Reverse lievito sistema Two-ibrida per identificare mammiferi Nuclear Receptor residui che interagiscono con leganti e / o antagonisti

1Department of Genetics, Albert Einstein College of Medicine, 2Shanghai Key Laboratory of Complex Prescription and MOE Key Laboratory for Standardization of Chinese Medicines, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine
* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Ketoconazolo lega e antagonizza Pregnane X Receptor (PXR) attivazione. Di lievito di alta schermi di throughput di mutanti PXR definiscono una regione unica per l'associazione ketoconazolo. Questo metodo genetico a base di lievito scopre interazioni recettore nucleare nuovi con leganti che associano con siti di legame di superficie.

Cite this Article

Copy Citation | Download Citations

Li, H., Dou, W., Padikkala, E., Mani, S. Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists. J. Vis. Exp. (81), e51085, doi:10.3791/51085 (2013).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Come regolatore critico del metabolismo dei farmaci e infiammazione, Pregnane X Receptor (PXR), svolge un ruolo importante nella patofisiologia collegamento metabolismo e infiammazione (es. steatosi epatica) 1,2. C'è stato molto progresso per l'identificazione di ligandi agonisti a PXR, tuttavia, ci sono le descrizioni limitate di antagonisti drug-like e dei loro siti di legame su PXR 3,4,5. Una barriera critica è l'incapacità di purificare efficientemente proteina intera per studi strutturali con antagonisti nonostante PXR è stato clonato e caratterizzato nel 1998. Il nostro laboratorio ha sviluppato un romanzo di lievito ad alta velocità basata saggio del doppio ibrido per definire un antagonista, ketoconazolo di residui vincolante per PXR 6. Il nostro metodo prevede la creazione di librerie mutazionali che salvare l'effetto delle singole mutazioni sulla superficie AF-2 di PXR previsto per interagire con ketoconazolo. Rescue o seco "guadagno di funzione"nd mutazioni possono essere fatte in modo tale che le conclusioni riguardanti l'interazione genetica di ketoconazolo e il residuo di superficie (s) on PXR sono fattibili. Così, abbiamo sviluppato un elevato throughput two-hybrid schermo lievito di mutanti PXR che interagiscono con il suo coactivator, SRC-1. Usando questo approccio, in cui il lievito è stato modificato per accogliere lo studio del farmaco antifungino, ketoconazolo, potremmo dimostrare mutazioni specifiche su PXR arricchiti in cloni incapaci di legarsi al ketoconazolo. Con logica inversa, possiamo concludere che i residui originali siano residui interazione diretta con ketoconazolo. Questo test rappresenta un romanzo, test genetico trattabili allo schermo per antagonista siti di legame sulle superfici del recettore nucleare. Questa analisi può essere applicata a qualsiasi farmaco indipendentemente dal suo potenziale citotossico di lievito e di proteina cellulare (s) che non può essere studiata utilizzando biologia strutturale standard o metodi basati proteomica. Potenziali insidie ​​comprendono l'interpretazione dei dati (metodi complementari utile), relizione sul metodo unico Y2H, esperienza nella gestione di lievito o l'esecuzione di lievito saggi di due ibridi, e l'ottimizzazione del dosaggio.

Introduction

Il lievito due ibridi (Y2H) saggio è ampiamente utilizzato per rilevare le interazioni proteina-proteina e più recentemente per la scoperta di nuove piccole molecole che interrompono proteina-proteina complessi di interazione 7, 8, 9, 10, 11. Tuttavia, gli approcci convenzionali di questo test, utilizzato per la scoperta di nuovi farmaci o di "hits", non consentono per il rilevamento di residui di interazione allosterici di prodotti chimici composti all'interno di superfici proteina-proteina, che, quando alterati ancora interagire e consentire l'interrogatorio dei residui alterati 11 . Infatti, tale metodo (s), se possibile sviluppare, consentirebbe un sistema di lievito trattabili per la valutazione ad alta velocità di residui di interazione allosterici critiche per l'interazione proteina-proteina perturbazione. Nel contesto di scoperta di farmaci, il modo più diretto per stabilire l'interazione dei composti con proteine ​​comporterebbe determinazione strutturale (es cristallizzazione del complesso proteina-inibitore). Questi metodi sono cumbersome, utilizzare le risorse elaborate e non è tecnicamente possibile effettuare studi strutturali su tutte le proteine.

Sistemi di screening di stupefacenti genetica trattabili sono state stabilite nei batteri 1, 2 e altri sistemi modello, come mammiferi two-hybrid. Tuttavia, questi sistemi devono ottimizzazione e sistemi alternativi come Y2H sono ancora i più testato nella scoperta di farmaci. Esistono limitazioni che includono scarsa sensibilità e affidabilità delle interazioni con metodi singolari 13, tuttavia, un singolo test Y2H può essere modificato per rispondere a domande specifiche relative ai residui di interazione. Nel campo della ricerca recettore nucleare, Y2H è stato usato per definire proteine ​​interagenti 14, tuttavia, queste interazioni proteina sono state raramente utilizzata per definire la natura in cui ligandi / antagonisti interagiscono con complessi recettore-proteine ​​nucleari. Così, il nostro laboratorio concentrato sforzi sulla definizione di un metodo, in particolare per le proteine ​​recettori che non sonofacilmente suscettibili di proteomica metodi basati, che sarebbe dissotterrare romanzo ligando / antagonista interagire residui utilizzando un Y2H basato piattaforma di scoperta inverso.

Sulla base della nostra precedente scoperta che il ketoconazolo interrompe PXR e il suo attivatore SRC-1, abbiamo sviluppato un nuovo sistema Y2H che ci permettono di definire e interrogare ketoconazolo interagire residui sulla PXR 6 inversa. Il nostro metodo si basa sulle proprietà della proteina GAL4 lievito che consiste di domini separabili responsabili dell'attivazione di legame al DNA e trascrizionale. La proteina PXR LBD è espressa come una fusione al dominio LexA DNA-binding (DNA-BD), mentre le lunghe co-attivatori SRC-1 (coactivator recettore steroide 1) proteine ​​sono espresse come fusioni al dominio di attivazione GAL4 (AD ). Interazione tra PXR e SRC-1 proteine ​​di fusione porta all'attivazione trascrizionale di GAL4 siti di legame contenenti gene reporter β-Lac Z che viene integrato nel genom lievitoe. Ketoconazolo, un antagonista PXR, interrompe PXR e SRC-1 interazione 15, 16, 17 e si può rilevare l'interazione di PXR e SRC-1 in presenza o assenza di ketoconazolo dopo colorazione colonie su filtri per l'attività X-gal. Il principio di Y2H è illustrato in Figura 1 e la procedura sperimentale è riassunto in Figura 2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Costruzione di PXR e SRC-1 Fusioni in vettori di lievito

  1. Amplificazione PCR di Human PXR LBD (107-434 amminoacidi) e Human SRC-1 a figura intera (1-1401 amminoacidi).
    1. Utilizzare pSG5-hPXR plasmide 8 come modello PXR LBD, utilizzare plasmide pCMX-SRC1 come SRC-1 modelli.
    2. Thaw PCR SuperMix, i modelli di DNA e primer (vedi Materiali), tenerli su ghiaccio.
    3. Aggiungere 0,25 mg / template DNA microlitri 1 ml, 10 mM coppie di primer 2 microlitri ciascuno, PCR SuperMix 45 ml e aggiungere H 2 O per portare il volume totale di 50 microlitri.
    4. Impostare PCR in un ciclo di 94 ° C per 2 min, 20 cicli di 94 ° C per 30 sec, 55 ° C per 30 sec e 72 ° C per 2 min, poi un ciclo di 72 ° C per 10 min per estensione. Controllare prodotti PCR eseguendo il 1% gel di agarosio.
  2. I prodotti di PCR clonazione in vettori Y2H.
    1. Purificare prodotti di PCR dal 1% gel di agarosio. Digest PXR, LBD, PCR, e Y2H vettore PSH2-1 conBamHI e Sali; digerire SRC-1 PCR e Y2H vettore pGADNOT con NotΙ e SalΙ. Per fare questo, aggiungere 1 mg di DNA, 3 ml 10x tampone di reazione, 1 ml enzimi di restrizione, e, infine, H 2 O per portare il volume totale di 30 microlitri.
    2. Mettere i campioni digestione nel 37 ° C a bagnomaria per 1 ora. Controllare digestione eseguendo il 1% gel di agarosio.
    3. Purificare i campioni di digestione da 1% gel di agarosio, legare digerito prodotti di PCR e vettori Y2H e trasformare le cellule competenti DH5a.
    4. Scegli le colonie e isolare il DNA plasmide.
  3. Identificare PSH2-1-PXR plasmide DNA BamHI / SalI digestione, identificare pGADNOT-SRC-1 plasmide DNA Notl / SalI digestione. Verificare che tutto il DNA plasmide positivo mediante sequenziamento.

2. Lievito Two-hybrid Saggi

  1. Inoculare il ceppo di lievito in 5 ml YPAD e incubare per tutta la notte mediante agitazione costante (220 rpm a 30 ° C). Nota: Il ceppo Saccharomyces cerevisiae era CTY10-5d(Mat A ade2 trp 1-901 LEU2-3, 112 his3-200 ga l4 - gal80 - URA3 :: lexA-lacZ) che contiene un gene integrato GAL1-lacZ con lexA operatore 10. Per ottenere cellule di lievito vitali resistenti al ketoconazolo, ma quelli che non portano alterazioni trasportatore come causa della resistenza azolici 18-20, nuovi ceppi di lievito CTY10-5d sono stati ottenuti dalla prima ERG3 cancellazione (ERG3 Δ) e poi introducendo la cancellazione supplementare ERG11 (ERG3 Δ / erg11 Δ) geni di ricombinazione omologa. I dettagli costruttivi sono stati descritti in un manoscritto precedentemente pubblicato 6.
  2. Il giorno successivo (al mattino), inoculare lievito (1,20) in 5 ml YAPD e incubare avere un OD 600 ~ 0,2 mediante agitazione costante (220 rpm a 30 ° C).
  3. Agglomerare le cellule a 2.000 rpm in una microcentrifuga per 2 minuti e scartare il surnatante. Quindi lavare la pellet due volte con acqua autoclave e una volta con 0.1 M LIAC.
  4. Dopo l'ultimo lavaggio, scartare il surnatante e aggiungere i seguenti reagenti per il pellet cellulare: 240 ml PEG 3500 al 50% w / v, 36 microlitri 1 M LIAC, 50 pl 2 mg / ml bollito ssDNA sperma di salmone, H 2 O 34 microlitri. Vortex per mescolare, aggiungere 1 mg PSH-PXR e 1 mg pGADNOT-SRC-1 DNA e mescolare.
  5. Trasferire la miscela di polistirene tubo a fondo rotondo, agitare la trasformazione, mescolare (220 rpm a 30 ° C) per 30 min. Spostare il tubo a 42 ° C bagnomaria e incubare per altri 30 min.
  6. Centrifugare la provetta a 2.000 rpm per 2 minuti e rimuovere il surnatante. Lavare pellet una volta con acqua autoclave.
  7. Aggiungere 100 ml di acqua sterile nel tubo, risospendere le cellule dalla barretta dolce toccando e pipettaggio, poi piastra su piastre di -His/-Leu Dropout Media (Formulazione per un litro -His/-Leu Dropout medio: 20 g destrosio, 1.7 g YNB, 0.67 g CSM-His/-Leu, 5 g di solfato di ammonio, 1,5% agar) e incUbate a 30 ° C per 3-4 giorni per isolare trasformanti.

3. X-gal Filter Assay

  1. Tagliare membrana di nitrocellulosa alla dimensione di una parte di una piastra di Petri. Etichettare la membrana di nitrocellulosa per segnare l'orientamento.
  2. Posizionare membrana di nitrocellulosa premarcata su colonie di lievito, assicurarsi che la membrana è in contatto con la superficie del terreno piastra.
  3. Rimuovere la membrana, posizionarlo lato colonia su una carta da filtro a 3 mm, e collocare la membrana e la carta da filtro a -80 ° C per 15 min.
  4. Preparare la soluzione di X-gal. Aggiungere 50 microlitri 20 mg / ml X-gal e 15 microlitri β-mercaptoetanolo al 5 ml di Z-buffer (tampone 1 L contiene 16,1 g di Na 2 HPO 4 7H 2 O, 5,5 g di NaH 2 PO 4 H 2 O, 0,75 g KCl, 0,25 g MgSO 4 • 7H 2 O). Se Z Buffer fu mantenuta a 4 ° C, portarlo a temperatura ambiente prima di aggiungere questi reagenti.
  5. Mettere due cerchi di 3 millimetri carta da filtroin una piastra di Petri e ammollo con 5 ml di soluzione X-gal. Scolare il tampone in eccesso dalla piastra di Petri e posizionare la membrana di nitrocellulosa con la colonia verso l'alto.
  6. Chiudere il coperchio, assicurarsi che la membrana è in contatto completo con la carta da filtro ed è completamente bagnato. Avvolgere la piastra di Petri in strisce e incubare a 37 ° C per 30 min a overnight.

4. Liquid Assay β-gal

  1. Crescere lievito in -His/-Leu Dropout mezzo liquido di OD 600 0.7.
  2. Trasferire 1 ml in mezzo una provetta da 1,5 ml microcentrifuga e centrifugare a 3000 rpm per 2 min. Scartare il surnatante.
  3. Aggiungere 1 ml di Z Buffer per risospendere il pellet, centrifugare a 3000 rpm ancora per 2 min. Scartare il surnatante.
  4. Aggiungere 150 ml di Z Buffer con 2ME per risospendere il pellet cellulare, mescolare poi aggiungere 50 ml di cloroformio e il 20 microlitri 0,1% SDS. Vigorosamente vortice il campione per 15 sec.
  5. Aggiungere 700 ml di ONPG Soluzione (1 mg / ml in Z buffer). Impostare il timer, incubare a 30 ° C abbastanza a lungo per permettere al colore giallo di sviluppare e notare tempo di reazione totale.
  6. Aggiungere 500 ml di 1 M di Na 2 CO 3 per bloccare la reazione e determinare l'assorbanza a 420 nm. Il bianco è la soluzione ONPG 700 ml più 500 ml 1 M Na 2 CO 3.

Calcola Unità Miller come segue: Miller Unità = (A420 * 1000) / (A600 * min * ml)

A420: unità di assorbanza a 420 nanometri; A600: unità di assorbanza a 600 nanometri, min: il tempo di reazione in minuti; ml: il volume di reazione in ml

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Noi eseguito un test per vedere se potevamo rilevare una lettura colorimetrica dell'associazione di PXR e del recettore steroide coactivator-1 (SRC-1). Dato che il lievito ha una significativa produzione di sterolo, è stato precedentemente dimostrato che l'espressione lacZ nel lievito può essere indotta senza la necessità di ulteriori ligando esogeno. Abbiamo trovato che l'espressione lacZ (colonie blu) è anche indotto nel ceppo di lievito trasformato con PXR e SRC-1, tuttavia, non vi è alcuna induzione dell'espressione LacZ (colonie bianche) in lievito trasformate con i vettori vuoti, PXR o SRC-1 singolarmente (Figura 3). Per determinare se ketoconazolo (25 micron) perturbato PXR e SRC-1 di interazione in lievito, piastre di replica contenenti ketoconazolo erano intrisi di nitrocellulosa ed il filtro X-gal, ascensore e sono state eseguite β-galattosidasi saggi liquidi. Abbiamo dimostrato che il ketoconazolo sconvolge PXR e SRC-1 interazioni nel lievito da tutte le colonie dal filtro replica ora erano bianchi (che eraevidenziata anche dalla significativa riduzione dell'attività β-galattosidasi mediante saggi enzimatici liquidi) (Figura 4A). Avevamo già mostrato nei test di mammifero che il mutante PXR (T248E/K277Q) può essere attivato da un forte legante (es. rifampicina), ma è immune agli effetti antagonisti di ketoconazolo 1 7. Allo stesso modo, quando abbiamo costruito il PXR doppio mutante (T248E/K277Q) nel plasmide lievito e poi eseguito trasformazioni lievito con SRC-1, siamo stati in grado di dimostrare che le colonie esposte al ketoconazolo conservano ancora l'espressione LacZ (Figura 4B).

Figura 1
Figura 1. Illustra schematicamente i principi del doppio ibrido in lievito (Y2H) dosaggio. Il dosaggio del lievito è stato stabilito come un saggio funzionale che consente l'isolamento di mutanti PXR che sono resist al ketoconazolo inibizione mediata di SRC-1 interazione. A, l'interazione del doppio ibrido rifampicina indotta di proteina di fusione LexA-DB-hPXR con SRC-1 fusa al dominio GAL4-attivazione (GAL4AC-SRC-1). I risultati di interazione in colonie blu in un saggio X-gal causa della giornalista LacZ. B, presenza di ketoconazolo sconvolge l'interazione rifampicina indotta di hPXR con SRC-1. X-Gal risultati del saggio in colonie bianche. C, la presenza di una mutazione (indicati con un asterisco) in hPXR che rende immune all'azione di ketoconazolo darà una colonia blu. D, una ulteriore modifica della nostra analisi in futuro potrebbe includere ulteriori mutazioni sito soppressori secondo (illustrate con mezza luna) annullando l'effetto della prima mutazione che potrebbe provocare l'interruzione della hPXR-SRC-1 interazione e quindi una colonia bianca nel saggio X-gal. LexAOp, LexA operone, Galp, Gal4 promoter, Lac Z, beta-glalactosidase, DB, LexAOp dominio DNA-binding di Galp, AC, attodominio ivation, *, mutazione (s). (Tratto da riferimento 6). Clicca qui per ingrandire la figura .

Figura 2
Figura 2. Flow Chart sperimentale.

Figura 3
Figura 3. X-gal, ascensore dosaggio e β-gal dosaggio liquido. Lievito è stato trasformato con plasmidi indicate e colonie placcati sottoposti a X-gal lift test (pannello di sinistra) e β-gal liquido dosaggio (pannello di destra). PSH vettore vuoto + pGADNOT vettore vuoto (corsia 1); PSH-PXR + pGADNOT vettore vuoto (corsia 2); PSH vettore vuoto + pGADNOT-SRC-1 (corsia 3); PSH-PXR + pGADNOT-SRC-1 (corsia 4 </ Em>), 5. PSH-INI-1 + pGADNOT-c-Myc (controllo positivo, corsia 5). (Riprodotto da riferimento 6).

Figura 4
Figura 4. Ketoconazolo interrompe wild-type, ma non mutante associazione PXR con coactivator, SRC-1 colonie di lievito erano replica in piastre contenenti veicolo. (0,2% DMSO, corsia 1) o ketoconazolo (25 micron; corsia 2). X-gal lift test (pannello di sinistra) e β-gal liquido dosaggio (pannello di destra) sono stati poi eseguiti. Tipo PXR selvatico (A, B linea 1 e 2) e ketoconazolo mute T248E/K277Q mutante (B linea 3 e 4) sono stati mostrati in questa figura. (Riprodotto da riferimento 6).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Nel nostro test Y2H modificata, abbiamo identificato residui importanti per le interazioni ketoconazolo su PXR 6. Dal SRC-1 è un coactivator (ed è stato clonato nel vettore pGADNot), abbiamo provato anche se SRC-1 potrebbe attivare l'espressione lacZ quando clonato nel sistema vettore PSH e se questo cambierebbe il profilo di attivazione e / o influenzare il leakiness di il lievito saggio del doppio ibrido. Utilizzando i nostri plasmidi ridisegnati abbiamo effettuato test di due ibride in ERG3 Δ / erg11 lievito Δ. Come prima, abbiamo dimostrato che l'espressione lacZ (colonie blu) è anche indotta in ERG3 Δ / erg11 ceppo di lievito Δ trasformato con PXR e SRC-1, tuttavia, non vi è nessuna induzione dell'espressione LacZ (colonie bianche) in lievito trasformate con i vettori vuoti , PXR o SRC-1 individualmente (dati non riportati). Il nostro approccio fornisce un potente metodo nuovo per l'isolamento di interazione genetica residui ligando-proteina allosterica per le proteine ​​non suscettibili di conventionale biologia e / o proteomica strutturale approcci 5,21.

Il protocollo descritto ha diverse insidie ​​che devono essere riconosciuti. In primo luogo, la sensibilità di rilevazione, in particolare gli effetti antagonisti parziali sui residui di interazione proteina-proteina può limitare la risoluzione del dosaggio. Scansione colorimetrico potrebbe contribuire a risolvere alcuni dei rilevamento emette 21. In secondo luogo, la presenza di colonie blu non può sempre indicare le mutazioni PXR resistenti ketoconazolo (falsi positivi). L'espressione lacZ potè essere salvato in presenza di ketoconazolo dovuta a mutazione (s) in PXR che rende la proteina costitutivamente attivo o attivo indipendente di SRC-1 interazione. Tali mutanti di PXR possono distinguere dai veri mutanti resistenti ketoconazolo testando la capacità del LexA-DB-PXR di auto attivare espressione lacZ, cioè questi mutanti produrranno colonie blu in assenza di GAL4AC-SRC-1. Come corollario, i mutanti possono alcosì introdotto nel lievito usando l'GAL4AC-plasmide in assenza di LexA-DB-SRC-1 per descrivere ulteriori prove per auto-attivazione di LacZ. In terzo luogo, è noto se lo stesso risultato si otterrebbe se sono stati usati altri protocolli Y2H / vettori 13. In quarto luogo, lo studio di mutanti revertant intramolecolari (secondo portale di mutanti soppressori di mutanti ketoconazolo-resistente) può aggiungere alla comprensione del legame attraverso la definizione di residui vicini che hanno un impatto farmacoforo associazione antagonista. Con una modifica della biblioteca di mutanti, si può definire questo più precisamente utilizzando un mutante ketoconazolo resistente come il modello mutagenesi.

Questo metodo può essere modificato per includere qualsiasi farmaco quale il target citotossica in lievito è ben definito o di un farmaco (s) che non ha potenziale tossicità verso lievito. Il lievito può essere modificato, come abbiamo dimostrato 6, ed essere ancora valida per saggi Y2H. La potenza di questo metodo si basa anche su accessorie informazione da altri test (ad esempio una docking molecolare) che informano le interazioni specifiche del sito. Inoltre, specifiche interazioni recettore nucleare / coregulator (es nurr77/LKB1; AR/PELP1) possono essere studiate 22,23. La morbidezza di questo sistema è che è portatile, può essere effettuata all'interno giorni in un alto modo throughput e non richiede reagenti o metodi costosi.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Nessun conflitto di interessi dichiarati.

Acknowledgments

Questo lavoro è stato sostenuto dal National Institutes of Health (NIH) concede CA127231 e The Damon Runyon Premio Fondazione Clinical Investigator (CI 1502) (SM). Vorremmo ringraziare il professor Zdenek Dvorak da Palacky Università di Olomouc, Repubblica Ceca per i suoi utili intuizioni che parlano di portabilità di questa tecnica per la loro istituzione e la standardizzazione del protocollo.

Materials

Name Company Catalog Number Comments
Yeast Strain CTY10-5d erg3Δ/erg11Δ Our lab CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 .
YPD Growth Medium BD Biosciences 630409
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate BD Biosciences 233520
Bacto Agar BD Biosciences 214010
CSM-His/-Leu Complete Supplement Mixture MP Biomedicals 4250-412
ONPG (o-Nitrophenyl Β-D- Galactopyranoside). Sigma-Aldrich N1127
2-Mercaptoethanol Sigma-Aldrich M6250
Luria Broth (LB) Sigma-Aldrich L3022
X-Gal Fisher BP-1615
Sonicated Salmon Sperm DNA boiled (10 mg/ml) Life Technology 156-017
Ampicillin Acros Organics 61177
Ketoconazole Sigma-Aldrich K1003
N,N-Dimethylformamide Acros Organics 326871000
Lithium Acetate Sigma-Aldrich L4158
50% PEG-3350 solution, filter-sterilized Sigma-Aldrich P-3640
Nitrocellulose Membrane Whatman 10402091
10 cm Petri Dish Fisher 875712
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3' our lab PXR LBD forward primer for pSH2-1
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3' our lab PXR LBD reverse primer for pSH2-1
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3' our lab SRC-1 forward primer for pGADNOT
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3' our lab SRC-1 reverse primer for pGADNOT
Platinum PCR Supermix Invitrogen 11306-016
BamHI our lab R0136
SalI our lab R0138
NotI our lab R0189

DOWNLOAD MATERIALS LIST

References

  1. Kliewer, S. A., et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell. 92, (1), 73-82 (1998).
  2. Blumberg, B., et al. a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 12, (20), 3195-3205 (1998).
  3. Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists. Pharm. Res. 26, (8), 1807-1815 (2009).
  4. Pondugula, S. R., Mani, S. Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response. Cancer Lett. 328, (1), 1-9 (2013).
  5. Mani, S., Dou, V., Redinbo, M. R. PXR antagonists and implications for drug metabolism. Drug Metab. Rev. 45, (1), 60-72 (2013).
  6. Li, H., et al. Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR. J. Biol. Chem. 288, (19), 13655-13668 (2013).
  7. Hollenberg, S. M., et al. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15, (7), 3813-3822 (1995).
  8. Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell. 74, (1), 205-214 (1993).
  9. Wang, H., et al. The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor. Mol. Endocrinol. 22, (4), 838-857 (2008).
  10. Kalpana, G. V., Goff, S. P. Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system. Proc. Natl. Acad. Sci. U.S.A. 90, (22), 10593-10597 (1993).
  11. Hamdi, A., Colas, P. Yeast two-hybrid methods and their applications in drug discovery. TiPS. 33, (2), 109-118 (2012).
  12. Battesti, A., Bouveret, E. The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli. Methods. 58, (4), 325-334 (2012).
  13. Caufield, J. H., Sakhawalkar, N., Uetz, P. A comparison and optimization of yeast two-hybrid systems. Methods. 58, (4), 317-324 (2012).
  14. Albers, M., et al. Automated yeast two-hybrid screening for nuclear receptor-interacting proteins. Mol. Cell Proteomics. 4, (2), 205-213 (2005).
  15. Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics. J. Biol. Chem. 277, (36), 32453-32458 (2002).
  16. Huang, H., et al. Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole. Oncogene. 26, (2), 258-268 (2007).
  17. Wang, H., et al. Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs. Clin. Cancer Res. 13, (8), 2488-2495 (2007).
  18. Ghannoum, M. A., Rice, L. B. Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin. Microbiol. Rev. 12, (4), 501-517 (1999).
  19. Kaur, R., Bachhawat, A. K. The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae. Microbiology. 145, 809-818 (1999).
  20. White, T. C., Marr, K. A., Bowden, R. A., cellular, Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin. Microbiol. Rev. 11, (2), 382-402 (1998).
  21. Serebriiskii, I. G., et al. Detection of peptides, proteins, and drugs that selectively interact with protein targets. Genome Res. 12, 1785-1791 (2002).
  22. Yang, L., et al. Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer. Mol Endocrinol. 26, (4), 550-561 (2012).
  23. Zhan, Y. Y., et al. The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK. Nat Chem Biol. 8, (11), 897-904 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics