للطي وتوصيف روبوت الحيوية استجابة من الحمض النووي اوريغامي

Chemistry
 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

وnanorobot DNA هو جهاز النانومترية سداسية جوفاء، تهدف إلى فتح استجابة للمؤثرات معينة والبضائع الحالية المحتبسة داخل. كل من المحفزات والبضائع يمكن تكييفها وفقا لاحتياجات محددة. نحن هنا تصف البروتوكول تلفيق nanorobot DNA، مع استخدام تقنية اوريغامي DNA. يبدأ الإجراء عن طريق خلط المواد الغذائية قصيرة DNA واحدة حبلا في خليط الأوراق المالية التي يتم بعد ذلك تضاف إلى طويلة، دائرية، سقالة DNA واحدة حبلا في وجود منطقة عازلة للطي. وتمت برمجة A الحرارية cycler على معيار لخفض تدريجيا درجة حرارة التفاعل خلط لتسهيل الصلب المواد الغذائية إلى سقالة، وهي هي القوة المحركة للطي من nanorobot. مرة واحدة في رد فعل للطي 60 ساعة كاملة، يتم تجاهل المواد الغذائية الزائدة باستخدام فلتر الطرد المركزي، تليها التصور عبر الاغاروز هلام الكهربائي (AGE). وأخيرا، يتم التحقق منها تلفيق الناجح لnanorobot بواسطة المجهر الإلكتروني النافذ (TEM)،مع استخدام اليورانيل-فورمات كما صمة عار سلبية.

Introduction

استخدامات للأحماض النووي تكنولوجيا النانو هي مذهلة. وقابلية الإستطراق قاعدة الاقتران واتسون-كريك فضلا عن سهولة والنسبية منخفضة التكلفة لتجميع واسعة النطاق من oligos حسب الطلب 2 قد ولدت انفجار التطبيقات 3 والبحوث في مجال تكنولوجيا النانو DNA. تكنولوجيا النانو DNA الهيكلي، على أساس متحرك سيمان 4،5 تقاطع باعتبارها اللبنة الأساسية يجعل من استخدام DNA كوحدة الابتدائية الذاتي تجميع لبناء الأشكال التعسفية 6-8.

التطورات الأخيرة في الحمض النووي scaffolded اوريغامي 9 الأسلوب يسمح لبناء مجمع 2D / 3D النانو أبنية 10-12 بدقة نانومتر الفرعي وهي كفاءة الطريق لبناء الأجسام وظيفية جديدة مع زيادة تعقيد وتنوع مذهل. وتستند عملية البناء بناء على الحمض النووي الذين تقطعت بهم السبل واحد سقالة طويلة، والمستمدة عادة من genom الفيروسيه، والتي يمكن أن تكون مطوية من خلال التهجين مئات احدة oligos DNA حبلا قصيرة تسمى المواد الغذائية. القرار الهيكلي عالية التي حصلت عليها هذه التقنية هو نتيجة مباشرة للأبعاد الطبيعية من الحلزون المزدوج DNA، في حين أن استنساخ تلفيق هو نتيجة الخياطة وقصيرة التيلة تسلسل واحد حبلا لتسهيل أقصى الهيدروجين الرابطة التكامل للتحقيق. مع استخدام درجة حرارة الصلب بطيئة المنحدر المصممة أدنى مستوى الطاقة، الديناميكا الحرارية يتم التوصل البنية النانوية يفضل في عوائد عالية والإخلاص. تمكين سهل التنفيذ من قواعد التصميم تقاطع في مدونة كمبيوتر تطوير أدوات CAD، مثل caDNAno 13، التي تبسط غاية مهمة تصميم الهياكل الكبيرة والمعقدة التي تحتوي على مئات من تقاطعات متصل.

سابقا وصفنا تصميم nanorobot DNA مع المعونة من أداة 14،15 caDNAno. نحن هنا تصوير وتلفيقالتصور، من خلال المجهر الإلكتروني النافذ (TEM) من nanorobot، وهو nanodevice سداسية جوفاء 3D، مع أبعاد 35 × 35 × 50 نانومتر مصممة للخضوع لتغيير متعلق بتكوين كبير في استجابة لمؤثرات محددة سلفا والبضائع المحددة الحالية، مثل كما البروتينات أو oligos الحمض النووي، المحتبسة داخل. في حين أن 12 محطة التحميل المتاحة داخل الهيكل جوفاء، العدد الفعلي للبضائع المربوطة يختلف مع حجم البضائع. وتتراوح جزيئات البضائع من جزيئات DNA صغيرة لالانزيمات، والأجسام المضادة و10/05 جزيئات الذهب نانومتر. Cargocan إما أن تكون موحدة أو متجانسة، مثل أن كل nanorobot يحتوي على خليط من جزيئات مختلفة. ويتحقق الاستشعار عن طريق اثنين المزدوج حلزونية تصميم بوابات تأمين على الشعور البروتينات والأحماض النووية أو المواد الكيميائية الأخرى، استنادا إما على aptasensor 16،17 أو حبلا DNA تشريد 18 التكنولوجيات. تمكن التطورات الأخيرة في aptamer بروتوكولات اختيار 19-21 تصميم روبوتات النانو الاستجابةإلى مجموعة متزايدة من جزيئات وأنواع الخلايا.

وأظهر العمل في وقت سابق من nanorobot يحمل الأجسام المضادة المحددة، التي تقوم عليها ملزمة لمستضد لها القيام بترحيل إما المثبطة أو إشارة غزير إلى داخل أنواع معينة من الخلايا في خلية السكان مختلطة 15. ميزة مثيرة من هذه الأجهزة النانوية هي قدرتها على أداء المزيد من المهام المعقدة والتحكم المنطقي مع إدخال الأنواع الفرعية nanorobot مختلفة في عدد السكان واحد. مؤخرا أثبتنا فرعية محددة من روبوتات النانو أداء إما المنظمين إيجابية أو سلبية، والسيطرة على السكان المستجيب تحتوي على جزيء البضائع نشط 22.

بروتوكول المعروضة هنا يصف تصنيع وتنقية والتصوير من nanorobot مسور مع تسلسل استشعار aptamer التي تربط بشكل انتقائي لPDGF لتسهيل افتتاح nanorobot 15،22. عملية تلفيق وصف مشابه لنعملية تصنيع anorobot يصور في البداية من قبل دوغلاس وآخرون. 15 مع التغييرات تهدف إلى الحد من مدة العملية الشاملة، مع زيادة معدلات العائد وتنقيتها.

Protocol

1. إعداد ستابلز بركة خليط

  1. ترتيب مجفف بالتجميد DNA المواد الغذائية nanorobot على لوحات 96-جيدا كما هو موضح في الجدول رقم 1 (انظر المواد) وتطبيع إلى 10 نانومول. للحصول على وصف مفصل للتصميم والهندسة المعمارية للnanorobot DNA رؤية بن Ishay وآخرون. 14 ودوغلاس وآخرون. 15).
  2. إعادة كل الأساسية بشكل جيد مع الدناز / ريبونوكلياز خالية عالى النقاء لتركيز 100 ميكرومتر. لتطبيع المواد الغذائية إلى 10 نانومول، إعادة مع 100 ميكرولتر من الماء عالى النقاء.
  3. تجمع معا 20 ميكرولتر من كل الأساسية باستخدام pipettor الأقنية والعقيمة 55 مل حوض الحل.
    ملاحظة: منذ يتكون شكل nanorobot من 254 فروع الأساسية (بما في ذلك النواة، الحواف، مقابض وسلاسل وأدلة، والجدول 1)، وتركيز كل من المواد الغذائية في تجمع المواد الغذائية هو 394 نانومتر. إزالة المواد الغذائية من تجمع الأساسية، أو إضافة بعض في المجلد مختلفةumes، قد يقلل من العائد إلى حد كبير، أو يؤدي ذلك في المجاميع غير المطوية.

2. إعداد تصنيع خليط التفاعل

  1. لخليط التفاعل القياسية استخدام 40 ميكرولتر من M13mp18 الفيروسي الجينوم دائرية DNA ضفيرة واحدة، الموافق 4 بمول من الحمض النووي سقالة (حل 100 نانومتر الأسهم، انظر المواد). تركيز النهائي من سقالة في خليط تصنيع 20 نانومتر، الحجم النهائي 200 ميكرولتر.
    1. ضبط كمية من الحمض النووي سقالة وفقا لاحتياجات محددة؛ ومع ذلك، والحفاظ على التركيز النهائي من الحمض النووي سقالة في خليط التفاعل في ثابت 20 نانومتر.
  2. إضافة المواد الغذائية الأساسية للتوصل إلى السقالة إلى نسبة المواد الغذائية الأساسية من 1 إلى 10، على التوالي. ل20 نانومتر تركيز الحمض النووي سقالة، كل من تركيز النهائي 254 من السلع الاساسية "هو 200 نانومتر. ل200 ميكرولتر حجم رد الفعل النهائي إضافة 102 ميكرولتر من الخليط تجمع المواد الغذائية (القسم 1.2).
    1. إضافة متواليات محددة بوابة على حدة إلى thالبريد خليط التفاعل للطي في هذا الوقت. يتم ترتيب هذه oligos منفصل، وتتطلب تنقية HPLC. ضمان oligos بوابة موجودة في 01:10 سقالة لبوابة نسبة تسلسل، أي 200 نيوتن متر من كل جزئية ل20 نانومتر تركيز سقالة. ل200 ميكرولتر للطي حجم رد الفعل، إضافة 0.4 ميكرولتر لكل من جزئية أربعة بوابة بتركيز الأسهم 100 ميكرومتر.
  3. إضافة 10X TAE عازلة الأسهم للوصول إلى تركيز النهائي من 1X TAE (40 ملي تريس، خلات، 1 ملم EDTA). ل200 ميكرولتر للطي حجم رد الفعل، إضافة 20 ميكرولتر من 10X تاي.
  4. إضافة 1 M MgCl 2 إلى تركيز النهائي من 10 ملم. ل200 ميكرولتر للطي حجم رد الفعل، إضافة 2 ميكرولتر من 1 M MgCl 2.
  5. إضافة 36 ميكرولتر من الدناز / ريبونوكلياز الماء عالى النقاء المجاني إلى التوصل إلى الحجم النهائي من 200 ميكرولتر.
  6. دوامة وقسامة 100 ميكرولتر العينات في قارورة PCR.
    ملاحظة: راجع مواصفات cycler الحرارية بشأن كميات رد فعل القصوى لاستخدامها.سوف يقلل من حجم لتلبية هذه الحدود لا يقلل من الغلات المنتجة. أحجام رد فعل فوق الحد الأقصى المحدد سوف يعرض للخطر الغلة.

3. درجة الحرارة التليين المنحدر من تلفيق رد الفعل

  1. برنامج cycler الحرارية على النحو التالي:
    1. منحدر 85 درجة مئوية إلى 60 درجة مئوية في معدل من 5 دقيقة / درجة مئوية.
    2. منحدر 60 ° C إلى 4 درجات مئوية بمعدل 75 دقيقة / درجة مئوية.
    3. عقد في 4 درجات مئوية إلى أجل غير مسمى.
  2. بعد التصنيع قد انتهت عينات في مخزن -20 ° C.

4. إزالة من ستابلز الزائدة

  1. إضافة 100 ميكرولتر من للطي خليط التفاعل إلى 0.5 مل فلتر الطرد المركزي مع MWCO من 100 كيلو دالتون. حفظ عينة 10 ميكرولتر من روبوتات النانو قبل تنقية لتحليلها لاحقا.
  2. أجهزة الطرد المركزي لمدة 10 دقيقة في 9600 ز س.
  3. إضافة 400 ميكرولتر من العازلة للطي (1X TAE، 10 ملي MgCl 2).
  4. كرر الخطوات من 4.2 و 4.3 ضعف أكثر من ذلك.
  5. أجهزة الطرد المركزي لمدة 5 دقائق في 9600 ز س.
  6. استعادة التركيز من خلال وضع مرشح رأسا على عقب في أنبوب microcentrifuge نظيفة وتدور لمدة 1 دقيقة في 9600 ز س. قد تختلف أحجام النهائية اعتمادا على حجم الأولي من خليط التفاعل تلفيق التي وضعت في التصفية. وعادة ما يتم الحصول على الحجم النهائي 25-60 ميكرولتر من عينة nanorobot المركزة.
  7. قياس تركيز الحمض النووي في العينات عن طريق معمل في 260 نانومتر. استخدام الوزن الجزيئي من 5،3 ميكروغرام / بمول عند حساب تركيزات المولي العينات nanorobot.
    ملاحظة: معامل الانقراض المولي لdsDNA، 50 ميكروغرام / OD 260، غير كافية لمعظم التطبيقات. 48 ميكروغرام / OD 260 يأخذ بعين الاعتبار الثايمين بولي ssDNA تمتد على المواد الغذائية الحواف.

5. الاغاروز جل التحليل الكهربائي من مطوية ننربتس

  1. إعداد TBE 0.5X (45 ملي تريس، البورات، 1 ملم EDTA)، 2٪ هلام الاغاروز تستكمل مع 10 ملي MgCl 2 وآخرون 21):
    1. إعداد 0.5X العازلة TBE عن طريق تمييع 6.25 مل من 10X TBE العازلة الأسهم في 118.75 مل من ده 2 O.
    2. حل 2.5 غرام من الاغاروز في 125 مل من العازلة 0.5X TBE.
    3. تغلي في الميكروويف حتى يذوب تماما agarose.
    4. إضافة 1.25 مل من 1 M MgCl 2 إلى تركيز النهائي من 10 ملم.
    5. إضافة 7 ميكرولتر من 10 ملغ / مل إيثيديوم بروميد.
    6. انتظر حل لتبرد قليلا وملء علبة الجل قبل يتصلب هلام الاغاروز. تثبيت مشط المطلوب فورا.
    7. إعداد 1 L 0.5X TBE العازلة على التوالي وذلك بإضافة 50 مل من 10X TBE العازلة الأسهم و 10 مل من 1 M MgCl 2-940 مل من ده 2 O.
    8. مرة واحدة هلام هو إضافة الصلبة العازلة تشغيل للجهاز الكهربائي وجهاز وضع في حمام الثلج.
  2. تحميل 1 ميكروغرام DNA الكلي للروبوتات النانو قبل تنقية (الخطوة 3.2)، وبعد تنقية (الخطوة 4.7)، جنبا إلى جنب مع سقالةعينة من الحمض النووي DNA وعلامة 1 كيلو بايت، على هلام. تم اعطاء مثال في الشكل 2. مجلدات الفعلية للعينات تعتمد على تركيزات التي تم الحصول عليها بعد تنقيتها. يتم تحميل كل العينات مع العازلة تحميل في 1: 6 نسبة حجم النهائية.
  3. وضع مصدر الطاقة إلى 80 V وتشغيل هلام لمدة 3 ساعة. تشغيل هلام في حمام مليء الثلج والماء. سوف ننربتس تتكشف وتظهر كما مسحة اذا الجل الاغاروز مع ارتفاع درجات الحرارة خلال الكهربائي. خلال الكهربائي إضافة الجليد إضافية للحفاظ على الجهاز من التدفئة.
  4. مشاهدة هلام على طاولة الأشعة فوق البنفسجية (الشكل 2).

6. وصمة عار سلبي من Nanorobot مع اليورانيل-فورمات

  1. إعداد 2٪، فورمات اليورانيل حل سهم (مقتبس من كاسترو وآخرون 23):
    1. تزن 100 ملغ من مسحوق اليورانيل فورمات في أنبوب 15 مل.
    2. يغلي الدناز / ريبونوكلياز الماء عالى النقاء مجانا لمدة 3 دقائق لاجتثاث الأوكسجين.
    3. إضافة 5 مل من الماء الساخن غير المؤكسج (~ 60 ° C)في أنبوب 15 مل تحتوي على مسحوق اليورانيل فورمات (من الخطوة السابقة). غطاء وثيق بإحكام، والتفاف في رقائق الألومنيوم ودوامة بدقة لمدة 10 دقيقة (أنبوب ربط إلى دوامة). يجب أن يظهر الحل العكرة مع اللون الأصفر.
    4. حل مرشح من خلال 0.2 ميكرون حقنة فاي lter. وينبغي أن يصبح حل واضح.
    5. قسامة 200 ميكرولتر من الحل في أنابيب microcentrifuge.
    6. أجهزة الطرد المركزي في أقصى سرعة لمدة 5 دقائق في جهاز للطرد المركزي أعلى الجدول لعينات التجمع في الجزء السفلي من الأنبوب.
  2. تحميل عينة لشبكة وتلطيخ السلبية:
    1. تذويب قسامة 200 ميكرولتر من 2٪ من محلول اليورانيل-فورمات (المعد في القسم 6.1). إضافة 10 ميكرولتر من 0.5 M محلول هيدروكسيد الصوديوم ودوامة بدقة لمدة 3 دقائق. أجهزة الطرد المركزي في أقصى سرعة لمدة 5 دقائق باستخدام جهاز للطرد المركزي أعلى الجدول.
    2. وفي الوقت نفسه، شبكة وهج التفريغ باستخدام هواء الغرفة عند 0.2 ملي بار و 25 مللي أمبير لمدة 30 ثانية.
    3. إضافة 15 ميكرولتر من 2 نانومتر عينة nanorobot بعد تنقية (sectiعلى 4،7) على الجانب العلوي من الشبكة (التي عقدت مع ملقط) والسماح استيعاب لمدة 1 دقيقة. استخدام فاي رقة lter لتصريف السوائل الزائدة عن طريق وضع شبكة على رأس ورقة الترشيح. لا تلمس سطح الشبكة.
    4. إضافة 10 ميكرولتر من 2٪ اليورانيل-فورمات (من الخطوة 6.2.1) على الجانب العلوي من الشبكة (التي عقدت مع ملقط).
    5. استخدام بسرعة فاي رقة lter لتصريف السوائل الزائدة عن طريق وضع شبكة على رأس ورقة الترشيح. لا تلمس سطح الشبكة.
    6. كرر الخطوات من 6.2.4 و6.2.5.
    7. إضافة 10 ميكرولتر من 2٪ اليورانيل-فورمات (من الخطوة 6.2.1) على الجانب العلوي من الشبكة (التي عقدت مع ملقط). دعونا حل تلطيخ امتصاص لمدة 30 ثانية.
    8. استخدام فاي رقة lter لتصريف السوائل الزائدة عن طريق وضع شبكة على رأس ورقة الترشيح. لا تلمس سطح الشبكة.
    9. السماح للشبكة تجف تماما لمدة 30 دقيقة على الأقل، تواجه حتى على ورق الترشيح، قبل حقن في TEM.

Representative Results

وأظهرت نتائج ممثل في الشكل 2A. جميع الممرات تحتوي على 1 ميكروغرام من الحمض النووي الكلي، وتقاس عن طريق مقياس الطيف الضوئي (OD 260). مقارنة مع دائرية واحدة حبلا السقالة DNA (لين 2)، تعوقهم روبوتات النانو في هلام نتيجة لارتفاع الوزن الجزيئي، والنتيجة من المواد الغذائية التهجين إلى DNA سقالة (لين 3. الأحمر السهم). انخفاض الجزيئية الفرقة الوزن في لين 3 وتمثل المواد الغذائية الزائدة التي لم ربط DNA سقالة (السهم الأخضر). بعد تنقيتها عن طريق الترشيح الطرد المركزي يتم إزالة معظم المواد الغذائية الزائدة (الممرات 4-6) وروبوتات النانو هي جاهزة للتحميل مع جزيئات البضائع مترافق إلى مقابض حبلا التكميلية 14،15،22. الممرات 4-6 تحتوي على العصابات الوزن الجزيئي عالية تمثل dimers nanorobot (الأزرق السهم)، يبلغ عدد سكانها روبوتات النانو التي تربطهم. الحد من تركيز سقالة في الإجراء تلفيق (إما 5 أو 10 نانومتر) يمكن أن يحتمل reduم مبلغ النسبي لهذه الهياكل عالية الوزن الجزيئي. الممرات 4-6 المعرض ننربتس بعد تنقية مع وجود اختلافات طفيفة في بروتوكول تنقية وصفها، وهي حجم الأولي من روبوتات النانو ملفقة تضاف إلى تصفية تدور (الخطوة 4.1 لين 4: 50 ميكرولتر؛ لين 5: 100 ميكرولتر؛ لين 6: 100 ميكرولتر)، وعدد المرات التي تم إضافة عازلة للمرشح (الخطوة 4.4 لين 4: 2 مرات؛ لين 5: 2 مرات؛ لين 6: 5 مرات).

مقارنة بين العائد وتنقية النتائج بين الأشكال المختلفة للبروتوكول (الشكل 2C) تبين أن تخفيض حجم الأولي من الروبوتات ملفقة تحميل الى تصفية الطرد المركزي (الخطوة 4.1) له تأثير يذكر على معدلات العائد وتنقيتها. وعلاوة على ذلك، وزيادة عدد التبادلات العازلة ويدور الطرد المركزي (الخطوات 4،4) لها تأثير هامشي على نقاء على روبوتات النانو، في حين خفض كبير في العائد. وبالتالي بروتوكول صفها، الموافق 100 ميكرولترويعتبر حجم الأولي و2 الإضافات العازلة (لين 5)، الأمثل.

وتستند تقديرات العائد على معمل (OD 260) قياس كل بعد تنقية العينة وتحسب نسبة إلى المبلغ الأولي تحميلها في كل مرشح الطرد المركزي. ويستند تنقية على الوزن في المئة من روبوتات النانو من الحمض النووي بأكمله في العينة، المقابلة لروبوتات النانو والمواد الغذائية الزائدة التي لم تغسل خلال تنقية. وتحسب تقديرات تنقية من شدة النسبية للروبوتات النانو (السهام الحمراء والزرقاء في الشكل 2A) إلى أن من المواد الغذائية الزائدة (السهم الأخضر في الشكل 2B). وتم تطبيع للروبوتات النانو النسبية / المواد الغذائية شدة مع عينة تنقيته قبل (لين 3)، الذي الوزن DNA الكلي للمشابك (السهم الأخضر) هو ~ 4.5 مرة من روبوتات النانو غير المكرر (السهم الأحمر)، الموافق الأولية 10: 1 سقالة لنسبة المولي المواد الغذائية في البروتوكول تلفيق.

ويتحقق التحقق النهائي من السلامة الهيكلية عن طريق المجهر الإلكتروني النافذ باستخدام 2٪ اليورانيل-فورمات بمثابة وصمة عار سلبية. يتم عرض الصور في الشكل (3).

الشكل 1
الشكل 1: تصميم التخطيطي لnanorobot عرض (A) جانب من nanorobot مغلقة. بوابة الحلزون المزدوج، التي تنتجها تسلسل aptamer وحبلا التكميلية، يشار بواسطة سهم أخضر. (B) جبهة نظرا لnanorobot مغلقة تبين البضائع بروتين ملزمة الداخل. (C) عبر قسم الخطط من nanorobot مغلقة المنتجة. ويسلط الضوء يتعامل مع المواد الغذائية التي كتبها السهم الأحمر. الدوائر الخضراء تشير اللولب التي تحتوي على المفصلي على جانب واحد وتسلسل البوابة في الجانب المعاكس. (D) مخططات لوnanorobot في عرض الجانب. يشار إلى مقابض التي كتبها السهام الحمراء. يشار إلى تسلسل البوابة الأسهم الخضراء. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 2
الشكل 2: الاغاروز النتائج الكهربائي للهلام (A) لين 1: علامة 1KB. 2 لين: M13mp18 دائرية سقالة واحدة حبلا. حارة 3: روبوتات النانو قبل التنقية. الممرات 4-6: روبوتات النانو وظيفة في التنقيات. حارة 4: 50 ميكرولتر حجم الأولي. 2 الإضافات العازلة. حارة 5: 100 ميكرولتر حجم الأولي. 2 الإضافات العازلة. لين 6: 100 ميكرولتر حجم الأولي. 5 الإضافات العازلة. يشار إلى المواد الغذائية الزائدة بواسطة سهم أخضر وأشار روبوتات النانو اختلقتها السهم الأحمر. وأشار السهم الأزرق dimers nanorobot. (B) عرض 3D من الكثافة النسبية للعصابات في الاغاروزهلام. (C) المحصول وتنقية التقديرات.

الشكل (3)
الشكل 3: صور TEM من روبوتات النانو DNA المأخوذة من افتراءات متعددة / تلطيخ الاجراءات.

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> كور 141 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
عدد تسمية تسلسل
1 النواة AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
2 النواة GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 النواة TACGATATAGATAATCGAACAACA
4 النواة CTTTTGCTTAAGCAATAAAGCGAGTAGA
5 النواة GTCTGAAATAACATCGGTACGGCCGCGCACGG
6 النواة GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 النواة AAAATCACCGGAAGCAAACTCTGTAGCT
8 النواة CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 النواة CATGTAAAAAGGTAAAGTAATAAGAACG
10 النواة ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
11 النواة ATAGTCGTCTTTTGCGGTAATGCC
12 النواة AGTCATGGTCATAGCTGAACTCACTGCCAGT
13 النواة AACTATTGACGGAAATTTGAGGGAATATAAA
14 النواة ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
15 النواة AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
16 النواة GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
17 النواة GCACCGCGACGACGCTAATGAACAGCTG
18 النواة AACTTCATTTTAGAATCGCAAATC
19 النواة CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
20 النواة CCAATCAAAGGCTTATCCGGTTGCTATT
21 النواة AGAGGCGATATAATCCTGATTCATCATA
22 النواة CCGTAATCCCTGAATAATAACGGAATACTACG
23 النواة AAATGGTATACAGGGCAAGGAAATC
24 النواة TCCTCATCGTAACCAAGACCGACA
25 النواة CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
26 النواة ACCCGCCCAATCATTCCTCTGTCC
27 النواة CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
28 النواة CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
29 النواة TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
30 النواة
31 النواة AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
32 النواة ACATTCAGATAGCGTCCAATATTCAGAA
33 النواة AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
34 النواة GAGATGACCCTAATGCCAGGCTATTTTT
35 النواة TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
36 النواة GCCGAAAAATCTAAAGCCAATCAAGGAAATA
37 النواة AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
38 النواة ACCAATCGATTAAATTGCGCCATTATTA د>
39 النواة ATCTTACTTATTTTCAGCGCCGACAGGATTCA
40 النواة CCCTAAAAGAACCCAGTCACA
41 النواة GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
42 النواة CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
43 النواة TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
44 النواة TTCCTTATAGCAAGCAAATCAAATTTTA
45 النواة ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
46 النواة AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
48 النواة TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 النواة AAAGAAACAAGAGAAGATCCGGCT
50 النواة TTGAGGGTTCTGGTCAGGCTGTATAAGC
51 النواة TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
52 النواة ACGAGCGCCCAATCCAAATAAAATTGAGCACC
53 النواة AATAAGTCGAAGCCCAATAATTATTTATTCTT
54 النواة ACGAAATATCATAGATTAAGAAACAATGGAACTGA
55 النواة TTTCATAGTTGTACCGTAACACTGGGGTTTT
56 النواة AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
57 النواة CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
58 النواة TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 النواة ATAACGCAATAGTAAAATGTTTAAATCA
60 النواة ACGAATCAACCTTCATCTTATACCGAGG
61 النواة TAATGGTTTGAAATACGCCAA
62 النواة CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
63 النواة ATTAAAGGTGAATTATCAAAGGGCACCACGG
64 GGCAACCCATAGCGTAAGCAGCGACCATTAA
65 النواة AGAAACGTAAGCAGCCACAAGGAAACGATCTT
66 النواة AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 النواة GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
68 النواة TTTTAGAACATCCAATAAATCCAATAAC
69 النواة AAATGTGGTAGATGGCCCGCTTGGGCGC
70 النواة ACGGATCGTCACCCTCACGATCTAGAATTTT
71 النواة CGCCATAAGACGACGACAATAGCTGTCT
72 النواة GCGTATTAGTCTTTAATCGTAAGAATTTACا
73 النواة AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
74 النواة AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
75 النواة TAATTTAGAACGCGAGGCGTTAAGCCTT
76 النواة ACCAGGCGTGCATCATTAATTTTTTCAC
77 النواة CAGCCTGACGACAGATGTCGCCTGAAAT
78 النواة ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 النواة CTCGAATGCTCACTGGCGCAT
80 النواة GGGCAGTCACGACGTTGAATAATTAACAACC
81 النواة
82 النواة TCAACCCTCAGCGCCGAATATATTAAGAATA
83 النواة ATTATACGTGATAATACACATTATCATATCAGAGA
84 النواة GCAAATCTGCAACAGGAAAAATTGC
85 النواة ATAATTACTAGAAATTCTTAC
86 النواة TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 النواة AAGTAGGGTTAACGCGCTGCCAGCTGCA
88 النواة CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 النواة TGGCGAAGTTGGGACTTTCCG
90 CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
91 النواة AAATCAAAGAGAATAACATAACTGAACACAGT
92 النواة CTGTATGACAACTAGTGTCGA
93 النواة ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
94 النواة TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
95 النواة ATAAGAATAAACACCGCTCAA
96 النواة CGTTGTAATTCACCTTCTGACAAGTATTTTAA
97 النواة AACCGCCTCATAATTCGGCATAGCAGCA
98 النواة AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
99 النواة CAGTATAGCCTGTTTATCAACCCCATCC
100 النواة TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
101 النواة CGTCGGAAATGGGACCTGTCGGGGGAGA
102 النواة AAGAAACTAGAAGATTGCGCAACTAGGG
103 النواة CCAGAACCTGGCTCATTATACAATTACG
104 النواة ACGGGTAATAAATTAAGGAATTGCGAATAGTA
105 النواة CCACGCTGGCCGATTCAAACTATCGGCCCGCT
106 النواة GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
107 CAGCATTAAAGACAACCGTCAAAAATCA
108 النواة ACATCGGAAATTATTTGCACGTAAAAGT
109 النواة CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
110 النواة AAATCGTACAGTACATAAATCAGATGAA
111 النواة TTAACACACAGGAACACTTGCCTGAGTATTTG
112 النواة AGGCATAAGAAGTTTTGCCAGACCCTGA
113 النواة GACGACATTCACCAGAGATTAAAGCCTATTAACCA
114 النواة AGCTGCTCGTTAATAAAACGAGAATACC
115 النواة CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
116 النواة CACCCTCTAATTAGCGTTTGCTACATAC
117 النواة GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
118 النواة GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 النواة ATGAAACAATTGAGAAGGAAACCGAGGATAGA
120 النواة GGATGTGAAATTGTTATGGGGTGCACAGTAT
121 النواة GGCTTGCGACGTTGGGAAGAACAGATAC
122 النواة TAAATGCCTACTAATAGTAGTTTTCATT
123 النواة TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
124 النواة TGACCATAGCAAAAGGGAGAACAAC
125 النواة CGAGCCAGACGTTAATAATTTGTATCA
126 النواة GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 النواة AGACGCTACATCAAGAAAACACTTTGAA
128 النواة AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 النواة GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
130 النواة GGTATTAAGGAATCATTACCGAACGCTA
131 النواة GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
132 النواة
133 النواة ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
134 النواة AACGAGATCAGGATTAGAGAGCTTAATT
135 النواة TACCAAGTTATACTTCTGAATCACCAGA
136 النواة CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 النواة AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
138 النواة TTTCAACCAAGGCAAAGAATTTAGATAC
139 النواة TTGAAATTAAGATAGCTTAACTAT
140 النواة CTATTATCGAGCTTCAAAGCGTATGCAA
النواة CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
142 النواة GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 النواة CGAACGTTAACCACCACACCCCCAGAATTGAG
144 النواة GTGTGATAAATAAGTGAGAAT
145 النواة GCTATATAGCATTAACCCTCAGAGA
146 النواة AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 النواة CGGCCTCCAGCCAGAGGGCGAGCCCCAA
148 النواة CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 النواة
150 النواة ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
151 النواة ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
152 النواة TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
153 النواة AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
154 حافة TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
155 حافة TTTTTTTTTTTTTTTTAATAAGAGAATA
156 حافة TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 حافة
158 حافة TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 حافة TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
160 حافة TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
161 حافة TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
162 حافة TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
163 حافة TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
164 حافة TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
165 حافة TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
166 حافة TTTTTTTTTTTTTTTACCGGATATTCA
167 حافة TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
168 حافة TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 حافة CTGAGAGAGTTGTTTTTTTTTTTTTTT
170 حافة CAATGACAACAACCATTTTTTTTTTTTTTTT
171 حافة TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
172 حافة TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 حافة
174 حافة TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
175 حافة TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
176 حافة TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 حافة CCACACAACATACGTTTTTTTTTTTTT
178 حافة TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 حافة TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
180 حافة TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 حافة TTTTTTTTTTTTTTTACGGCGGAT
182 حافة TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 حافة TTTTTTTTTTTTTTTACGATTGGCCTTGATA
184 حافة TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 حافة TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
186 حافة TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 حافة TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 حافة ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 حافة
190 حافة TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
191 حافة GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
192 حافة GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 حافة ATAACGTGCTTTTTTTTTTTTTTTTTT
194 حافة TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
195 حافة TTTTTTTTTTTTTTTACAAAATAAACA
196 حافة TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 حافة
198 حافة TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 حافة GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
200 حافة TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
201 حافة CACTAAAACACTTTTTTTTTTTTTTTT
202 حافة TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
203 حافة TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
204 حافة TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
205 حافة TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
206 حافة TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
207 حافة CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
208 حافة TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
209 حافة AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
210 حافة ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
211 حافة TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
212 حافة TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
213 CAGAACAATATTTTTTTTTTTTTTTTT
214 حافة TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
215 حافة TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
216 حافة TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
217 حافة TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
218 حافة TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 حافة AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
220 حافة CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
221 TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
222 حافة TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
223 حافة TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
224 حافة TTTTTTTTTTTTTTTCGCCCACGCATAACCG
225 حافة AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
226 حافة CAAGTTTTTTGGTTTTTTTTTTTTTTT
227 حافة TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
228 حافة TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 حافة TTTTTTTTTTTTTCATCTTTGACCC
230 حافة TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
231 حافة GATACAGGAGTGTACTTTTTTTTTTTTTTTT
232 حافة TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
233 حافة GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
234 حافة TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
235 حافة TTTTTTTTTTTTTTTATAGCAATAGCT
236 مقابض AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 مقابض ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
238 مقابض CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 مقابض CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
240 مقابض CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
241 مقابض CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
242 مقابض AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 مقابض CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
244 مقابض CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
245 مقابض TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
246 مقابض AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 مقابض GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
248 أدلة AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 أدلة ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
250 أدلة CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
251 أدلة GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
252 أدلة AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
253 أدلة TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
254 أدلة TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
255 إزالة أدلة GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
256 إزالة أدلة GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 إزالة أدلة TAAAACACCGTACTTTAGAACTAAATTGCTACG
258 إزالة أدلة AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 إزالة أدلة CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
260 واجهة المستخدم الرسوميةقصر إزالة GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
261 إزالة أدلة ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
262 غيتس Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
263 غيتس Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
264 غيتس Gate0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
265 غيتس Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

الجدول 1: قائمة تسلسل الأساسيةالمستخدمة لبناء nanorobot. ستابلز 1-153 تصنف الأساسية ويشكلون الجزء الأكبر من هيكل. تصنف المواد الغذائية 154-235 الحواف وتقع في كل من طرفي اللولب 61 للهيكل. المواد الغذائية تحتوي على حافة ذيل الثايمين بولي تهدف إلى تجنب تجميع روبوتات النانو. تصنف المواد الغذائية 236-247 مقابض وتشكل مواقع لرسو السفن الشحن. يعالج المواد الغذائية لديها المنطقة تسلسل فريدة من نوعها، وربطها لموقع معين من الهيكل، ومنطقة تسلسل توافق الآراء الذي يستخدم كموقع لرسو السفن لجزيئات البضائع. تصنف المواد الغذائية 248-254 دليل التطوير وإرفاق شطري الجهاز أثناء عملية الصلب. بعد التصنيع تتم إزالة دليل التطوير مع إضافة دليل الدبابيس إزالة 255-261 (الخطوة 6)، وترك الجهاز مؤمن من قبل أجهزة الاستشعار اثنين من nanorobot. يتم تعيين تسلسل استشعار غيتس. ويتكون كل من أجهزة الاستشعار ليصل لaptamer PDGF وحبلا التكميلية. لexpla أكثر تفصيلاالأمة يرى بن Ishay وآخرون. 14 ودوغلاس وآخرون. 15. يتم ترتيب ستابلز تجاريا على ثلاث لوحات 96-جيدا (أسفل جولة عميق). وتطبيع كل مبلغ التيلة إلى 10 نانومول. باستثناء تسلسل بوابة، والتي تتطلب تنقية HPLC، المواد الغذائية لا تتطلب إجراء تنقية خاص.

Discussion

وصفنا تلفيق، وتنقية، والتصور للnanorobot DNA. وبعد تصنيع هيكل السيارة سداسية للجهاز، وتمت برمجة وظيفة nanorobot مع مقدمة بسيطة من البضائع محددة وخيوط الاستشعار للروبوت التي تجد بسهولة موقفهم المعينة بسبب الهيدروجين الرابطة التكامل مع مواقع لرسو السفن المتاحة منفردة الجديلة 14 ، 15،22.

بروتوكول تلفيق وصف يستخدم منحدر الصلب بطيئة، والذي يستخدم عادة في مختبرنا لأضعاف مجموعة واسعة من الأشكال الورقية. إذا أصبح وقت الإنتاج وغيرها من البروتوكولات الرئيسية عامل، مثل بروتوكول للطي السريع وصفها Sobczak وآخرون. 24 يمكن استخدامها. يقال هذا البروتوكول لتحقيق لطي اوريغامي في عوائد عالية، ومع ذلك فإنه يتطلب معايرة لكل شكل اوريغامي.

يستخدم تدور الترشيح لتنقية الروبوتات من المواد الغذائية الزائدة. عند تحميل الصورةالعمود دبوس مع عينات أو العازلة، ينبغي الحرص على عدم الاضرار الغشاء مع طرف ماصة. يمكن للغشاء يحتمل أن تمزق مما أدى إلى انخفاض كبير الغلة. فإنه من المستحسن أن لا تجاهل التدفق من خلال حتى يتم تصور للروبوتات النانو التي كتبها AGE.

لتطبيق معين هو المطلوب معدل تنقية العالي؛ هذا لا يمكن أن يتحقق من خلال تكرار الترشيح باستخدام عمود الدوران الأصلي. للأعلى نقاء، يمكن استخدام عمود الدوران جديد، ولكن هذا سوف يكون له تأثير سلبي كبير على معدلات العائد. تم اختبار أساليب أخرى لهياكل اوريغامي DNA تنقية، مثل الختان من هلام الاغاروز لاحقا إلى الكهربائي وغسيل الكلى من المواد الغذائية الزائدة. وأدت هذه الأساليب في أي ضعف العائد أو معدلات تنقية الفقيرة مقارنة مع بروتوكول صفها. لم يتم اختبار أساليب أخرى، مثل تنقية تستند PEG-25 ومعدل منطقتين تنبيذ فائق 26. وذكرت هذه الأساليب لعشيعشية معدلات تنقية عالية، إلا أنها إما يؤدي إلى المحصول الضعيف (معدل منطقتين تنبيذ فائق) أو تتطلب هطول الأمطار (على PEG) وهو ما قد يضر شكل nanorobot جوفاء.

هي ملفقة ننربتس بدبابيس دليل الذي قفل الشكل في موقف مغلقة من أجل زيادة yeilds تلفيق 15. من المهم أن إزالة هذه المواد الغذائية عن طريق إضافة دليل الدبابيس إزالة للروبوتات النانو لفتح فعال في الاستجابة للمنبهات تصميم (PDGF في بروتوكول صفها). تم تصميم مشابك دليل مع منطقة حبلا واحدة موطئ قدم للالتحام دليل الدبابيس إزالة الذي الإفراج عن السلع الاساسية دليل من خلال عملية النزوح حبلا وينبغي أن يضاف 18. هذه المواد الغذائية في 10: 1 نسبة المولي في نهاية تنقية الزائدة المرحلة المواد الغذائية "(الخطوة 4.7) وحضنت لمدة 2 ساعة في درجة حرارة الغرفة على نهاية على نهاية شاكر.

وقد وصفت التصور من قبل TEM، includiنانوغرام اليورانيل-فورمات تلطيخ السلبية 2٪. مقارنة مع اليورانيل خلات، اليورانيل-فورمات تنتج هياكل الحبوب الدقيقة التي تسمح للأفضل قرار من التصاميم اوريغامي DNA. ينبغي توخي الحذر كما اليورانيل-فورمات سوف يصلب إذا تم تجميد قسامات لفترات طويلة من الزمن. فمن المستحسن استخدام 2٪ محلول اليورانيل-فورمات الطازجة لتلطيخ. قرارات أفضل قابلة للتحقيق مع استخدام كرو-TEM 27.

تصميم وتصنيع المعماري البروتوكول الأساسي للnanorobot DNA موحدة في نهاية المطاف ومباشر. ومع ذلك، يتم تقديم مجموعة واسعة من المرونة في شكل خليط من البضائع محددة وخيوط الاستشعار عن بعد. وعلاوة على ذلك، في مجتمع واحد العديد من الأنواع الفرعية يمكن إدخال ورياضيات الكيمياء النسبي برمجة والأمثل لتناسب الاحتياجات المحددة. حتى أكبر صقل حركية محددة في كل خطوة تحد من معدل يمكن تحقيقه مع زيادة / تخفيض مدة مزدوج التهجين حبلا أومقدمة من عدم التطابق في مناصب رئيسية محددة. هذه درجة عالية من المرونة مع سهولة البناء يسمح للهندسة أجهزة النانو قادرة على أداء المهام المعقدة متنوعة للغاية في الوسط البيولوجي ذات الصلة.

Disclosures

الكتاب ليس لديهم ما يكشف.

Acknowledgments

الكتاب أود أن أشكر S. دوغلاس لإجراء مناقشات قيمة للغاية والمشورة، وجميع أعضاء المختبر باشيليت لإجراء مناقشات مفيدة والعمل. ويؤيد هذا العمل من المنح المقدمة من كلية علوم الحياة ومعهد تقنية النانو والمواد المتقدمة في جامعة بار إيلان.

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics