Folding og karakterisering av en Bio-responsive Robot fra DNA Origami

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

DNA nanorobot er en hul sekskantet nanometric enhet, designet for å åpne i respons til bestemte stimuli og nåtid last sekvestrert inne. Både stimuli og last kan skreddersys etter behov. Her beskriver vi DNA nanorobot fabrikasjonsprotokoll, med bruk av DNA origami teknikk. Fremgangsmåten starter ved å blande kort enkeltkjedet DNA stifter inn i et lager blanding som deretter tilsettes til en lang, rund, enkeltkjedet DNA stillaset i nærvær av en foldebuffer. En standard termosykler er programmert til å gradvis senke blandingsreaksjonstemperaturen for å lette stifter til stillaset gløding, som er den styrende kraft bak folding av nanorobot. Når 60 timer folding reaksjonen er fullstendig, blir overskudd av stifter kastes ved hjelp av en sentrifuge-filter, etterfulgt av visualisering via agarose-gel-elektroforese (AGE). Til slutt blir vellykket fremstilling av nanorobot verifisert ved transmisjonselektronmikroskopi (TEM),med bruk av uranyl-formiat som negative flekken.

Introduction

De bruker for nukleinsyrer nanoteknologi er forbløffende. Den tractability av Watson-Crick baseparing samt den enkle og relativt lave kostnader i stor skala syntese av skreddersydde oligos 2 har generert en eksplosjon av søknader 3 og forskning innen DNA nanoteknologi. Strukturelle DNA nanoteknologi, basert på det immobile Seeman krysset 4,5 som en grunnleggende byggeblokk gjør bruk av DNA som en selvsammen elementær enhet for bygging av vilkårlige former 6-8.

Den siste utviklingen av stillaset DNA origami 9 teknikken gjør det mulig for bygging av komplekse 2D / 3D nano arkitekturer 10-12 med sub-nanometer presisjon og er en effektiv rute for å bygge nye funksjonelle objekter med økende kompleksitet og forbløffende mangfold. Byggeprosessen er basert på en lang stillas enkelttrådet DNA, vanligvis avledet fra et viralt genome, som kan brettes inn i hybridiseringen av hundrevis av korte enkeltkjedet DNA oligonukleotider betegnet stifter. Den høye strukturelle oppløsning oppnådd ved denne teknikk er et direkte resultat av den naturlige dimensjonene av DNA-dobbeltspiralen, mens reproduserbarheten av fabrikasjonen er et resultat av å skreddersy de korte enkelttråds stift sekvenser for å lette maksimal hydrogenbinding komplementaritet oppnåelig. Med bruk av en langsom temperatur annealing rampe utformet lavest energi, termodynamisk foretrekkes nanostrukturen oppnås i høye utbytter og gjengivelse. Den enkel implementering av koblingsdesignregler i en datakode aktivert utvikling av DAK-verktøy, for eksempel caDNAno 13, som ekstremt forenkle oppgaven med å designe store, komplekse strukturer som inneholder hundrevis av tilkoblede veikryss.

Tidligere har vi beskrevet konstruksjonen av en DNA-nanorobot ved hjelp av den caDNAno verktøyet 14,15. Her viser vi fabrikasjon ogvisualisering, via transmisjonselektronmikroskopi (TEM), av nanorobot, en 3D hul sekskantet nanodevice, med dimensjoner på 35 x 35 x 50 nm 3, utformet for å gjennomgå en stor konformasjonsendring i respons til et forhåndsbestemt stimuli og liggende spesifikk last, f.eks som proteiner eller nukleinsyre oligos, sekvestrert inne. Mens 12 lastestasjoner er tilgjengelig inne i hule chassis, skiller det faktiske antall av bundet last med last størrelse. Cargo molekyler spenner fra små DNA-molekyler til enzymer, antistoffer og 5-10 nm gull nanopartikler. Cargocan enten være ensartet eller uensartet, slik at hver nanorobot inneholder en blanding av forskjellige molekyler. Sensing oppnås via to doble spiralformede låse porter design til fornuft proteiner, nukleinsyrer eller andre kjemikalier, basert enten på aptasensor 16,17 eller DNA-tråden forskyvning 18 teknologier. Den siste utviklingen i aptamer valgprotokollene 19-21 aktiver design av nanoroboter å svaretil en stadig økende utvalg av molekyler og celletyper.

Tidligere arbeid viste en nanorobot bærer et spesifikt antistoff, som ved binding til antigenet kan relé enten inhiberende eller en produktiv signal til innsiden av spesifikke celletyper i en blandet cellepopulasjon 15. En spennende funksjon av disse nanodevices er deres evne til å utføre enda mer komplekse oppgaver og logisk kontroll med innføring av forskjellige nanorobot undertyper i en enkelt populasjon. Nylig demonstrerte vi bestemte undergrupper av nanoroboter som utfører som enten positive eller negative regulatorer, som styrer en effektor befolkningen som inneholder en aktiv last molekyl 22.

Protokollen presenteres her beskriver fremstillingen, rensingen og avbildning av et nanorobot gated med aptamer sensor sekvenser som bindes selektivt til PDGF for å lette åpningen av nanorobot 15,22. Fremstillingsprosessen som er beskrevet er lik nanorobot fabrikasjon prosessen opprinnelig avbildet av Douglas et al. 15 med endringer for å redusere totale prosessen varighet, mens øke utbyttet og rense priser.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Utarbeidelse av Staples Pool Blanding

  1. Bestill frysetørret DNA nanorobot stifter på 96-brønners plater som er oppført i tabell 1 (se Materials) og normal til 10 nmol. For en detaljert beskrivelse av design og arkitektur av DNA nanorobot se Ben-Ishay et al. 14 og Douglas et al. 15).
  2. Rekonstituer hver stift godt med DNase / RNase-fri ultrarent til en konsentrasjon på 100 uM. For stifter normalisert til 10 nmol rekonstituere med 100 ul ultrarent vann.
  3. Bassenget sammen 20 mL av hver stift med en multikanalpipette og en steril 55 ml oppløsning servant.
    Merk: Siden nanorobot form består av 254 stifte tråder (inkludert Core, Kanter, Håndtak og guider sekvenser, Tabell 1), konsentrasjonen av hver av de stifter i stifter bassenget er 394 nM. Fjerne stifter fra stifte bassenget, eller legge noen på ulike volvolumer, kan redusere utbyttet betydelig, eller på annen måte føre til utfoldete aggregater.

2. Fremstilling av Fabrication reaksjonsblandingen

  1. For en standard reaksjonsblanding bruke 40 pl M13mp18-virusgenomet sirkulært enkeltkjedet DNA, svarende til 4 pmol av stillaset DNA (100 nM forrådsløsning, se Materials). Sluttkonsentrasjon av stillaset i fabrikasjon blandingen er 20 nM, sluttvolum 200 ul.
    1. Juster mengden stillaset DNA i henhold til spesifikke behov; Imidlertid holder den endelige konsentrasjonen av stillaset DNA i reaksjonsblandingen ved en konstant 20 nM.
  2. Legg stifter for å nå et stillas til stifter forhold på 1 til 10, henholdsvis. For en 20 nM stillas DNA-konsentrasjon, er hver av de 254 'stifter sluttkonsentrasjon 200 nM. For en 200 mL endelig reaksjonsvolum legge 102 mL av stifter bassenget blanding (avsnitt 1.2).
    1. Legg spesifikke Gate sekvenser separat til the folding reaksjonsblandingen på dette tidspunktet. Disse oligos bestilles separat og krever HPLC rensing. Sikre at Gate oligoene er tilstede i en 01:10 stillas til Gate sekvens andel, dvs. 200 nM av hver oligo for et stillas 20 nM konsentrasjon. For en 200 pl reaksjonsvolum folding, tilsett 0,4 mL for hver av de fire Gate oligo på en 100 uM lager konsentrasjon.
  3. Legg 10 x TAE buffer lager for å nå en sluttkonsentrasjon på 1 x TAE (40 mM Tris-acetat, 1 mM EDTA). For en 200 mL sammenleggbar reaksjon volum, legge til 20 mL av 10x TAE.
  4. Tilsett 1 M MgCl2 til en endelig konsentrasjon på 10 mM. For en 200 mL sammenleggbar reaksjonsvolum, tilsett 2 mL av en M MgCl2.
  5. Legg 36 mL av DNase / RNase fri ultrarent vann til en nå et endelig volum på 200 ul.
  6. Vortex og delmengde 100 ul prøver til PCR-hetteglass.
    Merk: Se termosykler spesifisering av de maksimale reaksjonsvolumer som skal brukes.Redusere volumet for å møte disse grensene vil ikke redusere utbyttene innhentet. Reaksjonsvolumer over den maksimale angitte vil sette rentene.

3. Temperatur Utglødning Ramp av Fabrication Reaction

  1. Program termosykler som følger:
    1. Rampe 85 ° C til 60 ° C med en hastighet på 5 min / ° C.
    2. Ramp 60 ° C til 4 ° C ved en hastighet på 75 min / ° C.
    3. Hold ved 4 ° C på ubestemt tid.
  2. Etter fabrikasjon er avsluttet lagre prøvene ved -20 ° C.

4. fjerning av overflødig Staples

  1. Tilsett 100 ul av folding reaksjonsblandingen til en 0,5 ml sentrifugalfilter med en MWCO på 100 kDa. Lagre en 10 mL prøve av nanoroboter pre-rensing for senere analyse.
  2. Sentrifuger i 10 minutter ved 9600 x g.
  3. Tilsett 400 ul av foldebuffer (1 x TAE, 10 mM MgCl2).
  4. Gjenta trinn 4,2 og 4,3 ganger mer.
  5. Sentrifuger i 5 min ved 9600 x g.
  6. Gjenopprette konsentratet ved å plassere filteret opp ned i en ren mikro rør og spinn for en min ved 9600 x g. Avsluttende mengder kan variere avhengig av det opprinnelige volumet av fabrikasjon reaksjonsblandingen som ble satt inn i filteret. Typisk vil en 25 til 60 ul sluttvolum av konsentrert nanorobot prøve oppnås.
  7. Måle konsentrasjonen av DNA i prøvene via spektrofotometer ved 260 nm. Bruk molekylvekt på 5,3 pg / pmol ved beregning molare konsentrasjoner av nanorobot prøver.
    Merk: Det molare ekstinksjonskoeffisient for dsDNA, 50 mikrogram / ​​OD 260, er tilstrekkelig for de fleste bruksområder. 48 ug / OD 260 tar hensyn til poly tymin ssDNA strekker seg på kantene stifter.

5. agarosegelelektroforese Analyse av Folded nanoroboter

  1. Fremstilling av 0,5x TBE (45 mM Tris-borat, 1 mM EDTA), 2% agarosegel supplert med 10 mM MgCl2 et al. 21):
    1. Forbered 0.5x TBE buffer ved å fortynne 6,25 ml 10x TBE lager buffer i 118,75 ml DDH 2 O.
    2. Oppløs 2,5 g agarose i 125 ml 0,5x TBE-buffer.
    3. Kok i mikrobølgeovn inntil agarose er fullstendig oppløst.
    4. Legg 1,25 ml av 1 M MgCl2 til endelig konsentrasjon på 10 mM.
    5. Legg til 7 ul av 10 mg / ml etidiumbromid.
    6. Vent til løsning til litt kjølig og fylle gelen skuffen før agarosegelen stivner. Installere ønsket kam umiddelbart.
    7. Tilbered en L 0,5x TBE buffer ved tilsetning av 50 ml 10 x TBE-buffer lager og 10 ml 1 M MgCl2 for å 940 ml DDH 2 O.
    8. Når gelen er fast add buffer til elektroforese enheten og sette apparatet i et isbad.
  2. Load 1 mikrogram total DNA av nanoroboter pre-rensing (trinn 3.2), og etter rensing (trinn 4.7), sammen med et stillasDNA-prøven og et 1 kb DNA-markør, på gelen. Et eksempel er gitt i figur 2. De faktiske mengder av prøvene avhenge av konsentrasjonen som oppnås etter rensing. Hver prøvene ladet med ladningsbuffer ved en 1: 6 endelig volum-forhold.
  3. Still strømkilde til 80 V og kjøre gel i 3 timer. Kjør gelen i et bad fylt med is og vann. Nanoroboter vil utfolde seg og fremstå som en sverte hvis agarosegelen varmes opp under elektroforese. Under elektroforese legge ekstra is for å holde enheten fra oppvarming.
  4. Syn gel på en UV-tabell (figur 2).

6. Negative Stain av nanorobot med Uranyl-format

  1. Fremstilling av 2% uranyl-formiat lagerløsning (tilpasset fra Castro et al. 23):
    1. Veier 100 mg av uranyl-formiat pulver i et 15 ml rør.
    2. Kok DNase / RNase fritt ultrarent vann i 3 minutter til de-oksygenatet.
    3. Tilsett 5 ml deoksygenert varmt vann (~ 60 ° C)inn i 15 ml rør inneholdende uranyl-formiat pulver (fra foregående trinn). Tett tett lokk, wrap i aluminiumsfolie og vortex strengt i 10 min (feste røret til en vortex). Oppløsningen skal være grumset med en gul farge.
    4. Filter løsning gjennom en 0,2 mikrometer sprøyte fi lter. Oppløsningen skal bli klart.
    5. Alikvoter 200 ul av oppløsningen inn i mikrosentrifugerør.
    6. Sentrifuge ved maksimal hastighet i 5 minutter i en bordsentrifuge i bassenget eksempler på bunnen av røret.
  2. Lasting av prøven til rutenett og negativ farging:
    1. Tine en 200 mL delmengde av 2% uranyl-formiat (fremstilt i avsnitt 6.1). Tilsett 10 ul 0,5 M NaOH-løsning og vortex grundig i 3 min. Sentrifuger ved maks hastighet i 5 minutter ved hjelp av en bordplate sentrifuge.
    2. I mellomtiden, glød-utslippet grid bruker romluft på 0,2 mbar og 25 mA i 30 sek.
    3. Legg 15 ul 2 nM nanorobot prøven etter rensing (§ AAApå 4,7) på oversiden av rutenettet (holdt med tang) og la absorbere i 1 min. Bruk fi lter papir for å drenere overskuddsvæske ved å plassere gitteret på toppen av filterpapiret. Ikke berør rutenettet overflaten.
    4. Tilsett 10 mL av 2% uranyl-formiat (fra trinn 6.2.1) på oversiden av rutenettet (holdt med pinsett).
    5. Raskt bruk fi lter papir for å drenere overskuddsvæske ved å plassere gitteret på toppen av filterpapiret. Ikke berør rutenettet overflaten.
    6. Gjenta trinn 6.2.4 og 6.2.5.
    7. Tilsett 10 mL av 2% uranyl-formiat (fra trinn 6.2.1) på oversiden av rutenettet (holdt med pinsett). La fargeløsning som absorberer i 30 sek.
    8. Bruk fi lter papir for å drenere overskuddsvæske ved å plassere gitteret på toppen av filterpapiret. Ikke berør rutenettet overflaten.
    9. La rutenettet tørke helt i minst 30 min, møte opp på et filterpapir, før injisering i TEM.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Representative resultater er vist i figur 2A. Alle baner inneholder 1 ug av total-DNA, målt via spektrofotometer (OD 260). Sammenlignet med den sirkulære enkeltkjedet DNA stillas (felt 2), nanoroboter er hindret i gelen på grunn av deres høyere molekylvekt, et resultat av stifter hybridisering til stillaset DNA (Lane 3. rød pil). Den lavmolekylære bånd i Lane 3 representerer overskytende stifter som ikke binder seg til stillaset DNA (grønn pil). Etter rensing ved hjelp av sentrifugal-filtrering meste av det overskytende stiftene fjernes (kolonnene 4-6) og nanoroboter er klar til å bli lastet med cargomolekyler konjugert til håndtakene komplementære tråden 14,15,22. Lanes 4-6 inneholde høymolekylvekt band som representerer nanorobot dimer (blå pil), en befolkning på nanoroboter som er bundet sammen. Redusere konsentrasjonen av stillaset i fabrikasjonen prosedyre (enten 5 eller 10 nM), kan potensielt reduce den relative mengden av disse høymolekylære strukturer. Lanes 4-6 viser nanoroboter post-rensing med små variasjoner til den beskrevne renseprotokoll, nemlig den opprinnelige volumet av fabrikkerte nanoroboter lagt til spin filter (trinn 4.1 Lane. 4: 50 ul; Lane 5: 100 ul; Lane 6: 100 ul), og det antall ganger buffer ble tilsatt til filteret (trinn 4.4 Felt 4: 2 ganger, felt 5:. to ganger, felt 6: 5 ganger).

Sammenligning av utbytte og rensing resultater mellom de ulike variantene i protokollen (figur 2C) viser at å redusere den opprinnelige volum fabrikkert roboter lastet inntil sentrifugalfilter (trinn 4.1) har liten effekt på avkastning og rense priser. Videre øker antallet bufferskift og sentrifugale spinn (trinn 4.4) har marginal innvirkning på renheten på nanoroboter, samtidig som i betydelig grad reduserer utbyttet. Derav den beskrevne protokoll, tilsvarende 100 ulopprinnelige volum og 2 buffer tilsetninger (spor 5), er ansett som optimal.

Utbytte Beregningene er basert på spektrofotometer (OD 260) målinger av hver prøve etter-rensing og beregnet i forhold til den opprinnelige mengde som er lagt inn i hver sentrifugalfilter. Rensing er basert på vektprosent av de nanoroboter fra hele DNA i prøven, tilsvarende nanoroboter og overskytende stifter som ikke vaskes ut under rensing. Rensing av beregninger er beregnet fra den relative intensiteten av nanoroboter (røde og blå piler i figur 2A) til at det overskytende stifter (grønn pil i figur 2B). De relative nanoroboter / stifter intensiteter ble normalisert med pre-renset prøve (Lane 3), hvor den totale DNA vekten av kramper (grønn pil) er ~ 4,5 ganger så stor som de urensede nanoroboter (rød pil), tilsvarende den innledende 10: 1 stillaset tilstifter molforhold i fabrikasjonsprotokoll.

Slutt validering av strukturell integritet oppnås via transmisjonselektronmikroskopi ved anvendelse av 2% uranyl-formiat som en negativ flekken. Bilder er vist i figur 3.

Figur 1
Figur 1: Design skjematisk av nanorobot (A) fra siden av en lukket nanorobot.. Gate dobbeltspiralen, produsert av en aptamer sekvens og en utfyllende tråd, er angitt med en grønn pil. (B) Sett forfra av en lukket nanorobot som viser protein last bundet inne. (C) Tverrsnittskonstanter skjematisk av lukkede nanorobot produsert. Håndtak stifter er markert med en rød pil. Grønne sirkler angir viklingene som inneholder et hengsel på den ene siden, og en port-sekvens på den motsatte side. (D) Blueprints aven nanorobot ved side-visning. Håndtakene er angitt med røde piler. Gate sekvenser er indikert med grønne piler. Klikk her for å se en større versjon av dette tallet.

Figur 2
Fig. 2: agarosegel-elektroforese resultater (A) Felt 1: 1 kb markør. Felt 2: M13mp18 sirkulær single-strand stillaset. Lane 3: nanoroboter pre-rensing. Lanes 4-6: nanoroboter poste renselser. Felt 4: 50 ul opprinnelige volum; 2 buffer tilføyelser. Lane 5: 100 ul første volum; 2 buffer tilføyelser. Lane 6: 100 ul første volum; 5 buffer tilføyelser. Overflødig stifter indikeres med en grønn pil Ferdige nanoroboter er indikert med en rød pil. Blå pilen indikert nanorobot dimer. (B) 3D-visning av den relative intensiteten av bandene i agarosegel. (C) Yield og rensing beregninger.

Figur 3
Figur 3: TEM bilder av DNA-nanoroboter tatt fra flere fabrikasjoner / flekker prosedyrer.

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> Kjerne 141 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
Antall Betegnelse Sekvens
1 Kjerne AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
2 Kjerne GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 Kjerne TACGATATAGATAATCGAACAACA
4 Kjerne CTTTTGCTTAAGCAATAAAGCGAGTAGA
5 Kjerne GTCTGAAATAACATCGGTACGGCCGCGCACGG
6 Kjerne GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 Kjerne AAAATCACCGGAAGCAAACTCTGTAGCT
8 Kjerne CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 Kjerne CATGTAAAAAGGTAAAGTAATAAGAACG
10 Kjerne ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
11 Kjerne ATAGTCGTCTTTTGCGGTAATGCC
12 Kjerne AGTCATGGTCATAGCTGAACTCACTGCCAGT
1. 3 Kjerne AACTATTGACGGAAATTTGAGGGAATATAAA
14 Kjerne ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
15 Kjerne AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
16 Kjerne GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
17 Kjerne GCACCGCGACGACGCTAATGAACAGCTG
18 Kjerne AACTTCATTTTAGAATCGCAAATC
19 Kjerne CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
20 Kjerne CCAATCAAAGGCTTATCCGGTTGCTATT
21 Kjerne AGAGGCGATATAATCCTGATTCATCATA
22 Kjerne CCGTAATCCCTGAATAATAACGGAATACTACG
23 Kjerne AAATGGTATACAGGGCAAGGAAATC
24 Kjerne TCCTCATCGTAACCAAGACCGACA
25 Kjerne CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
26 Kjerne ACCCGCCCAATCATTCCTCTGTCC
27 Kjerne CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
28 Kjerne CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
29 Kjerne TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
30 Kjerne
31 Kjerne AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
32 Kjerne ACATTCAGATAGCGTCCAATATTCAGAA
33 Kjerne AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
34 Kjerne GAGATGACCCTAATGCCAGGCTATTTTT
35 Kjerne TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
36 Kjerne GCCGAAAAATCTAAAGCCAATCAAGGAAATA
37 Kjerne AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
38 Kjerne ACCAATCGATTAAATTGCGCCATTATTA d>
39 Kjerne ATCTTACTTATTTTCAGCGCCGACAGGATTCA
40 Kjerne CCCTAAAAGAACCCAGTCACA
41 Kjerne GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
42 Kjerne CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
43 Kjerne TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
44 Kjerne TTCCTTATAGCAAGCAAATCAAATTTTA
45 Kjerne ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
46 Kjerne AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
48 Kjerne TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 Kjerne AAAGAAACAAGAGAAGATCCGGCT
50 Kjerne TTGAGGGTTCTGGTCAGGCTGTATAAGC
51 Kjerne TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
52 Kjerne ACGAGCGCCCAATCCAAATAAAATTGAGCACC
53 Kjerne AATAAGTCGAAGCCCAATAATTATTTATTCTT
54 Kjerne ACGAAATATCATAGATTAAGAAACAATGGAACTGA
55 Kjerne TTTCATAGTTGTACCGTAACACTGGGGTTTT
56 Kjerne AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
57 Kjerne CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
58 Kjerne TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 Kjerne ATAACGCAATAGTAAAATGTTTAAATCA
60 Kjerne ACGAATCAACCTTCATCTTATACCGAGG
61 Kjerne TAATGGTTTGAAATACGCCAA
62 Kjerne CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
63 Kjerne ATTAAAGGTGAATTATCAAAGGGCACCACGG
64 GGCAACCCATAGCGTAAGCAGCGACCATTAA
65 Kjerne AGAAACGTAAGCAGCCACAAGGAAACGATCTT
66 Kjerne AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 Kjerne GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
68 Kjerne TTTTAGAACATCCAATAAATCCAATAAC
69 Kjerne AAATGTGGTAGATGGCCCGCTTGGGCGC
70 Kjerne ACGGATCGTCACCCTCACGATCTAGAATTTT
71 Kjerne CGCCATAAGACGACGACAATAGCTGTCT
72 Kjerne GCGTATTAGTCTTTAATCGTAAGAATTTACEN
73 Kjerne AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
74 Kjerne AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
75 Kjerne TAATTTAGAACGCGAGGCGTTAAGCCTT
76 Kjerne ACCAGGCGTGCATCATTAATTTTTTCAC
77 Kjerne CAGCCTGACGACAGATGTCGCCTGAAAT
78 Kjerne ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 Kjerne CTCGAATGCTCACTGGCGCAT
80 Kjerne GGGCAGTCACGACGTTGAATAATTAACAACC
81 Kjerne
82 Kjerne TCAACCCTCAGCGCCGAATATATTAAGAATA
83 Kjerne ATTATACGTGATAATACACATTATCATATCAGAGA
84 Kjerne GCAAATCTGCAACAGGAAAAATTGC
85 Kjerne ATAATTACTAGAAATTCTTAC
86 Kjerne TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 Kjerne AAGTAGGGTTAACGCGCTGCCAGCTGCA
88 Kjerne CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 Kjerne TGGCGAAGTTGGGACTTTCCG
90 CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
91 Kjerne AAATCAAAGAGAATAACATAACTGAACACAGT
92 Kjerne CTGTATGACAACTAGTGTCGA
93 Kjerne ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
94 Kjerne TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
95 Kjerne ATAAGAATAAACACCGCTCAA
96 Kjerne CGTTGTAATTCACCTTCTGACAAGTATTTTAA
97 Kjerne AACCGCCTCATAATTCGGCATAGCAGCA
98 Kjerne AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
99 Kjerne CAGTATAGCCTGTTTATCAACCCCATCC
100 Kjerne TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
101 Kjerne CGTCGGAAATGGGACCTGTCGGGGGAGA
102 Kjerne AAGAAACTAGAAGATTGCGCAACTAGGG
103 Kjerne CCAGAACCTGGCTCATTATACAATTACG
104 Kjerne ACGGGTAATAAATTAAGGAATTGCGAATAGTA
105 Kjerne CCACGCTGGCCGATTCAAACTATCGGCCCGCT
106 Kjerne GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
107 CAGCATTAAAGACAACCGTCAAAAATCA
108 Kjerne ACATCGGAAATTATTTGCACGTAAAAGT
109 Kjerne CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
110 Kjerne AAATCGTACAGTACATAAATCAGATGAA
111 Kjerne TTAACACACAGGAACACTTGCCTGAGTATTTG
112 Kjerne AGGCATAAGAAGTTTTGCCAGACCCTGA
113 Kjerne GACGACATTCACCAGAGATTAAAGCCTATTAACCA
114 Kjerne AGCTGCTCGTTAATAAAACGAGAATACC
115 Kjerne CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
116 Kjerne CACCCTCTAATTAGCGTTTGCTACATAC
117 Kjerne GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
118 Kjerne GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 Kjerne ATGAAACAATTGAGAAGGAAACCGAGGATAGA
120 Kjerne GGATGTGAAATTGTTATGGGGTGCACAGTAT
121 Kjerne GGCTTGCGACGTTGGGAAGAACAGATAC
122 Kjerne TAAATGCCTACTAATAGTAGTTTTCATT
123 Kjerne TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
124 Kjerne TGACCATAGCAAAAGGGAGAACAAC
125 Kjerne CGAGCCAGACGTTAATAATTTGTATCA
126 Kjerne GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 Kjerne AGACGCTACATCAAGAAAACACTTTGAA
128 Kjerne AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 Kjerne GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
130 Kjerne GGTATTAAGGAATCATTACCGAACGCTA
131 Kjerne GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
132 Kjerne
133 Kjerne ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
134 Kjerne AACGAGATCAGGATTAGAGAGCTTAATT
135 Kjerne TACCAAGTTATACTTCTGAATCACCAGA
136 Kjerne CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 Kjerne AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
138 Kjerne TTTCAACCAAGGCAAAGAATTTAGATAC
139 Kjerne TTGAAATTAAGATAGCTTAACTAT
140 Kjerne CTATTATCGAGCTTCAAAGCGTATGCAA
Kjerne CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
142 Kjerne GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 Kjerne CGAACGTTAACCACCACACCCCCAGAATTGAG
144 Kjerne GTGTGATAAATAAGTGAGAAT
145 Kjerne GCTATATAGCATTAACCCTCAGAGA
146 Kjerne AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 Kjerne CGGCCTCCAGCCAGAGGGCGAGCCCCAA
148 Kjerne CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 Kjerne
150 Kjerne ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
151 Kjerne ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
152 Kjerne TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
153 Kjerne AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
154 Kant TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
155 Kant TTTTTTTTTTTTTTTTAATAAGAGAATA
156 Kant TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 Kant
158 Kant TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 Kant TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
160 Kant TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
161 Kant TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
162 Kant TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
163 Kant TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
164 Kant TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
165 Kant TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
166 Kant TTTTTTTTTTTTTTTACCGGATATTCA
167 Kant TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
168 Kant TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 Kant CTGAGAGAGTTGTTTTTTTTTTTTTTT
170 Kant CAATGACAACAACCATTTTTTTTTTTTTTTT
171 Kant TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
172 Kant TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 Kant
174 Kant TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
175 Kant TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
176 Kant TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 Kant CCACACAACATACGTTTTTTTTTTTTT
178 Kant TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 Kant TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
180 Kant TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 Kant TTTTTTTTTTTTTTTACGGCGGAT
182 Kant TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 Kant TTTTTTTTTTTTTTTACGATTGGCCTTGATA
184 Kant TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 Kant TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
186 Kant TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 Kant TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 Kant ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 Kant
190 Kant TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
191 Kant GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
192 Kant GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 Kant ATAACGTGCTTTTTTTTTTTTTTTTTT
194 Kant TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
195 Kant TTTTTTTTTTTTTTTACAAAATAAACA
196 Kant TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 Kant
198 Kant TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 Kant GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
200 Kant TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
201 Kant CACTAAAACACTTTTTTTTTTTTTTTT
202 Kant TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
203 Kant TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
204 Kant TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
205 Kant TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
206 Kant TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
207 Kant CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
208 Kant TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
209 Kant AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
210 Kant ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
211 Kant TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
212 Kant TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
213 CAGAACAATATTTTTTTTTTTTTTTTT
214 Kant TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
215 Kant TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
216 Kant TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
217 Kant TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
218 Kant TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 Kant AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
220 Kant CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
221 TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
222 Kant TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
223 Kant TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
224 Kant TTTTTTTTTTTTTTTCGCCCACGCATAACCG
225 Kant AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
226 Kant CAAGTTTTTTGGTTTTTTTTTTTTTTT
227 Kant TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
228 Kant TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 Kant TTTTTTTTTTTTTCATCTTTGACCC
230 Kant TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
231 Kant GATACAGGAGTGTACTTTTTTTTTTTTTTTT
232 Kant TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
233 Kant GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
234 Kant TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
235 Kant TTTTTTTTTTTTTTTATAGCAATAGCT
236 Håndtak AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 Håndtak ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
238 Håndtak CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 Håndtak CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
240 Håndtak CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
241 Håndtak CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
242 Håndtak AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 Håndtak CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
244 Håndtak CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
245 Håndtak TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
246 Håndtak AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 Håndtak GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
248 Guides AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 Guides ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
250 Guides CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
251 Guides GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
252 Guides AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
253 Guides TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
254 Guides TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
255 Guides Removal GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
256 Guides Removal GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 Guides Removal TAAAACACCGTACTTTAGAACTAAATTGCTACG
258 Guides Removal AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 Guides Removal CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
260 Guides Removal GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
261 Guides Removal ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
262 Gates Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
263 Gates Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
264 Gates Gate0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
265 Gates Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

Tabell 1: Liste over stift sekvenserbrukes til å konstruere nanorobot. Staples 1-153 er utpekt Core og utgjør hoveddelen av strukturen. 154-235 stifter er betegnet kanter og er plassert ved hver av endene av viklingene 61 av strukturen. Kant stifter inneholder et poly tymin hale utformet for å unngå aggregering av nanoroboter. Staples 236-247 er utpekt Håndtak og gjøre opp laste docking nettsteder. Håndterer stifter har en unik sekvens region, koble dem til deres spesifikke plassering av strukturen, og en konsensus sekvens region som brukes som docking nettstedet for laste molekyler. Staples 248-254 er utpekt Guides og fest de to halvdelene av enheten under glødeprosessen. Etter fabrikasjon guidene er fjernet med tillegg av Guide fjerning stifter 255-261 (trinn 6), forlater enheten låst av de to følerne i nanorobot. Sensor sekvenser er utpekt Gates. Hver av de to sensorene består av en PDGF aptamer, og et komplementære tråden. For en mer detaljert explanasjon se Ben-Ishay et al. 14 og Douglas et al., 15. Staples er beordret kommersielt på tre 96-brønners plater (dyp rund bunn). Hver stift beløpet er normalisert til 10 nmol. Med unntak av de Gate sekvenser, som krever HPLC rensing, trenger stifter ikke krever en spesiell rensemetode.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Vi beskrev fremstilling, rensing, og visualisering av DNA nanorobot. Etter fremstillingen av den heksagonale chassis av anordningen, er funksjonen av nanorobot programmert med enkel innføring av spesifikk last og føler tråder til roboten som lett finne sin egen stilling på grunn av hydrogenbinding komplementaritet med tilgjengelige enkelttrådstilkoblingssteder 14 , 15,22.

Fabrikasjon protokollen beskrevet bruker en langsom gløding rampe, som vanligvis brukes i vår lab å kaste et bredt spekter av origami figurer. Hvis produksjonstiden blir en viktig faktor andre protokoller, slik som den raske folding protokollen beskrevet av Sobczak et al. 24 kan anvendes. Denne protokollen er rapportert å oppnå origami folding i høye utbytter, men det krever kalibrering for hver origami form.

Spin filtrering blir brukt til å rense robotene fra overskytende stifter. Når du legger de spin kolonne med prøver eller buffer, bør man være forsiktig så du ikke skader membranen med pipettespissen. Membranen kan potensielt brudd resulterer i dramatisk reduserte avlinger. Det er lurt å ikke forkaste gjennomstrømning inntil nanoroboter er visualisert etter alder.

For enkelte søknad høyere rensegrad er ønsket; dette kan oppnås ved å gjenta filtrering ved hjelp av det opprinnelige spinnkolonne. For enda høyere renhet, kan en ny vri kolonne brukes, men dette vil ha en dramatisk negativ effekt på avkastningen priser. Andre metoder for rensing av DNA origami strukturer ble testet, slik som fjerning fra agarosegel påfølgende elektroforese og dialyse av overflødig stifter. Disse fremgangsmåter resulterte i enten dårlig utbytte eller dårlig rense prisen sammenlignet med den beskrevne protokoll. Andre metoder, slik som PEG-baserte rensing 25 og hastighets-soneultrasentrifugering 26 ble ikke testet. Disse metodene er rapportert å Achieve høy rense priser, men de enten føre til dårlig avkastning (rente-sone ultra-sentrifugerings) eller kreve nedbør (PEG-basert) som potensielt kan skade den hule nanorobot form.

Nanoroboter er fabrikkert med guide stifter som låser formen i lukket posisjon for å øke fabrikasjons yeilds 15. Det er viktig å fjerne disse stifter ved å tilsette å gjøre fjerning stifter for nanoroboter til effektivt å åpne i respons til de utformede stimuli (PDGF i den beskrevne protokoll). Guide stifter er designet med en toehold enkelt strand region for dokking av guide fjerning stifter som slipper guide stifter gjennom en prosess med tråd forskyvning 18 .Disse stifter bør legges på en 10: 1 molarforhold på slutten av rensing av overskytende stifter 'trinn (trinn 4,7) og inkubert i 2 timer ved værelsestemperatur på en ende-over-ende shaker.

Visualisering av TEM ble beskrevet, including uranyl-formiat 2% negativ farging. Sammenlignet med uranyl-acetat, produserer uranyl-formiat finere kornstrukturer som gir mulighet for bedre oppløsning av DNA origami design. Forsiktighet bør tas som uranyl-formiat stivner hvis porsjoner er frosset for lange perioder av gangen. Det anbefales å bruke en nylaget 2% uranyl-formiat løsning for farging. Bedre oppløsninger er oppnåelig med bruk av Cryo-TEM 27.

Den grunnleggende arkitektonisk utforming og fabrikasjon protokollen for DNA nanorobot er slutt uniform og grei. Det er imidlertid et bredt spekter av fleksibilitet tilbys i form av konkrete laste blandinger og sensing tråder. Videre, i en enkelt populasjon mange undertyper kan bli innført, og deres relative støkiometri programmert og optimalisert for å passe spesielle behov. Enda større finjustering av de spesielle kinetikken ved hver hastighetsbegrensende trinn er oppnåelig med økende / redusere lengden av dobbelt tråd hybridisering ellerInnføringen av uoverensstemmelser på bestemte nøkkelposisjoner. Denne høy grad av fleksibilitet med enkel konstruksjon gjør det mulig for prosjektering av nanoskala enheter i stand til å utføre svært varierte komplekse oppgaver i et biologisk relevant miljø.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Forfatterne ønsker å takke S. Douglas for ekstremt verdifulle diskusjoner og råd, og alle medlemmene av Bachelet lab for nyttige diskusjoner og arbeid. Dette arbeidet er støttet med tilskudd fra Fakultet for biovitenskap og Institute of Nanoteknologi og avanserte materialer ved Bar-Ilan-universitetet.

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics