 2,00 ul 1,00 ul 0,00 ul

<forte> Tabela 7. Titulação do Mg 2 + usado na Figura 3.

A Figura 1
Figura 1. Problemas comuns que surgem com primers e 3-passo de amplificação por PCR do ADN alvo. (A) de auto-recozimento dos iniciadores resultando na formação de estrutura secundária em gancho loop. Note-se que os primers nem sempre anneal nos extremos e podem formar estruturas menores do circuito. (B) Primer recozimento um ao outro, ao invés de o molde de ADN, criação de dímeros de iniciadores. Uma vez que os iniciadores anneal uns aos outros eles vão alongado para as extremidades de iniciadores. (C) ciclos de PCR gerar um fragmento amplificado específico. Padrão 3-passo dos ciclos de PCR incluem desnaturação do DNA molde, recozimento dos iniciadores, e extensão do ADN alvo (amplicon) por DNA polimerase.

A Figura 2
Figura balde de gelo 2. Com Reagents, pipetas, e as cremalheiras necessária para uma PCR. (1.) P-200 de pipeta, (2.) P-1000 de pipeta, (3.) P-20 de pipeta, (4). P-10 pipeta, (5). Placa de 96 poços e 0,2 ml paredes finas tubos de PCR , (6). Reagentes incluindo polimerase Taq, tampão de PCR 10x, MgCl2, água estéril, dNTPs, iniciadores, e ADN molde, (7). 1,8 ml tubos e cremalheira.

A Figura 3
Figura 3. Exemplo de um 2 Mg + titulações utilizados para optimizar um experimento PCR utilizando um padrão de 3-passo protocolo de PCR. (A) S. cerevisiae ADN genómico de levedura foi utilizado como um modelo para amplificar um gene 2098 pb GAL3. Nas pistas 1 - 6, onde a concentração de Mg 2 + é muito baixa, não existe nenhum produto, quer formado (pistas 1-5) ou muito pouco do produto formado (pista 6). As pistas 7 - 11 representam as concentrações óptimas de Mg 2 + para esta experiência de PCR como indicado pela presença do produto amplicon 2098 pb. (B) Uma uncharacterized mycobacteriophage molde de ADN genómico foi usado para amplificar um fragmento amplificado 566 pb. As pistas 1 a 4, o Mg + 2 concentração for demasiado baixo, como indicado pela ausência de produto. As pistas 5 a 11 representam as concentrações óptimas de Mg 2 + para este PCR, como indicado pela presença do produto amplicon 566 kb. (C). S. cerevisiae ADN genómico de levedura foi utilizado como um modelo para amplificar um gene 2098 pb GAL3 como indicado no painel. No entanto, a temperatura de recozimento foi reduzida de 61 ° C a 58 ° C, resultando em algumas bandas não específicas de PCR com comprimentos variáveis ​​que produzem um efeito manchas sobre o gel de agarose. As pistas 1 a 4, onde a concentração de Mg 2 + é muito baixa, não existe nenhum produto formado. Pistas 5 a 8 representam as concentrações óptimas de Mg 2 + para este PCR como pode ser visto pela presença de um esfregaço e em torno da banda 2098 tamanho do produto amplicon kb. As pistas 9 - 11 são indicativos de condições excessivamente rigorosas com nenhum produto formado. (Ac) Lanes 12 é uma negative controlo que não continha qualquer DNA molde. Pista M (marcador) foi carregado com NEB Ladder 1kb.

A Figura 4
Figura 4. Tubos estéreis utilizados para PCR. (1). Tubo de 1,8 ml (2.) 0,2 ml indivíduo fino tubo de PCR murada, (3.) 0,2 ml de tiras de finos tubos PCR de parede e bonés.

A Figura 5
Figura 5. Termociclador. Fechado imagem termociclador esquerda. Imagem direita contém 0,2 ml de finos tubos PCR de parede colocados no bloco de aquecimento de um ciclador térmico aberto.

Discussion

PCR tornou-se uma ferramenta indispensável no arsenal da ciência biológica. PCR alterou o curso da ciência permitindo biólogos para se obter o poder sobre genomas, e fazer genes híbridos com novas funções, permitindo específico e preciso testes clínicos, ganhando percepções do genoma e diversidade, bem como genes simplesmente de clonagem para a análise bioquímica adicional. Aplicação PCR é limitado apenas pela imaginação do cientista que exerce o seu poder. Há muitos livros e artigos que descrevem novos usos especializados de PCR, e muitos mais serão desenvolvidas durante a próxima geração da ciência biológica. No entanto, independentemente das abordagens previstas, o quadro fundamental continua o mesmo. PCR, em toda a sua grandeza, é uma aplicação in vitro para gerar grandes quantidades de um segmento específico de ADN.

Projetando um experimento PCR requer pensamento e paciência. Os resultados mostrados na Figura 3 exemplificam um do ch grandeallenges ao projetar uma estratégia de otimização para a PCR. Isto é, como um parâmetro de PCR é alterado, ele pode ter impacto outro. Como um exemplo, se a PCR inicial foi realizada à temperatura de sub-óptima de recozimento (58 ° C) com um óptimo 2 + Mg concentração de 2,0 mM, então o resultado seria produzir um esfregaço como visto na Figura 3c. Uma tentativa para resolver o esfregaço pode envolver a criação de condições de PCR com reacções contendo 2,0 mM de MgCl2 e ajustando a temperatura de recozimento de 61 ° C. No entanto, como pode ser visto na Figura 3a, isto não produz qualquer produto. Por conseguinte, é aconselhável para titular os reagentes, em vez de adicionar uma concentração para uma reacção única, quando a resolução de resultados falsos. Além disso, os ajustes mais comuns que são necessários para a optimização de um experimento PCR são para alterar a concentração de Mg 2 + e para corrigir as temperaturas de recozimento. No entanto, se essas mudanças não minimizar ou anular os resultados aberrantes, a titulação de additives e / ou alterando os protocolos de ciclismo condição, como descrito nas Tabelas 2-6 pode aliviar o problema. Se tudo mais falhar, redesenhar os primers e tente, tente novamente.

Disclosures

Não tenho nada para revelar.

Acknowledgments

Agradecimentos especiais a Kris Reddi na UCLA para a criação de reagentes e derramando géis e Erin Sanders na Universidade da Califórnia em busca de inspiração, orientação e apoio e revisão do manuscrito. Gostaria também de agradecer a Giancarlo Costaguta e S. Gregório Payne para o fornecimento do DNA genômico de levedura e primers para amplificar o gene GAL3. Gostaria também de agradecer Shah Bhairav ​​para fotografar o equipamento de laboratório e reagentes utilizados para fazer figuras de 2 a 4. O financiamento para este projeto foi fornecido pelo HHMI (HHMI Grant No. 52006944).

Materials

Name Company Catalog Number Comments
Taq Polymeras Sigma-Aldrich D4545-25UN
dNTPs Qiagen 201225
0.2 ml Thin Wall Tubes PCR tubes Bio-Rad 223-9469
0.2 ml Thin Wall Tube caps Bio-Rad 223-9472
EDTA disodium salt dihydrate Sigma-Aldrich E5134
Trizma-HCl Sigma-Aldrich T-3253
Custom Phage Primer Invitrogen 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG
Custom Phage Primer Invitrogen 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Custom Yeast Primer Integrated DNA Technologies SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Custom Yeast Primer Integrated DNA Technologies Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Thermal Cycler Bio-Rad 170-9703 My Cycler
Agarose ISC BioExpress E-3120-500
Gel electrophoresis Hoeffer Scientific Instruments Model HE33
1 kb DNA Ladder New England Biolabs N3232S
Bio Rad Power Pack Bio-Rad 164-5050 PowerPac Basic
Gel Doc system Fotodyne Incorporated FOTO/Analyst Investigator FX Workstation

DOWNLOAD MATERIALS LIST

References

  1. Albert, J., Fenyo, E. M. Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbiol. 28, 1560-1564 (1990).
  2. Baskaran, N., et al. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6, 633-638 (1996).
  3. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. PCR buffer optimization with uniform temperature regimen to facilitate automation. PCR Methods Appl. 2, 234-240 (1993).
  4. Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. Stability of ribonucleic acid double-stranded helices. J. Mol. Biol. 86, 843-853 (1974).
  5. Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).
  6. Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20, 1717-1723 (1992).
  7. Coleman, W. B., Tsongalis, G. J. Diagnostics for the clinical laboration. Humana Press. (2005).
  8. D'Aquila, R. T., et al. Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19, 3749 (1991).
  9. Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. General concepts for PCR primer design. PCR Methods Appl. 3, S30-S37 (1993).
  10. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 4008 (1991).
  11. Erlich, H. A., Gelfand, D., Sninsky, J. J. Recent advances in the polymerase chain reaction. Science. 252, 1643-1651 (1991).
  12. Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. PCR-amplification of GC-rich regions: 'slowdown PCR. Nat. Protoc. 3, 1312-1317 (2008).
  13. Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. Specific amplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res. 16, 11844 (1988).
  14. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957-3958 (1997).
  15. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. PCR Protocols: A guide to methods and applications. Academic Press, Inc. San Diego. (1990).
  16. King, N. Methods in Molecular Biology. 630, Humana Press. (2010).
  17. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56, 341-361 (1971).
  18. Korbie, D. J., Mattick, J. S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 3, 1452-1456 (2008).
  19. Kramer, M. F., Coen, D. M. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).
  20. Kramer, M. F., Coen, D. M. The polymerase chain reaction. Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).
  21. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  22. Kwok, S., et al. Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694 (1987).
  23. McConlogue, L., Brow, M. A., Innis, M. A. Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine. Nucleic Acids Res. 16, 9869 (1988).
  24. Mullis, K. B. The unusual origin of the polymerase chain reaction. Sci. Am. 262, 56-65 (1990).
  25. Mullis, K. B. Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris). 48, 579-582 (1990).
  26. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion). PCR Methods Appl. 1, 1-4 (1991).
  27. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  28. Paabo, S., Gifford, J. A., Wilson, A. C. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Res. 16, 9775-9787 (1988).
  29. Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry. 32, 137-144 (1993).
  30. Roux, K. H., Hecker, K. H. One-step optimization using touchdown and stepdown PCR. Methods Mol. Biol. 67, 39-45 (1997).
  31. Rychlik, W., Spencer, W. J., Rhoads, R. E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Saiki, R. K., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, 487-491 (1988).
  33. Saiki, R. K., et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1350-1354 (1985).
  34. Sambrook, J. A. R., David, W. Molecular Cloning A Laboratory Manual. 2, 3, Cold Spring Harbor Laboratory Press. (2001).
  35. Sarkar, G., Kapelner, S., Sommer, S. S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18, 7465 (1990).
  36. Smit, V. T., et al. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 16, 7773-7782 (1988).
  37. Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63, 3741-3751 (1997).
  38. Wu, R. Methods in Enzymology. 218, Academic Press, Inc. San Diego. (1993).

Comments

1 Comment

  1. Thanks for the great overview of the all-important PCR procedure. I will no doubt reference it often in the future.

    I have a PCR troubleshooting question...what do to about streaking on the gel after a successful amplification? My bands are nice and bright and where they are supposed to be, but there is a heavily-streaked "path" starting at the wells and following until the end where my bands are. Is there something I can do about my PCR conditions, or the thermocycler settings? Any comments would be appreciated.

    Reply
    Posted by: Doug E.
    September 8, 2013 - 1:23 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics