Складной и характеристика Био-отзывчивого робота от ДНК оригами

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Наноробота ДНК представляет собой полый гексагональной нанометровый устройство, предназначен для открытия в ответ на конкретные раздражители и настоящим груза поглощенных внутри. Оба раздражители и грузов может быть адаптирована в соответствии с конкретными потребностями. Здесь мы описываем протокол изготовления нанороботов ДНК, с использованием техники ДНК-оригами. Порядок инициирует путем смешивания короткие однонитевые скобы ДНК в акционерное смеси, которая затем добавляется к длинному, круговой, одноцепочечной ДНК эшафот в присутствии складной буфера. Стандартный термо циклер запрограммирован, чтобы постепенно снизить температуру реакции смешивания для облегчения отжиг скобы к эшафот, который является руководящей силой позади складывания нанороботов. После завершения реакции складывания 60 ч завершена, избыток скобы отбрасываются с использованием центробежного фильтра, а затем с помощью визуализации агарозном гель-электрофореза (возраст). Наконец, успешное изготовление на нанороботов проверяется методом просвечивающей электронной микроскопии (ПЭМ),с использованием уранила формиата-как негативный краситель.

Introduction

Использует для нуклеиновых кислот нанотехнологий поразительны. Уступчивость базовой спаривания Уотсона-Крика, а также легкость и относительная низкая стоимость крупномасштабного синтеза заказных олигонуклеотидов 2 породила взрыв приложений 3 и исследований в области нанотехнологий ДНК. Структурно ДНК нанотехнологии, основанный на неподвижной распределительной Seeman 4,5 качестве фундаментального строительного блока использует ДНК в качестве самосборки элементарной единицы для строительства произвольной формы 6-8.

Недавнее развитие scaffolded ДНК оригами 9 методика позволяет на строительство сложных 2D / 3D нано-архитектур 10-12 с точностью субнанометровым и является эффективным путем для строительства новых функциональных объектов с увеличением сложности и удивительной разнообразия. Процесс строительства основан на длинные лесов однонитевой ДНК, как правило, получают из генома вирусногое, которые могут быть сложены через гибридизации сотен коротких одиночных олигонуклеотидов ДНК называют цепь скрепки. Высокая структурная разрешение получаемых с помощью этого метода является прямым результатом естественных размеров двойной спирали ДНК, в то время как воспроизводимость изготовления является результатом адаптации короткие однонитевые последовательности скрепками, чтобы облегчить максимальной взаимодополняемости водородной связи достижимо. При использовании медленного отжига нарастить проектную наименьшей энергией, термодинамически более предпочтительным наноструктуры достигается с высоким выходом и верности. Простой реализация правил проектирования распределительных в компьютерном коде позволили разработать САПР, таких как caDNAno 13, что чрезвычайно упрощает задачу проектирования больших и сложных структур, содержащих сотни связанных переходов.

Ранее мы описали конструкцию нанороботов ДНК с помощью инструмента 14,15 caDNAno. Здесь мы изобразить изготовление ивизуализации, с помощью электронной микроскопии (ПЭМ), в нанороботов, 3D-полой шестигранной наноустройства, с размерами 35 х 35 х 50 нм 3, предназначен для прохождения основной конформационные изменения в ответ на заранее определенных стимулов и настоящей конкретного груза, например как белки или олигонуклеотиды нуклеиновых кислот, поглощенных внутри. В то время как 12 загрузочные станции доступны внутри полого корпуса, фактическое количество связанного груза отличается от размера груза. Молекулы Грузовые от небольших молекул ДНК ферментов, антител и 5-10 нм наночастиц золота. Cargocan либо быть однородной или гетерогенной, так что каждый нанороботов содержит смесь различных молекул. Зондирования достигается с помощью двух двуспирально замок ворот дизайна ощутить белки, нуклеиновые кислоты и другие химические вещества, основаны либо на aptasensor 16,17 или нити ДНК смещения 18 технологий. Последние события в аптамеров протоколов отбора 19-21 включить дизайн нанороботов отвечаяво все возрастающей диапазоне молекул и клеточных типов.

Ранее работа показала наноробот несущий специфические антитела, которое при связывании со своим антигеном может передавать либо ингибирующий или плодовитых сигнал к внутренней части специфических типов клеток в смешанной популяции клеток 15. Захватывающая особенность этих наноустройств является их способность выполнять даже более сложные задачи и логика управления с введением различных подтипов нанороботов в одной популяции. Недавно мы показали, конкретные подтипы нанороботов, осуществляющих как положительные или отрицательные регуляторы, контролируя население эффекторной содержащий активную молекулу грузов 22.

Протокол, представленные здесь описывает изготовление, очищение и визуализации в закрытом нанороботов с последовательностями сенсорных аптамер, которые связывают выборочно PDGF, чтобы облегчить открытие нанороботов 15,22. Процесс изготовления описано аналогичен пПроцесс изготовления anorobot изначально изображен Дуглас и др. 15 с изменениями, направленных на снижение продолжительности процесса в целом, в то время как увеличение ставки доходности и очистки.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Подготовка Скобы бассейн смеси

  1. Заказать лиофилизированы ДНК нанороботов скобы на 96-луночных планшетах, перечисленные в таблице 1 (см Материалы) и нормализовать до 10 нмоль. Для более подробного описания конструкции и архитектуры нанороботов ДНК см Бен-Ишай др. 14 и Дуглас и др. 15).
  2. Разведите каждый главный продукт хорошо с ДНКазы / РНКазы сверхчистого до концентрации 100 мкМ. Для скобы нормализованы до 10 нмоль, восстановить 100 мкл сверхчистой воды.
  3. Бассейн вместе 20 мкл каждого скобы с помощью многоканальной пипетки и стерильный 55 мл раствора бассейн.
    Примечание: Поскольку форма нанороботов состоит из 254 основных нитей (включая Core, края, ручек и Гид последовательностей, таблица 1), концентрации каждого из скоб в бассейне скобы является 394 нМ. Снятие скобы из бассейна штапельного или добавления некоторых в другом обмов, может снизить урожайность значительно, или иным образом приводить развернутых агрегатов.

2. Подготовка изготовления реакционную смесь

  1. Для стандартной реакционной смеси используют 40 мкл вирусного генома M13mp18 круговой одной нити ДНК, соответствующий 4 пмоль лесов ДНК (100 нМ маточный раствор, см Материалы). Конечная концентрация эшафот в изготовлении смеси 20 нМ, конечный объем 200 мкл.
    1. Отрегулируйте количество лесов ДНК в соответствии с конкретными потребностями; однако, иметь конечную концентрацию лесов ДНК в реакционной смеси при постоянном 20 нМ.
  2. Добавьте скрепки, чтобы достичь каркас соотношение скобы от 1 до 10, соответственно. Для нМ концентрации 20 эшафот ДНК, каждый из конечной концентрации 254 Staples "200 нМ. Для 200 мкл конечного объема реакционной добавить 102 мкл смеси скобы бассейна (раздел 1.2).
    1. Добавить специфических последовательностей Gate отдельно гое складные Реакционную смесь в это время. Эти олигонуклеотиды заказываются отдельно и требуют очистки ВЭЖХ. Убедитесь, что ворота олигонуклеотиды находятся в соотношении 1:10 леса в ворота последовательности, т.е. 200 нМ каждого олигонуклеотида на 20 нМ концентрации лесов. Для 200 мкл складной объема реакционной добавить 0,4 мкл для каждого из четырех олигонуклеотидов Gate на фондовой концентрации 100 мкМ.
  3. Добавить 10x TAE буферный до конечной концентрации 1х ТАЕ (40 мМ Трис-ацетат, 1 мМ ЭДТА). Для 200 мкл складной объема реакционной, добавить 20 мкл 10х TAE.
  4. Добавить 1 М MgCl 2 до конечной концентрации 10 мМ. Для 200 мкл складной объема реакционной, добавить 2 мкл 1 М MgCl 2.
  5. Добавить 36 мкл ДНКазы / РНКазы сверхчистой водой до достижения конечного объема 200 мкл.
  6. Вихревые и аликвоту 100 мкл образцов в ПЦР флаконах.
    Примечание: Проконсультируйтесь с тепловой спецификации ЦИКЛОВАТЕЛЬ о максимальных объемах реакции, которые будут использоваться.Уменьшение объемов для удовлетворения этих пределов не снизит урожайность, полученные. Объемы выше максимального значения, указанного поставит под угрозу урожаи реакции.

3. температуры отжига рампы изготовления реакции

  1. Программа термоциклер, как следует:
    1. Рампа 85 ° C до 60 ° C со скоростью 5 мин / ° C.
    2. Рампа 60 ° С до 4 ° С, со скоростью 75 мин / ° C.
    3. Держите при температуре 4 ° C до бесконечности.
  2. После изготовления закончился хранить образцы при -20 ° C.

4. Удаление избыточных Staples

  1. Добавить 100 мкл реакционной смеси складывания на 0,5 мл центробежным фильтром с MWCO 100 кДа. Сохранить 10 мкл образца нанороботов предварительно очистки для последующего анализа.
  2. Центрифуга течение 10 мин при 9600 х г в.
  3. Добавить 400 мкл буфера (складной 1x TAE, 10 мМ MgCl 2).
  4. Повторите шаги 4.2 и 4.3 в два раза больше.
  5. Центрифуга течение 5 мин при 9600 х г в.
  6. Восстановление концентрата путем размещения фильтра с ног на голову в чистом трубки микроцентрифужных и спина в течение 1 мин при 9600 х г. Конечные объемы могут меняться в зависимости от первоначального объема реакционной смеси, что изготовление был введен в фильтр. Обычно 25-60 мкл конечный объем сконцентрированной пробы нанороботов получается.
  7. Измерение концентрации ДНК в образцах через спектрофотометре при 260 нм. Использование молекулярную массу 5,3 мкг / пмоль при расчете молярных концентраций образцов нанороботов.
    Примечание: Молярный коэффициент погашения для двухцепочечной ДНК, 50 мкг / ОД 260, достаточно для большинства приложений. 48 мкг / ОД 260 учитывает поли тимин онДНК тянется по краям скрепками.

5. Электрофорез в агарозном геле анализ сложенном нанороботы

  1. Приготовление 0,5 × КЭ (45 мМ Трис-борат, 1 мМ ЭДТА), 2% агарозном геле с добавлением 10 мМ MgCl 2 и др. 21):
    1. Подготовка 0.5x TBE буфер разбавления 6,25 мл 10x КЭ фондовой буфера в 118.75 мл DDH 2 O.
    2. Растворить 2,5 г агарозы в 125 мл буфера TBE 0.5x.
    3. Варить до тех пор, в микроволновой печи агарозном полностью не растворится.
    4. Добавить 1,25 мл 1 М MgCl 2 до конечной концентрации 10 мМ.
    5. Добавить 7 мкл 10 мг / мл этидийбромида.
    6. Подождите немного раствора прохладно и заполнить лоток гель перед агарозном затвердевает гель. Немедленно установить желаемый гребень.
    7. Готовят 1 л 0.5x КЭ рабочего буфера, добавив 50 мл 10x КЭ буферный и 10 мл 1 М MgCl 2 до 940 мл DDH 2 O.
    8. После гель насыщенный Добавить рабочем буфере для электрофореза устройства и положить устройство в бане со льдом.
  2. Нагрузка 1 мкг общей ДНК нанороботов предварительной очистки (шаг 3.2), и очистка должность (шаг 4.7), наряду с эшафотаОбразец ДНК и ДНК-маркер 1 кб, на гель. Приведен пример на рисунке 2. Фактические объемы образцов зависит от концентрации, полученных после очистки. Каждый образцы загружается с загрузочного буфера в соотношении 1: окончательного объемном соотношении 6.
  3. Установка источника питания до 80 В и запустить гель в течение 3 ч. Запуск гель в ванну, наполненную льдом и водой. Нанороботы будут разворачиваться и появляются в мазке, если агарозном геле нагревается во время электрофореза. Во время электрофореза добавить дополнительную лед, чтобы держать устройство от нагрева.
  4. Просмотр гель на УФ таблице (рисунок 2).

6. Отрицательный Пятно нанороботов с уранила формиата-

  1. Получение 2% уранила формиат-раствора (адаптировано из Кастро и др 23.):
    1. Взвесьте 100 мг уранил-формиат порошка в 15 мл трубки.
    2. Отварить ДНКазы / РНКазы сверхчистой водой в течение 3 мин, чтобы де-оксигенат.
    3. Добавьте 5 мл обедненной кислородом горячей воды (~ 60 ° С)в 15 мл пробирку, содержащую уранилкарбонат-формиат порошок (из предыдущего шага). Плотно закройте крышку, завернуть в алюминиевую фольгу и тщательно вихря в течение 10 мин (закрепить трубки для вихря). Решение должно появиться мутная с желтого цвета.
    4. Фильтр решение через шприц фильтром 0,2 мкм. Решение должно стать ясно.
    5. Аликвоты по 200 мкл раствора в микроцентрифужных пробирках.
    6. Центрифуга на максимальной скорости в течение 5 мин в настольную центрифугу с образцами наплывы внизу трубы.
  2. Загрузка образца сетки и отрицательного окрашивания:
    1. Размораживание 200 мкл аликвоты 2% раствора уранила формиат-(полученного в разделе 6.1). Добавьте 10 мкл 0,5 М раствора NaOH и вихря строго в течение 3 мин. Центрифуга на максимальной скорости в течение 5 минут с использованием настольную центрифугу.
    2. Между тем, тлеющего разряда сетки с помощью комнатного воздуха на 0,2 мбар и 25 мА в течение 30 сек.
    3. Добавьте 15 мкл 2 нМ нанороботов образца после очистки (sectiна 4,7) на верхней стороне сетки (проводится щипцами), и пусть впитывают в течение 1 мин. Использование фильтром бумагу для слива избытка жидкости, поместив решетку в верхней части фильтровальной бумаги. Не прикасайтесь к поверхности сетки.
    4. Добавьте 10 мкл 2% уранила-формиата (со стадии 6.2.1) на верхней стороне сетки (проводится щипцами).
    5. Быстро использовать фильтром бумагу для слива избытка жидкости, поместив решетку в верхней части фильтровальной бумаги. Не прикасайтесь к поверхности сетки.
    6. Повторите шаги 6.2.4 и 6.2.5.
    7. Добавьте 10 мкл 2% уранила-формиата (со стадии 6.2.1) на верхней стороне сетки (проводится щипцами). Пусть окрашивание раствора впитаться в течение 30 сек.
    8. Использование фильтром бумагу для слива избытка жидкости, поместив решетку в верхней части фильтровальной бумаги. Не прикасайтесь к поверхности сетки.
    9. Пусть сетка полностью высохнуть в течение по крайней мере 30 мин, лицом вверх на фильтровальной бумаге, перед инъекцией в ПЭМ.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Типичные результаты показаны на фиг.2А. Все дорожки содержат 1 мкг тотальной ДНК, измеренное с помощью спектрофотометра (OD 260). По сравнению с круговой одножильному помост ДНК (дорожка 2), нанороботы мешает в геле из-за их более высокой молекулярной массой, в результате скобы гибридизации с ДНК каркасного (дорожка 3 красная стрелка). Молекулярная группа низкий вес в переулке 3 представляет собой превышение скобы, которые не связываются с ДНК (лесов зеленой стрелкой). После очистки с помощью центробежной фильтрации большей части избыточного скобы удаляются (Дорожки 4-6) и нанороботы готовы к загрузке с грузовыми молекул, конъюгированных с ручками комплементарной цепи 14,15,22. Дорожки 4-6 содержат высокие полосы молекулярным весом, представляющие нанороботов димеры (синяя стрелка), население нанороботов, которые связаны друг с другом. Снижение концентрации на эшафот в порядке изготовления (либо 5 или 10 нМ) потенциально может Редусе относительное количество этих высоких структур молекулярной массой. Дорожки 4-6 показывают нанороботы после очистки с небольшими вариациями в описанном протоколе очистки, а именно первоначальный объем готовых нанороботов добавлен в спиновый фильтр (шаг 4.1 Lane 4:. 50 мкл; дорожка 5: 100 мкл; пер 6: 100 мкл), и количество раз, когда буфер был добавлен в фильтре (Шаг 4.4 дорожка 4: 2 раза; дорожка 5: 2. раз; дорожка 6: 5 раз).

Сравнение доходности и очистки результатов между различными вариациями в протокол (рис 2С) показывают, что сокращение начальный объем изготовленных роботов загружалась к центробежным фильтром (шаг 4.1) имеет мало влияния на ставками доходности и очистки. Кроме того, увеличение количества буферных обменов и центробежных спинов (шаги 4.4) предельный влияние на чистоту по нанороботах, а значительно уменьшает выход. Следовательно, описанный протокол, соответствующий 100 мклНачальный объем и 2 буферные добавки (дорожка 5),, считается оптимальным.

Выход оценки основаны на измерениях каждого образца после очистки спектрофотометра (OD 260) и рассчитывается по отношению к исходному количеству загруженного в каждой центробежным фильтром. Очистка на основе весового процента нанороботах от всей ДНК в пробе, соответствующих нанороботов и избыточных скоб, которые не промыть в процессе очистки. Очистные оценки рассчитываются исходя из относительной интенсивности нанороботов (красные и синие стрелки на рисунке 2А) в том, что из избыточных скоб (зеленая стрелка на рисунке 2B). Относительные нанороботы / скобы интенсивности были нормализованы с заранее очищенный образец (дорожка 3), в котором общий вес ДНК скобы (зеленая стрелка) составляет ~ 4,5 раза больше, чем в неочищенных нанороботов (красная стрелка), соответствующих начальным 10: 1 эшафот, чтобыскобы молярное соотношение в протоколе изготовления.

Окончательное подтверждение структурной целостности достигается с помощью просвечивающей электронной микроскопии с использованием 2% уранил-формиат в качестве отрицательного пятна. Фотографии представлены на рисунке 3.

фигура 1
Рисунок 1: Разработка Схема нанороботов (А) вид сбоку закрытого нанороботов.. Ворота двойная спираль, произведенный последовательности аптамера и комплементарной цепи, обозначается зеленой стрелкой. (B), вид спереди закрытой нанороботов, показывая белка груз, связанный внутри. (С) Сечение схемы закрытого нанороботов производства. Ручки скобы выделены красной стрелкой. Зеленые кружки обозначают спиралей, которые содержат шарнир на одной стороне и последовательность ворота на противоположной стороне. (D) чертежинанороботов на вид сбоку. Ручки указано красными стрелками. Последовательности ворот обозначены зелеными стрелками. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Рисунок 2
Рисунок 2:. Агарозы Результаты гель-электрофореза (А) Дорожка 1: 1 кб Маркер. Полоса 2: M13mp18 круговой одноцепочечной эшафот. Дорожка 3: нанороботы предварительно очищение. Дорожки 4-6: нанороботы прикреплять очисток. Дорожка 4: 50 мкл первоначального объема; 2 буферные добавки. Дорожка 5: 100 мкл первоначального объема; 2 буферные добавки. Полоса 6: 100 мкл первоначального объема; 5 буферных дополнения. Избыточные скобы обозначены зеленой стрелкой Готовые нанороботы которые обозначены красной стрелкой. Синяя стрелка указано нанороботов димеры. (Б) 3D-вид относительной интенсивности полос в агарозномгель. (C) объем и очистки. Оценки

Рисунок 3
Рисунок 3: ТЕМ фото нанороботов ДНК, взятых из нескольких измышления / процедур окрашивания.

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> Основные 141 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
Число Обозначение Последовательность
1 Ядро AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
2 Ядро GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 Ядро TACGATATAGATAATCGAACAACA
4 Ядро CTTTTGCTTAAGCAATAAAGCGAGTАГА
5 Ядро GTCTGAAATAACATCGGTACGGCCGCGCACGG
6 Ядро GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 Ядро AAAATCACCGGAAGCAAACTCTGTAGCT
8 Ядро CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 Ядро CATGTAAAAAGGTAAAGTAATAAGAACG
10 Ядро ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
11 Ядро ATAGTCGTCTTTTGCGGTAATGCC
12 Ядро AGTCATGGTCATAGCTGAACTCACTGCCAGT
13 Ядро AACTATTGACGGAAATTTGAGGGAATATAAA
14 Ядро ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
15 Ядро AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
16 Ядро GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
17 Ядро GCACCGCGACGACGCTAATGAACAGCTG
18 Ядро AACTTCATTTTAGAATCGCAAATC
19 Ядро CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
20 Ядро CCAATCAAAGGCTTATCCGGTTGCTATT
21 Ядро AGAGGCGATATAATCCTGATTCATCATA
22 Ядро CCGTAATCCCTGAATAATAACGGAATACTACG
23 Ядро AAATGGTATACAGGGCAAGGAAATC
24 Ядро TCCTCATCGTAACCAAGACCGACA
25 Ядро CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
26 Ядро ACCCGCCCAATCATTCCTCTGTCC
27 Ядро CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
28 Ядро CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
29 Ядро TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
30 Ядро
31 Ядро AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
32 Ядро ACATTCAGATAGCGTCCAATATTCAGAA
33 Ядро AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
34 Ядро GAGATGACCCTAATGCCAGGCTATTTTT
35 Ядро TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
36 Ядро GCCGAAAAATCTAAAGCCAATCAAGGAAATA
37 Ядро AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
38 Ядро ACCAATCGATTAAATTGCGCCATTATTA d>
39 Ядро ATCTTACTTATTTTCAGCGCCGACAGGATTCA
40 Ядро CCCTAAAAGAACCCAGTCACA
41 Ядро GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
42 Ядро CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
43 Ядро TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
44 Ядро TTCCTTATAGCAAGCAAATCAAATTTTA
45 Ядро ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
46 Ядро AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
48 Ядро TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 Ядро AAAGAAACAAGAGAAGATCCGGCT
50 Ядро TTGAGGGTTCTGGTCAGGCTGTATAAGC
51 Ядро TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
52 Ядро ACGAGCGCCCAATCCAAATAAAATTGAGCACC
53 Ядро AATAAGTCGAAGCCCAATAATTATTTATTCTT
54 Ядро ACGAAATATCATAGATTAAGAAACAATGGAACTGA
55 Ядро TTTCATAGTTGTACCGTAACACTGGGGTTTT
56 Ядро AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
57 Ядро CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
58 Ядро TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 Ядро ATAACGCAATAGTAAAATGTTTAAATCA
60 Ядро ACGAATCAACCTTCATCTTATACCGAGG
61 Ядро TAATGGTTTGAAATACGCCAA
62 Ядро CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
63 Ядро ATTAAAGGTGAATTATCAAAGGGCACCACGG
64 GGCAACCCATAGCGTAAGCAGCGACCATTAA
65 Ядро AGAAACGTAAGCAGCCACAAGGAAACGATCTT
66 Ядро AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 Ядро GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
68 Ядро TTTTAGAACATCCAATAAATCCAATAAC
69 Ядро AAATGTGGTAGATGGCCCGCTTGGGCGC
70 Ядро ACGGATCGTCACCCTCACGATCTAGAATTTT
71 Ядро CGCCATAAGACGACGACAATAGCTGTCT
72 Ядро GCGTATTAGTCTTTAATCGTAAGAATTTAC
73 Ядро AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
74 Ядро AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
75 Ядро TAATTTAGAACGCGAGGCGTTAAGCCTT
76 Ядро ACCAGGCGTGCATCATTAATTTTTTCAC
77 Ядро CAGCCTGACGACAGATGTCGCCTGAAAT
78 Ядро ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 Ядро CTCGAATGCTCACTGGCGCAT
80 Ядро GGGCAGTCACGACGTTGAATAATTAACAACC
81 Ядро
82 Ядро TCAACCCTCAGCGCCGAATATATTAAGAATA
83 Ядро ATTATACGTGATAATACACATTATCATATCAGAGA
84 Ядро GCAAATCTGCAACAGGAAAAATTGC
85 Ядро ATAATTACTAGAAATTCTTAC
86 Ядро TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 Ядро AAGTAGGGTTAACGCGCTGCCAGCTGCA
88 Ядро CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 Ядро TGGCGAAGTTGGGACTTTCCG
90 CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
91 Ядро AAATCAAAGAGAATAACATAACTGAACACAGT
92 Ядро CTGTATGACAACTAGTGTCGA
93 Ядро ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
94 Ядро TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
95 Ядро ATAAGAATAAACACCGCTCAA
96 Ядро CGTTGTAATTCACCTTCTGACAAGTATTTTAA
97 Ядро AACCGCCTCATAATTCGGCATAGCAGCA
98 Ядро AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
99 Ядро CAGTATAGCCTGTTTATCAACCCCATCC
100 Ядро TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
101 Ядро CGTCGGAAATGGGACCTGTCGGGGGAGA
102 Ядро AAGAAACTAGAAGATTGCGCAACTAGGG
103 Ядро CCAGAACCTGGCTCATTATACAATTACG
104 Ядро ACGGGTAATAAATTAAGGAATTGCGAATAGTA
105 Ядро CCACGCTGGCCGATTCAAACTATCGGCCCGCT
106 Ядро GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
107 CAGCATTAAAGACAACCGTCAAAAATCA
108 Ядро ACATCGGAAATTATTTGCACGTAAAAGT
109 Ядро CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
110 Ядро AAATCGTACAGTACATAAATCAGATGAA
111 Ядро TTAACACACAGGAACACTTGCCTGAGTATTTG
112 Ядро AGGCATAAGAAGTTTTGCCAGACCCTGA
113 Ядро GACGACATTCACCAGAGATTAAAGCCTATTAACCA
114 Ядро AGCTGCTCGTTAATAAAACGAGAATACC
115 Ядро CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
116 Ядро CACCCTCTAATTAGCGTTTGCTACATAC
117 Ядро GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
118 Ядро GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 Ядро ATGAAACAATTGAGAAGGAAACCGAGGATAGA
120 Ядро GGATGTGAAATTGTTATGGGGTGCACAGTAT
121 Ядро GGCTTGCGACGTTGGGAAGAACAGATAC
122 Ядро TAAATGCCTACTAATAGTAGTTTTCATT
123 Ядро TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
124 Ядро TGACCATAGCAAAAGGGAGAACAAC
125 Ядро CGAGCCAGACGTTAATAATTTGTATCA
126 Ядро GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 Ядро AGACGCTACATCAAGAAAACACTTTGAA
128 Ядро AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 Ядро GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
130 Ядро GGTATTAAGGAATCATTACCGAACGCTA
131 Ядро GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
132 Ядро
133 Ядро ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
134 Ядро AACGAGATCAGGATTAGAGAGCTTAATT
135 Ядро TACCAAGTTATACTTCTGAATCACCAGA
136 Ядро CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 Ядро AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
138 Ядро TTTCAACCAAGGCAAAGAATTTAGATAC
139 Ядро TTGAAATTAAGATAGCTTAACTAT
140 Ядро CTATTATCGAGCTTCAAAGCGTATGCAA
Ядро CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
142 Ядро GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 Ядро CGAACGTTAACCACCACACCCCCAGAATTGAG
144 Ядро GTGTGATAAATAAGTGAGAAT
145 Ядро GCTATATAGCATTAACCCTCAGAGA
146 Ядро AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 Ядро CGGCCTCCAGCCAGAGGGCGAGCCCCAA
148 Ядро CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 Ядро
150 Ядро ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
151 Ядро ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
152 Ядро TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
153 Ядро AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
154 Край TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
155 Край TTTTTTTTTTTTTTTTAATAAGAGAATA
156 Край TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 Край
158 Край TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 Край TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
160 Край TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
161 Край TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
162 Край TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
163 Край TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
164 Край TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
165 Край TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
166 Край TTTTTTTTTTTTTTTACCGGATATTCA
167 Край TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
168 Край TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 Край CTGAGAGAGTTGTTTTTTTTTTTTTTT
170 Край CAATGACAACAACCATTTTTTTTTTTTTTTT
171 Край TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
172 Край TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 Край
174 Край TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
175 Край TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
176 Край TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 Край CCACACAACATACGTTTTTTTTTTTTT
178 Край TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 Край TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
180 Край TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 Край TTTTTTTTTTTTTTTACGGCGGAT
182 Край TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 Край TTTTTTTTTTTTTTTACGATTGGCCTTGATA
184 Край TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 Край TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
186 Край TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 Край TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 Край ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 Край
190 Край TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
191 Край GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
192 Край GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 Край ATAACGTGCTTTTTTTTTTTTTTTTTT
194 Край TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
195 Край TTTTTTTTTTTTTTTACAAAATAAACA
196 Край TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 Край
198 Край TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 Край GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
200 Край TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
201 Край CACTAAAACACTTTTTTTTTTTTTTTT
202 Край TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
203 Край TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
204 Край TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
205 Край TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
206 Край TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
207 Край CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
208 Край TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
209 Край AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
210 Край ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
211 Край TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
212 Край TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
213 CAGAACAATATTTTTTTTTTTTTTTTT
214 Край TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
215 Край TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
216 Край TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
217 Край TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
218 Край TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 Край AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
220 Край CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
221 TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
222 Край TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
223 Край TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
224 Край TTTTTTTTTTTTTTTCGCCCACGCATAACCG
225 Край AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
226 Край CAAGTTTTTTGGTTTTTTTTTTTTTTT
227 Край TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
228 Край TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 Край TTTTTTTTTTTTTCATCTTTGACCC
230 Край TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
231 Край GATACAGGAGTGTACTTTTTTTTTTTTTTTT
232 Край TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
233 Край GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
234 Край TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
235 Край TTTTTTTTTTTTTTTATAGCAATAGCT
236 Ручки AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 Ручки ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
238 Ручки CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 Ручки CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
240 Ручки CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
241 Ручки CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
242 Ручки AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 Ручки CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
244 Ручки CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
245 Ручки TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
246 Ручки AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 Ручки GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
248 Путеводители AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 Путеводители ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
250 Путеводители CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
251 Путеводители GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
252 Путеводители AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
253 Путеводители TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
254 Путеводители TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
255 Путеводители удаления GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
256 Путеводители удаления GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 Путеводители удаления TAAAACACCGTACTTTAGAACTAAATTGCTACG
258 Путеводители удаления AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 Путеводители удаления CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
260 Графический интерфейс пользователяде удаления GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
261 Путеводители удаления ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
262 Гейтс Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
263 Гейтс Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
264 Гейтс Бит GATE0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
265 Гейтс Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

Таблица 1: Список основных последовательностейиспользуется для построения наноробот. Скобы 1-153 предназначены ядро и сделать основную часть структуры. Скобы 154-235 обозначены краев и расположены на каждом из торцов 61 спиралей структуры. Краевые скобы содержат поли тимин хвост разработанный, чтобы избежать агрегации нанороботов. Скобы 236-247 обозначаются Ручки и составляют сайты стыковки груза. Ручки скобы имеют уникальную область последовательности, соединяя их в определенном месте структуры, и область консенсусной последовательности, которая используется в качестве док сайта для грузовых молекул. Скобы 248-254 обозначены направляющие и приложите две половинки устройства в процессе отжига. После изготовления в направляющие удаляются с добавлением Руководство по удалению скоб 255-261 (этап 6), в результате чего устройство заблокирован двух датчиков нанороботов. Последовательности датчиков обозначаются Гейтс. Каждый из двух датчиков состоит из аптамеров PDGF и комплементарной нити. Для получения более подробной explaнации см Бен-Ишай др. 14 и Дуглас др. 15. Скобы упорядочены в продаже на трех 96-луночных планшетах (глубокий круглым дном). Каждый из основных продуктов количество нормализуется к 10 нмоль. Для ворот последовательностей, которые требуют очистки ВЭЖХ исключением, скобы не требуют специальной процедуры очистки.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Мы описали изготовление, очищение и визуализацию нанороботов ДНК. После изготовления гексагональной шасси устройства, функция нанороботов запрограммирован с простой внедрения конкретного груза и зондирования нитей на робота, который легко найти их назначенный положение из-за водородных связей взаимодополняемости с имеющимися однонитевых док сайтов 14 , 15,22.

Протокол изготовление описано использует медленный отжига рампы, которая, как правило, используется в нашей лаборатории, чтобы сложить широкий спектр оригами форм. Если время производство становится ключевым фактором и другие протоколы, такие как протокол быстрого складывания, описанной Собчак и др. 24 могут быть использованы. Этот протокол сообщалось достичь оригами складывания с высокими выходами, однако требует калибровки для каждой формы оригами.

Спин фильтрации используется для очистки от избыточного роботов скоб. При загрузке Sконтактный колонка с образцами или буфере, должны быть приняты, чтобы не повредить мембрану с кончика пипетки. Мембрана может потенциально привести к разрыву в результате резко снижению урожайности. Желательно, чтобы не выбрасывайте проточные, пока нанороботы не визуализируются возраста.

Для определенного приложения более высокая скорость очистки желательно; это может быть достигнуто путем повторения фильтрации с использованием первоначальной ротационную колонку. Для еще более высокой чистоты, новая колонка спин может быть использован, однако это будет иметь огромное негативное влияние на ставками доходности. Другие способы очистки ДНК оригами структур были испытаны, как удаления от агарозном геле последующим электрофорезом и диализа избыточных скоб. Эти методы привели к плохой выход либо или низкой скорости очистки по сравнению с описанным протоколом. Другие методы, такие как ПЭГ-основе очистки 25 и скорости зонального ультрацентрифугирования-26 не были проверены. Эти методы, как сообщается, АчиНакануне высокие темпы очистки, однако они либо приводят к низким выходам (скорости зонального ультрацентрифугирования) или требуют осадков (на основе ПЭГ), которые могут нанести вред полый форму нанороботов.

Нанороботы изготавливаются с гидом, который скобы запирают форму в закрытом положении для того, чтобы увеличить изготовления yeilds 15. Важно, чтобы удалить эти скобы, добавив Руководство по удалению скобы для нанороботов эффективно открытых в ответ на раздражители, предназначенных (PDGF в описанном протоколе). Руководство скобы разработаны с опоры одной цепи регионе для стыковки Руководство по удалению скобы, которые высвобождают направляющей скобы с помощью процесса вытеснения цепи 18 пребывают в этом отеле скобы должны быть добавлены в 10: 1 молярном соотношении в конце очистки превышения этап Staples "(шаг 4,7) и инкубировали в течение 2 часов при комнатной температуре на конце над конца шейкере.

Визуализация с помощью ПЭМ было описано, вкнг уранила формиат-2% негативно окрашенную. По сравнению с уранил-ацетата, формиата уранила-производит тонкие структуры зерна, которые позволяют для лучшего разрешения оригами ДНК конструкций. Уход должны быть приняты в качестве уранила формиата-застынет, если аликвоты заморожены в течение длительных периодов времени. Желательно использовать свежеприготовленный раствор 2% уранила формиат-за окрашивания. Лучшее разрешение достижимы при использовании крио-TEM 27.

Основная архитектурная конструкция и изготовление протокол нанороботов ДНК, в конечном счете однородным и простым. Тем не менее, широкий диапазон гибкости предлагается в виде конкретных грузовых смесей и зондирования нитей. Кроме того, в одной популяции многих подтипов могут быть введены и их относительной стехиометрией запрограммирован и оптимизированы с учетом специфических потребностей. Даже больше, тонкая настройка специфических кинетики в каждом лимитирующей стадии достижимо с увеличением / уменьшения длины двойной гибридизации нитей илиВведение несоответствия в конкретных ключевых позициях. Эта высокая степень гибкости с легкостью строительства позволяет инженерии наноразмерных устройств, способных выполнять весьма разнообразные сложные задачи в биологической среде соответствующего.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего раскрывать.

Acknowledgments

Авторы выражают благодарность С. Дуглас для очень ценные обсуждения и советы, и всех членов лаборатории Бачелет за полезные обсуждения и работы. Эта работа поддержана грантами от факультета естественных наук и Института нанотехнологий и перспективных материалов Университета Бар-Илан.

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics