Pieghevole e caratterizzazione di un robot bio-reattiva da origami di DNA

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Il nanorobot DNA è un dispositivo nanometrico cava esagonale, progettato per aprire in risposta a stimoli specifici e presentare merci sequestrate all'interno. Entrambi gli stimoli e le merci possono essere personalizzati in base alle esigenze specifiche. Qui si descrive il protocollo di fabbricazione nanorobot DNA, con l'uso della tecnica origami di DNA. Il procedimento inizia miscelando brevi graffette DNA filamenti singoli, in una miscela di magazzino che viene poi inserito in un lungo, circolare, scaffold DNA a singolo filamento in presenza di un buffer di piegatura. Un cycler termico standard viene programmato per ridurre gradualmente la temperatura di reazione di miscelazione per facilitare la ricottura graffette da ponteggio, che è la forza guida dietro la piegatura della nanorobot. Una volta che la reazione di piegatura 60 hr è completa, graffette eccesso vengono eliminati utilizzando un filtro centrifugo, seguita da visualizzazione tramite elettroforesi in gel di agarosio-(AGE). Infine, successo fabbricazione del nanorobot viene verificata mediante microscopia elettronica a trasmissione (TEM),con l'uso di uranile-formiato come colorazione negativa.

Introduction

Gli usi per gli acidi nucleici nanotecnologie sono sbalorditivi. La trattabilità della base Watson-Crick accoppiamento nonché la facilità e relativo basso costo della sintesi su larga scala di oligo misura 2 ha generato un'esplosione di applicazioni 3 e ricerca nel campo delle nanotecnologie DNA. Nanotecnologie DNA strutturale, basato sul immobile 4,5 giunzione Seeman come un elemento fondamentale fa uso di DNA come unità elementare auto-assemblaggio per la costruzione di forme arbitrarie 6-8.

Il recente sviluppo del DNA ponteggi origami 9 tecnica permette per la costruzione di complessi 2D / 3D nano-architetture 10-12 con precisione sub-nanometrica ed è un percorso efficace per la costruzione di nuovi oggetti funzionali con l'aumentare della complessità e la diversità sorprendente. Il processo di costruzione si basa su un DNA a singolo filamento lungo scaffold, di solito derivato da un genom viralee che può essere piegato attraverso l'ibridazione di centinaia di singoli brevi oligo filamento di DNA definito graffette. La risoluzione strutturale elevato ottenuto con questa tecnica è la diretta conseguenza delle dimensioni naturali del DNA a doppia elica, mentre la riproducibilità della fabbricazione è il risultato della modulazione dei brevi sequenze singolo filamento fiocco per facilitare la massima complementarità idrogeno-bonding realizzabile. Con l'uso di una temperatura di ricottura lenta rampa la creazione più bassa energia, termodinamicamente nanostruttura preferito è raggiunto in alte rese e fedeltà. La semplice applicazione di regole di progettazione di giunzione in un codice di calcolo ha permesso lo sviluppo di strumenti CAD, come caDNAno 13, che semplifica molto il compito di progettare grandi strutture complesse che contengono centinaia di incroci collegati.

Precedentemente abbiamo descritto la progettazione di un nanorobot DNA con l'ausilio dello strumento 14,15 caDNAno. Qui ci raffiguriamo la fabbricazione evisualizzazione, tramite microscopia elettronica a trasmissione (TEM), del nanorobot, una cavità nanodevice esagonale 3D, con dimensioni di 35 x 35 x 50 nm 3, destinato a subire un cambiamento conformazionale in risposta a determinati stimoli predeterminati e presenti carico specifico, tale come proteine ​​o oligonucleotidi di acidi nucleici, sequestrati all'interno. Mentre 12 stazioni di carico sono disponibili all'interno del telaio cavità, il numero effettivo di carico legato differisce a carico di formato. Molecole cargo vanno da piccole molecole di DNA di enzimi, anticorpi e 5-10 nanoparticelle d'oro nm. Cargocan essere sia uniforme o eterogenea, tale che ogni nanorobot contiene una miscela di diverse molecole. Rilevamento avviene tramite due porte a doppia elica disegno di bloccaggio per rilevare proteine, acidi nucleici o altre sostanze chimiche, basato sia su aptasensor 16,17 o filamento di DNA spostamento 18 tecnologie. I recenti sviluppi in aptamer protocolli di selezione 19-21 consentono la progettazione di nanorobot risponderead una gamma sempre crescente di molecole e tipi di cellule.

Lavoro precedenza ha mostrato un nanorobot trasportano un anticorpo specifico, che in seguito al legame al suo antigene può trasmettere sia un inibitore o un segnale prolifica all'interno di specifici tipi cellulari in una popolazione cellulare mista 15. Una caratteristica interessante di questi nanodispositivi è la loro capacità di svolgere compiti ancora più complessi e controllo logico con l'introduzione di diversi sottotipi nanorobot in una singola popolazione. Recentemente abbiamo dimostrato specifici sottotipi di nanorobot che effettuano sia come regolatori positivi o negativi, che controlla una popolazione effettori contenente un carico molecola attiva 22.

Il protocollo presentato qui descritta la realizzazione, la purificazione e l'imaging di un nanorobot gated con sequenze sensori aptameri che si legano selettivamente al PDGF per facilitare l'apertura del nanorobot 15,22. Il processo di fabbricazione descritto è simile al nprocesso di fabbricazione anorobot inizialmente descritto da Douglas et al. 15 con modifiche volte a ridurre la durata complessiva dei processi, aumentando i tassi di rendimento e purificazione.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Preparazione di Staples Pool Miscela

  1. Ordinare liofilizzato DNA graffette nanorobot su piastre da 96 pozzetti come elencato nella tabella 1 (vedi Materiali) e normalizzare a 10 nmol. Per una descrizione dettagliata della progettazione e architettura del nanorobot DNA vedere Ben-Ishay et al. 14 e Douglas et al. 15).
  2. Ricostituire ogni fiocco bene con DNasi / ultrapuro RNasi-free a una concentrazione di 100 micron. Per punti normalizzati a 10 nmol, ricostituire con 100 ml di acqua ultrapura.
  3. Pool insieme 20 ml di ogni fiocco usando una pipetta multicanale e di una sterile, 55 ml di soluzione di bacino.
    Nota: Poiché la forma nanorobot è composto di 254 filamenti fiocco (compresi core, Bordi, maniglie e sequenze Guide, Tabella 1), la concentrazione di ciascuno dei punti in piscina Staples è 394 nm. Rimozione di graffette da piscina fiocco, o l'aggiunta di un po 'diverso a volUmes, può ridurre notevolmente la resa, o comunque provocare aggregati spiegate.

2. Preparazione di Fabrication Reaction Miscela

  1. Per una miscela di reazione standard di utilizzare 40 ml di M13mp18 virale genoma circolare singolo filamento di DNA, corrispondenti a 4 pmol di ponteggio DNA (100 nM soluzione madre, vedi Materiali). Concentrazione finale del ponteggio nella miscela fabbricazione è di 20 nm, volume finale di 200 ml.
    1. Regolare la quantità di DNA patibolo in base alle esigenze specifiche; tuttavia, mantenere la concentrazione finale di scaffold DNA nella miscela di reazione ad una costante di 20 nM.
  2. Aggiungere punti per raggiungere un ponteggio di graffette rapporto di 1 a 10, rispettivamente. Per una concentrazione di 20 nM impalcatura di DNA, ciascuna delle concentrazione finale dei 254 punti "è di 200 nm. Per un volume di reazione finale microlitri 200 aggiungere 102 ml di miscela Staples piscina (punto 1.2).
    1. Aggiungi specifiche sequenze di cancelli separatamente the miscela di reazione pieghevole in questo momento. Questi oligo sono ordinati separatamente e richiedono purificazione HPLC. Assicurarsi che oligo gate sono presenti in 1:10 scaffold Gate rapporto sequenza, cioè 200 nM di ciascun oligo di 20 nM concentrazione ponteggio. Per un volume di reazione di piegatura 200 microlitri, aggiungere 0,4 ml per ciascuna delle quattro oligo Gate a una concentrazione di 100 mM magazzino.
  3. Aggiungere 10x TAE magazzino tampone per raggiungere una concentrazione finale di 1x TAE (40 mM Tris-acetato, 1 mM EDTA). Per un volume di reazione pieghevole 200 ml, aggiungere 20 ml di 10x TAE.
  4. Aggiungere 1 M MgCl 2 ad una concentrazione finale di 10 mM. Per un volume di reazione di piegatura 200 microlitri, aggiungere 2 ml di 1 M MgCl 2.
  5. Aggiungere 36 ml di DNasi / RNasi acqua ultrapura gratuito per un raggiungere un volume finale di 200 ml.
  6. Campioni Vortex e un'aliquota di 100 microlitri in fiale per PCR.
    Nota: consultare le specifiche termociclatore per quanto riguarda i volumi massimi di reazione da utilizzare.Riducendo il volume di rispettare tali limiti non ridurrà le rese ottenute. Volumi di reazione al di sopra del massimo specificato metterà in pericolo le rese.

3. temperatura di ricottura Rampa di Fabrication Reazione

  1. Programma termociclatore come segue:
    1. Rampa 85 ° C a 60 ° C ad una velocità di 5 min / ° C.
    2. Rampa 60 ° C a 4 ° C ad una velocità di 75 min / ° C.
    3. Mantenere a 4 ° C indefinitamente.
  2. Dopo la fabbricazione è finita conservare i campioni a -20 ° C.

4. Rimozione di Staples in eccesso

  1. Aggiungere 100 pl di miscela di reazione di piegatura ad un filtro centrifugo 0,5 ml con MWCO di 100 kDa. Salvare un campione di 10 ml di nanorobot pre-purificazione per un'analisi successiva.
  2. Centrifugare per 10 minuti a 9.600 x g.
  3. Aggiungere 400 ml di tampone pieghevole (1x TAE, 10 mM MgCl 2).
  4. Ripetere i punti 4.2 e 4.3 per altre due volte.
  5. Centrifugare per 5 min a 9.600 x g.
  6. Recupero il concentrato posizionando il filtro capovolto in una provetta pulita e centrifugare per 1 min a 9.600 x g. Volumi finali possono variare a seconda del volume iniziale della miscela di reazione fabbricazione che è stato messo nel filtro. Tipicamente si ottiene un volume finale 25-60 microlitri di campione nanorobot concentrato.
  7. Misurare la concentrazione di DNA nei campioni tramite spettrofotometro a 260 nm. Utilizzare peso molecolare di 5,3 mg / pmol quando calcolare le concentrazioni molari dei campioni nanorobot.
    Nota: Il coefficiente di estinzione molare per dsDNA, 50 ug / OD 260, è sufficiente per la maggior parte delle applicazioni. 48 mcg / OD 260 tiene conto della timina poli ssDNA estende ai bordi graffette.

5. Gel di Agarosio Analisi di Folded Nanorobots

  1. Preparazione di 0,5x TBE (45 mM Tris-borato, EDTA 1 mM), 2% gel di agarosio integrato con 10 mM MgCl 2 et al. 21):
    1. Preparare tampone TBE 0.5x diluendo 6,25 ml di 10x TBE buffer in magazzino 118.75 ml di DDH 2 O.
    2. Sciogliere 2.5 g di agarosio in 125 ml di tampone TBE 0.5x.
    3. Far bollire in forno a microonde fino agarosio è completamente sciolto.
    4. Aggiungere 1,25 ml di 1 M MgCl 2 alla concentrazione finale di 10 mM.
    5. Aggiungere 7 ml di 10 mg / ml di bromuro di etidio.
    6. Attendere che la soluzione per un po 'freddo e riempire il vassoio gel prima si solidifica gel agarosio. Installa subito pettine desiderato.
    7. Preparare 1 L 0,5x TBE tampone di corsa con l'aggiunta di 50 ml di 10x TBE scorta regolatrice e 10 ml di 1 M MgCl 2-940 ml di DDH 2 O.
    8. Una volta gel è add solido tampone di corsa al dispositivo elettroforesi e mettere dispositivo in un bagno di ghiaccio.
  2. Carico 1 mg DNA totale del nanorobot pre-purificazione (punto 3.2), e la purificazione posta (punto 4.7), a fianco di un ponteggioCampione di DNA e un marcatore DNA 1 kb, sul gel. Un esempio è riportato nella figura 2. Volumi di campioni effettivi dipendono dalle concentrazioni ottenute dopo purificazione. Ogni campione è caricato con tampone di caricamento in un rapporto 1: volume 6 finale.
  3. Impostare fonte di alimentazione a 80 V e correre il gel per 3 ore. Eseguire il gel in un bagno riempito con acqua e ghiaccio. Nanorobot spiegheranno e appaiono come una macchia se il gel si riscalda durante l'elettroforesi. Durante l'elettroforesi aggiungere ghiaccio supplementare per mantenere dispositivo da riscaldamento.
  4. Vista gel su un tavolo UV (Figura 2).

6. Macchia negativo di nanorobot con uranile-formiato

  1. Preparazione di soluzione uranile-formiato 2% (adattato da Castro et al. 23):
    1. Pesare 100 mg di polvere di uranile-formiato in un tubo da 15 ml.
    2. Bollire DNase / RNase acqua ultrapura gratuito per 3 min per de-ossigenato.
    3. Aggiungere 5 ml di acqua calda deossigenata (~ 60 ° C)nel tubo 15 ml contenente la polvere uranile-formiato (dal passo precedente). Chiudere bene il coperchio, avvolgere in un foglio di alluminio e vortex rigorosamente per 10 min (tubo a fissare un vortice). Soluzione deve apparire torbido con un colore giallo.
    4. Filtro soluzione attraverso un 0,2 micron siringa fi ltro. Soluzione dovrebbe diventare trasparente.
    5. Aliquota 200 ml di soluzione in microprovette.
    6. Centrifugare alla massima velocità per 5 minuti in una centrifuga da tavolo per campioni piscina sul fondo della provetta.
  2. Caricamento di campione alla rete e colorazione negativa:
    1. Sbrinare un'aliquota di 200 ml di soluzione di uranile-formiato 2% (preparato nella sezione 6.1). Aggiungere 10 ml di soluzione 0,5 M di NaOH e vortex rigorosamente per 3 min. Centrifugare a massima velocità per 5 minuti con una centrifuga da tavolo.
    2. Nel frattempo, griglia glow-scarico con aria ambiente a 0,2 mbar e 25 mA per 30 sec.
    3. Aggiungere 15 ml di 2 nm campione nanorobot dopo la purificazione (sectisu 4.7) sul lato superiore della griglia (tenuto con una pinza) e lasciate assorbire per 1 min. Utilizzare carta ltro fi per drenare il liquido in eccesso ponendo la griglia sulla parte superiore della carta da filtro. Non toccare la superficie della griglia.
    4. Aggiungere 10 ml di uranile-formiato 2% (dal punto 6.2.1) sul lato superiore della griglia (tenuto con una pinza).
    5. Utilizzare rapidamente carta ltro fi per drenare il liquido in eccesso ponendo la griglia sulla parte superiore della carta da filtro. Non toccare la superficie della griglia.
    6. Ripetere i punti 6.2.4 e 6.2.5.
    7. Aggiungere 10 ml di uranile-formiato 2% (dal punto 6.2.1) sul lato superiore della griglia (tenuto con una pinza). Lasciate soluzione colorante assorbe per 30 sec.
    8. Utilizzare carta ltro fi per drenare il liquido in eccesso ponendo la griglia sulla parte superiore della carta da filtro. Non toccare la superficie della griglia.
    9. Lasciate che la griglia di asciugare completamente per almeno 30 minuti, a faccia in su una carta da filtro, prima di iniettare nel TEM.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Risultati rappresentativi sono mostrati nella Figura 2A. Tutte le corsie contengono 1 mg di DNA totale, misurata mediante spettrofotometro (OD 260). Rispetto al ponteggio circolare DNA a singolo filamento (corsia 2), nanorobots sono ostacolati nel gel causa del loro peso molecolare più elevato, il risultato di graffette ibridazione al DNA ponteggio (Lane 3. Red freccia). La banda basso peso molecolare a Lane 3 rappresenta graffette in eccesso che non si legano al DNA patibolo (freccia verde). Dopo la purificazione attraverso la filtrazione centrifuga la maggior parte dei punti in eccesso vengono rimosse (Lanes 4-6) ed i nanorobot sono pronti per essere caricato con molecole cargo coniugati alle maniglie filamento complementare 14,15,22. Lanes 4-6 contengono fasce ad alto peso molecolare che rappresentano dimeri nanorobot (freccia blu), una popolazione di nanorobot che sono legati insieme. Riducendo la concentrazione del ponteggio nella procedura di fabbricazione (a 5 o 10 nM) può potenzialmente reduCe la quantità relativa di queste strutture ad alto peso molecolare. Lanes 4-6 mostrano nanorobot post-depurazione con lievi variazioni al protocollo di purificazione descritto, vale a dire il volume iniziale di nanorobot fabbricati aggiunte al filtro rotativo (punto 4.1 corsia 4:. 50 ml; Corsia 5: 100 ml; Corsia 6: 100 microlitri), e il numero di volte che il buffer è stato aggiunto al filtro (Passo 4.4 Corsia 4: 2 volte; Corsia 5:. 2 volte; Corsia 6: 5 volte).

Il confronto dei risultati di rendimento e di depurazione tra le diverse varianti del protocollo (Figura 2C) mostrano che la riduzione del volume iniziale dei robot fabbricate caricate fino alla filtro centrifugo (punto 4.1) ha scarso effetto sui tassi di rendimento e purificazione. Inoltre, aumentando il numero di giri scambi tampone e centrifughe (passi 4.4) ha un'influenza marginale sulla purezza sulle nanorobots, riducendo considerevolmente il rendimento. Quindi il protocollo descritto, corrispondenti a 100 microlitrivolume iniziale e 2 aggiunte tampone (corsia 5), ​​è considerato ottimale.

Resa stime sono basate su spettrofotometro (OD 260) misure di ogni post-purificazione del campione e calcolati rispetto alla quantità inizialmente caricato in ciascun filtro centrifugo. La purificazione è basata sulla percentuale peso dei nanorobots dall'intero DNA nel campione, corrispondenti alle nanorobots e graffette in eccesso che non lavare durante la purificazione. Stime di purificazione sono calcolate per l'intensità relativa dei nanorobot (frecce rosse e blu e Figura 2A) a quello dei punti in eccesso (freccia verde in figura 2B). I relativi nanorobot / graffette intensità sono stati normalizzati con il campione pre-purificato (Lane 3), in cui il peso del DNA totale dei punti metallici (freccia verde) è ~ 4,5 volte quello dei nanorobot non purificati (freccia rossa), corrispondente a quella iniziale 10: 1 ponteggiorapporto molare punti nel protocollo di fabbricazione.

Validazione finale di integrità strutturale avviene tramite microscopia elettronica a trasmissione utilizzando 2% uranile-formiato come una macchia negativo. Foto sono presentati in Figura 3.

Figura 1
Figura 1: disegno schematico della nanorobot vista (A) laterale di un nanorobot chiuso.. Porta doppia elica, prodotto da una sequenza aptamero e un filamento complementare, è indicata da una freccia verde. (B) Vista frontale di un nanorobot chiuso mostrando proteine ​​cargo legato dentro. (C) Sezione schemi di nanorobot chiuso prodotta. Maniglie punti metallici sono evidenziati da una freccia rossa. Cerchi verdi indicano eliche che contengono una cerniera su un lato e una sequenza cancello sul lato opposto. (D) Blueprints diun nanorobot in vista laterale. Le maniglie sono indicati da frecce rosse. Porta sequenze sono indicati da frecce verdi. Cliccate qui per vedere una versione più grande di questa figura.

Figura 2
Figura 2:. Agarose risultati elettroforesi su gel (A) Corsia 1: 1kb Marker. Corsia 2: M13mp18 circolare impalcatura a singolo filamento. Corsia 3: nanorobot pre-purificazione. Lanes 4-6: nanorobot inviare purificazioni. Corsia 4: 50 ml di volume iniziale; 2 aggiunte tampone. Corsia 5: 100 ml di volume iniziale; 2 aggiunte tampone. Corsia 6: 100 ml di volume iniziale; 5 aggiunte tampone. Graffette in eccesso sono indicati da una freccia verde nanorobot Fabricated sono indicate da una freccia rossa. Freccia blu indica dimeri nanorobot. (B) vista 3D dell'intensità relativa delle bande nel agarosiogel. (C) la resa e purificazione stime.

Figura 3
Figura 3: TEM foto di nanorobot DNA prelevati da più FABRICATIONS / procedure di colorazione.

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> Nucleo 141 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
Numero Designazione Sequenza
1 Nucleo AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
2 Nucleo GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 Nucleo TACGATATAGATAATCGAACAACA
4 Nucleo CTTTTGCTTAAGCAATAAAGCGAGTAGA
5 Nucleo GTCTGAAATAACATCGGTACGGCCGCGCACGG
6 Nucleo GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 Nucleo AAAATCACCGGAAGCAAACTCTGTAGCT
8 Nucleo CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 Nucleo CATGTAAAAAGGTAAAGTAATAAGAACG
10 Nucleo ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
11 Nucleo ATAGTCGTCTTTTGCGGTAATGCC
12 Nucleo AGTCATGGTCATAGCTGAACTCACTGCCAGT
13 Nucleo AACTATTGACGGAAATTTGAGGGAATATAAA
14 Nucleo ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
15 Nucleo AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
16 Nucleo GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
17 Nucleo GCACCGCGACGACGCTAATGAACAGCTG
18 Nucleo AACTTCATTTTAGAATCGCAAATC
19 Nucleo CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
20 Nucleo CCAATCAAAGGCTTATCCGGTTGCTATT
21 Nucleo AGAGGCGATATAATCCTGATTCATCATA
22 Nucleo CCGTAATCCCTGAATAATAACGGAATACTACG
23 Nucleo AAATGGTATACAGGGCAAGGAAATC
24 Nucleo TCCTCATCGTAACCAAGACCGACA
25 Nucleo CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
26 Nucleo ACCCGCCCAATCATTCCTCTGTCC
27 Nucleo CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
28 Nucleo CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
29 Nucleo TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
30 Nucleo
31 Nucleo AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
32 Nucleo ACATTCAGATAGCGTCCAATATTCAGAA
33 Nucleo AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
34 Nucleo GAGATGACCCTAATGCCAGGCTATTTTT
35 Nucleo TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
36 Nucleo GCCGAAAAATCTAAAGCCAATCAAGGAAATA
37 Nucleo AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
38 Nucleo ACCAATCGATTAAATTGCGCCATTATTA d>
39 Nucleo ATCTTACTTATTTTCAGCGCCGACAGGATTCA
40 Nucleo CCCTAAAAGAACCCAGTCACA
41 Nucleo GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
42 Nucleo CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
43 Nucleo TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
44 Nucleo TTCCTTATAGCAAGCAAATCAAATTTTA
45 Nucleo ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
46 Nucleo AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
48 Nucleo TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 Nucleo AAAGAAACAAGAGAAGATCCGGCT
50 Nucleo TTGAGGGTTCTGGTCAGGCTGTATAAGC
51 Nucleo TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
52 Nucleo ACGAGCGCCCAATCCAAATAAAATTGAGCACC
53 Nucleo AATAAGTCGAAGCCCAATAATTATTTATTCTT
54 Nucleo ACGAAATATCATAGATTAAGAAACAATGGAACTGA
55 Nucleo TTTCATAGTTGTACCGTAACACTGGGGTTTT
56 Nucleo AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
57 Nucleo CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
58 Nucleo TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 Nucleo ATAACGCAATAGTAAAATGTTTAAATCA
60 Nucleo ACGAATCAACCTTCATCTTATACCGAGG
61 Nucleo TAATGGTTTGAAATACGCCAA
62 Nucleo CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
63 Nucleo ATTAAAGGTGAATTATCAAAGGGCACCACGG
64 GGCAACCCATAGCGTAAGCAGCGACCATTAA
65 Nucleo AGAAACGTAAGCAGCCACAAGGAAACGATCTT
66 Nucleo AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 Nucleo GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
68 Nucleo TTTTAGAACATCCAATAAATCCAATAAC
69 Nucleo AAATGTGGTAGATGGCCCGCTTGGGCGC
70 Nucleo ACGGATCGTCACCCTCACGATCTAGAATTTT
71 Nucleo CGCCATAAGACGACGACAATAGCTGTCT
72 Nucleo GCGTATTAGTCTTTAATCGTAAGAATTTACUN
73 Nucleo AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
74 Nucleo AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
75 Nucleo TAATTTAGAACGCGAGGCGTTAAGCCTT
76 Nucleo ACCAGGCGTGCATCATTAATTTTTTCAC
77 Nucleo CAGCCTGACGACAGATGTCGCCTGAAAT
78 Nucleo ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 Nucleo CTCGAATGCTCACTGGCGCAT
80 Nucleo GGGCAGTCACGACGTTGAATAATTAACAACC
81 Nucleo
82 Nucleo TCAACCCTCAGCGCCGAATATATTAAGAATA
83 Nucleo ATTATACGTGATAATACACATTATCATATCAGAGA
84 Nucleo GCAAATCTGCAACAGGAAAAATTGC
85 Nucleo ATAATTACTAGAAATTCTTAC
86 Nucleo TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 Nucleo AAGTAGGGTTAACGCGCTGCCAGCTGCA
88 Nucleo CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 Nucleo TGGCGAAGTTGGGACTTTCCG
90 CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
91 Nucleo AAATCAAAGAGAATAACATAACTGAACACAGT
92 Nucleo CTGTATGACAACTAGTGTCGA
93 Nucleo ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
94 Nucleo TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
95 Nucleo ATAAGAATAAACACCGCTCAA
96 Nucleo CGTTGTAATTCACCTTCTGACAAGTATTTTAA
97 Nucleo AACCGCCTCATAATTCGGCATAGCAGCA
98 Nucleo AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
99 Nucleo CAGTATAGCCTGTTTATCAACCCCATCC
100 Nucleo TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
101 Nucleo CGTCGGAAATGGGACCTGTCGGGGGAGA
102 Nucleo AAGAAACTAGAAGATTGCGCAACTAGGG
103 Nucleo CCAGAACCTGGCTCATTATACAATTACG
104 Nucleo ACGGGTAATAAATTAAGGAATTGCGAATAGTA
105 Nucleo CCACGCTGGCCGATTCAAACTATCGGCCCGCT
106 Nucleo GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
107 CAGCATTAAAGACAACCGTCAAAAATCA
108 Nucleo ACATCGGAAATTATTTGCACGTAAAAGT
109 Nucleo CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
110 Nucleo AAATCGTACAGTACATAAATCAGATGAA
111 Nucleo TTAACACACAGGAACACTTGCCTGAGTATTTG
112 Nucleo AGGCATAAGAAGTTTTGCCAGACCCTGA
113 Nucleo GACGACATTCACCAGAGATTAAAGCCTATTAACCA
114 Nucleo AGCTGCTCGTTAATAAAACGAGAATACC
115 Nucleo CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
116 Nucleo CACCCTCTAATTAGCGTTTGCTACATAC
117 Nucleo GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
118 Nucleo GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 Nucleo ATGAAACAATTGAGAAGGAAACCGAGGATAGA
120 Nucleo GGATGTGAAATTGTTATGGGGTGCACAGTAT
121 Nucleo GGCTTGCGACGTTGGGAAGAACAGATAC
122 Nucleo TAAATGCCTACTAATAGTAGTTTTCATT
123 Nucleo TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
124 Nucleo TGACCATAGCAAAAGGGAGAACAAC
125 Nucleo CGAGCCAGACGTTAATAATTTGTATCA
126 Nucleo GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 Nucleo AGACGCTACATCAAGAAAACACTTTGAA
128 Nucleo AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 Nucleo GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
130 Nucleo GGTATTAAGGAATCATTACCGAACGCTA
131 Nucleo GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
132 Nucleo
133 Nucleo ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
134 Nucleo AACGAGATCAGGATTAGAGAGCTTAATT
135 Nucleo TACCAAGTTATACTTCTGAATCACCAGA
136 Nucleo CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 Nucleo AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
138 Nucleo TTTCAACCAAGGCAAAGAATTTAGATAC
139 Nucleo TTGAAATTAAGATAGCTTAACTAT
140 Nucleo CTATTATCGAGCTTCAAAGCGTATGCAA
Nucleo CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
142 Nucleo GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 Nucleo CGAACGTTAACCACCACACCCCCAGAATTGAG
144 Nucleo GTGTGATAAATAAGTGAGAAT
145 Nucleo GCTATATAGCATTAACCCTCAGAGA
146 Nucleo AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 Nucleo CGGCCTCCAGCCAGAGGGCGAGCCCCAA
148 Nucleo CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 Nucleo
150 Nucleo ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
151 Nucleo ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
152 Nucleo TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
153 Nucleo AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
154 Bordo TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
155 Bordo TTTTTTTTTTTTTTTTAATAAGAGAATA
156 Bordo TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 Bordo
158 Bordo TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 Bordo TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
160 Bordo TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
161 Bordo TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
162 Bordo TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
163 Bordo TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
164 Bordo TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
165 Bordo TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
166 Bordo TTTTTTTTTTTTTTTACCGGATATTCA
167 Bordo TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
168 Bordo TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 Bordo CTGAGAGAGTTGTTTTTTTTTTTTTTT
170 Bordo CAATGACAACAACCATTTTTTTTTTTTTTTT
171 Bordo TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
172 Bordo TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 Bordo
174 Bordo TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
175 Bordo TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
176 Bordo TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 Bordo CCACACAACATACGTTTTTTTTTTTTT
178 Bordo TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 Bordo TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
180 Bordo TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 Bordo TTTTTTTTTTTTTTTACGGCGGAT
182 Bordo TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 Bordo TTTTTTTTTTTTTTTACGATTGGCCTTGATA
184 Bordo TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 Bordo TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
186 Bordo TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 Bordo TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 Bordo ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 Bordo
190 Bordo TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
191 Bordo GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
192 Bordo GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 Bordo ATAACGTGCTTTTTTTTTTTTTTTTTT
194 Bordo TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
195 Bordo TTTTTTTTTTTTTTTACAAAATAAACA
196 Bordo TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 Bordo
198 Bordo TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 Bordo GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
200 Bordo TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
201 Bordo CACTAAAACACTTTTTTTTTTTTTTTT
202 Bordo TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
203 Bordo TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
204 Bordo TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
205 Bordo TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
206 Bordo TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
207 Bordo CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
208 Bordo TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
209 Bordo AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
210 Bordo ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
211 Bordo TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
212 Bordo TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
213 CAGAACAATATTTTTTTTTTTTTTTTT
214 Bordo TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
215 Bordo TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
216 Bordo TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
217 Bordo TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
218 Bordo TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 Bordo AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
220 Bordo CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
221 TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
222 Bordo TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
223 Bordo TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
224 Bordo TTTTTTTTTTTTTTTCGCCCACGCATAACCG
225 Bordo AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
226 Bordo CAAGTTTTTTGGTTTTTTTTTTTTTTT
227 Bordo TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
228 Bordo TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 Bordo TTTTTTTTTTTTTCATCTTTGACCC
230 Bordo TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
231 Bordo GATACAGGAGTGTACTTTTTTTTTTTTTTTT
232 Bordo TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
233 Bordo GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
234 Bordo TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
235 Bordo TTTTTTTTTTTTTTTATAGCAATAGCT
236 Maniglie AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 Maniglie ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
238 Maniglie CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 Maniglie CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
240 Maniglie CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
241 Maniglie CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
242 Maniglie AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 Maniglie CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
244 Maniglie CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
245 Maniglie TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
246 Maniglie AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 Maniglie GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
248 Guide AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 Guide ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
250 Guide CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
251 Guide GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
252 Guide AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
253 Guide TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
254 Guide TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
255 Guide di rimozione GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
256 Guide di rimozione GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 Guide di rimozione TAAAACACCGTACTTTAGAACTAAATTGCTACG
258 Guide di rimozione AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 Guide di rimozione CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
260 Guides rimozione GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
261 Guide di rimozione ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
262 Gates Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
263 Gates Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
264 Gates GATE0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
265 Gates Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

Tabella 1: Elenco di sequenze sinteticheusato per costruire la nanorobot. Staples 1-153 sono designati Core e costituiscono la maggior parte della struttura. Staples 154-235 sono indicati bordi e sono situati in ciascuna delle estremità delle eliche 61 della struttura. Graffette bordo contengono una coda timina poli progettato per evitare l'aggregazione di nanorobot. Staples 236-247 sono indicati Maniglie e portare i siti di attracco cargo. Maniglie graffette hanno una regione sequenza univoca, collegandole alla loro posizione specifica della struttura, ed una regione sequenza consenso che viene utilizzata come aggancio per le molecole sito cargo. Staples 248-254 sono indicati Guide e collegare le due metà del dispositivo durante il processo di ricottura. Dopo la fabbricazione delle Guide vengono rimossi con l'aggiunta di Guida graffette rimozione 255-261 (punto 6), lasciando il dispositivo bloccato dai due sensori del nanorobot. Le sequenze dei sensori sono designati Gates. Ciascuno dei due sensori è costituito da un aptamero PDGF e un filamento complementare. Per fornire i chiarimenti più dettagliatanazione vedere Ben Ishay et al. 14 e Douglas et al. 15. Staples sono ordinate in commercio in tre piastre da 96 pozzetti (in basso rotondo profondo). Ogni importo fiocco è normalizzata a 10 nmol. Eccetto per le sequenze cancello, che richiedono purificazione HPLC, graffette non richiedono una speciale procedura di purificazione.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Abbiamo descritto la fabbricazione, la purificazione, e visualizzazione del nanorobot DNA. Dopo la fabbricazione del telaio esagonale del dispositivo, la funzione del nanorobot è programmato con la semplice introduzione di carico specifico e fili di rilevamento al robot che facilmente trovare la posizione designata causa idrogeno-bonding complementarità con siti di aggancio disponibile singolo filamento 14 , 15,22.

Il protocollo di fabbricazione descritto utilizza una rampa di ricottura lento, che viene generalmente utilizzato nel nostro laboratorio per piegare una vasta gamma di forme di origami. Se il tempo di produzione diventa un fattore chiave altri protocolli, quali il protocollo di piegatura rapida descritto da Sobczak et al. 24 può essere utilizzato. Questo protocollo è segnalato per realizzare origami pieghevole in alte rese, tuttavia richiede la calibrazione per ogni forma di origami.

Filtrazione Spin è usato per purificare i robot da graffette in eccesso. Quando si carica la sperno colonna con campioni o tampone, si deve prestare attenzione a non danneggiare la membrana con la punta della pipetta. La membrana può potenzialmente rompersi con conseguente resa drammaticamente ridotti. Si consiglia di non gettare il flusso continuo fino a quando i nanorobot sono visualizzati in base all'età.

Per alcune applicazioni è desiderato un tasso più elevato di purificazione; ciò può essere ottenuto ripetendo la filtrazione utilizzando la colonna giro originale. Per ancora più elevata purezza, una nuova colonna spin può essere utilizzato, ma questo avrà un drammatico effetto negativo sui tassi di rendimento. Altri metodi per purificare il DNA origami strutture sono stati testati come escissione dal gel di agarosio successiva ad elettroforesi e dialisi di graffette eccesso. Questi metodi hanno comportato sia scarsa resa o tariffe di depurazione scarsa rispetto al protocollo. Altri metodi, quali la depurazione a base di PEG 25 e tasso bizonale ultracentrifugazione 26 non sono stati testati. Questi metodi sono segnalati per achieve alti tassi di depurazione, tuttavia essi sia risultato in scarsa resa (tasso-zonale ultracentrifugazione) o richiedere precipitazioni (base-PEG), che può potenzialmente danneggiare la forma nanorobot cava.

Nanorobot sono fabbricati con le graffette Guida che bloccano la forma in posizione di chiusura al fine di aumentare yeilds fabbricazione 15. È importante rimuovere questi punti aggiungendo Guida graffette rimozione per nanorobots efficacemente aprono in risposta agli stimoli progettati (PDGF nel protocollo descritto). Graffette Guida sono progettati con una sola regione filo appiglio per l'attracco di Guida graffette rimozione che rilasciano le graffette Guida attraverso un processo di spostamento filo 18 .Questi punti devono essere aggiunti in un rapporto di 10: 1 molare alla fine della purificazione di eccesso fase graffette '(passo 4.7) e incubate per 2 ore a temperatura ambiente su una estremità sopra fine shaker.

Visualizzazione da TEM è stato descritto, including uranile-formiato 2% colorazione negativa. Rispetto uranile acetato, formiato di uranile-produce strutture grana più fine, che consentono una migliore risoluzione di origami di DNA. Si deve prestare attenzione come uranile-formiato si solidificherà se aliquote sono congelati per lunghi periodi di tempo. Si consiglia di utilizzare una soluzione uranile-formiato appena preparata 2% per la colorazione. Risoluzioni migliori sono ottenibili con l'uso di Cryo-TEM 27.

La progettazione e la realizzazione del protocollo di architettura di base del nanorobot DNA sono in ultima analisi, uniforme e semplice. Tuttavia, una vasta gamma di flessibilità è offerto in forma di miscele di carico specifici e trefoli rilevamento. Inoltre, in una singola popolazione molti sottotipi possono essere introdotti e la loro relativa stechiometria programmati e ottimizzati per soddisfare esigenze specifiche. Ancora maggiore la messa a punto della cinetica specifici a ciascun fattore limitante è realizzabile con l'aumento / riduzione della lunghezza della doppia ibridazione filamento o ilintroduzione di disallineamenti in posizioni chiave specifiche. Questo elevato livello di flessibilità con la facilità di costruzione permette per la progettazione di dispositivi su scala nanometrica in grado di svolgere compiti complessi molto vari in un ambiente biologico rilevante.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Gli autori desiderano ringraziare S. Douglas per le discussioni di grande valore e consigli, e tutti i membri del laboratorio Bachelet per utili discussioni e lavoro. Questo lavoro è sostenuto da finanziamenti della Facoltà di Scienze della Vita e Istituto di Nanotecnologie e Materiali Avanzati alla Bar-Ilan University.

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics