Plegable y caracterización de un Robot Bio-sensible de ADN Origami

Chemistry
 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

El nanorobot de ADN es un dispositivo nanométrico hexagonal hueco, diseñado para abrirse en respuesta a estímulos específicos y presente de carga secuestradas en el interior. Ambos estímulos y carga se pueden adaptar según las necesidades específicas. Aquí se describe el protocolo de fabricación nanorobot de ADN, con el uso de la técnica de origami de ADN. El procedimiento se inicia mediante la mezcla de alimentos básicos de ADN de una sola hebra cortos en una mezcla de valores que se añade a una larga y circular, andamio ADN de una sola hebra en presencia de un tampón de plegado. Un ciclador térmico estándar de está programado para disminuir gradualmente la temperatura de reacción de mezcla para facilitar el recocido-grapas a andamio, que es la fuerza de guía detrás el plegado de la nanorobot. Una vez que la reacción de plegado 60 hr es completa, el exceso de grapas se descartan usando un filtro de centrífuga, seguido por visualización a través de electroforesis en gel de agarosa (AGE). Por último, la fabricación con éxito de la nanorobot es verificado por microscopía electrónica de transmisión (TEM),con el uso de uranilo-formiato como tinción negativa.

Introduction

Los usos de los ácidos nucleicos de la nanotecnología son asombrosos. La maleabilidad de la base de emparejamiento Watson-Crick, así como la facilidad y bajo costo relativo de la síntesis a gran escala de oligonucleótidos medida 2 ha generado una explosión de aplicaciones 3 y la investigación en el campo de la nanotecnología de ADN. Nanotecnología de ADN estructural, basado en el 4,5 unión Seeman inmóvil como un bloque de construcción fundamental hace uso de ADN como una unidad elemental auto-montaje para la construcción de formas arbitrarias 6-8.

El reciente desarrollo de la DNA andamiaje origami 9 técnica permite la construcción de complejos 2D / 3D nano-arquitecturas de 10-12 con una precisión sub-nanométrica y es una vía eficaz para la construcción de nuevos objetos funcionales con el aumento de la complejidad y la diversidad asombrosa. El proceso de construcción se basa en un ADN monocatenario largo andamio, por lo general deriva de una genom virale, que se puede plegar a través de la hibridación de cientos de oligos cortos cadena de ADN individuales denomina grapas. La alta resolución estructural obtenida por esta técnica es el resultado directo de las dimensiones naturales de la doble hélice del ADN, mientras que la reproducibilidad de la fabricación es el resultado de la adaptación de las secuencias cortas de grapas de una sola hebra para facilitar la complementariedad máxima de enlaces de hidrógeno alcanzable. Con el uso de una temperatura de recocido rampa lenta la más baja energía diseñado, termodinámicamente preferido nanoestructura se alcanza en altos rendimientos y fidelidad. La fácil aplicación de las reglas de diseño de unión en un código informático permitió el desarrollo de herramientas CAD, como caDNAno 13, que muy a simplificar la tarea de diseñar estructuras grandes y complejas que contienen cientos de uniones conectadas.

Anteriormente hemos descrito el diseño de un nanorobot de ADN con la ayuda de la herramienta de 14,15 caDNAno. Aquí representan la fabricación yvisualización, a través de microscopía electrónica de transmisión (TEM), de la nanorobot, un nanodispositivo hexagonal hueca 3D, con unas dimensiones de 35 x 35 x 50 nm 3, diseñado para sufrir un cambio conformacional importante en respuesta a un estímulo predeterminados y presente de carga específica, tales como proteínas o ácidos nucleicos oligos, secuestrado en el interior. Mientras que 12 estaciones de carga están disponibles dentro del chasis hueco, el número real de carga con destino diferente con el tamaño de la carga. Moléculas de carga van desde pequeñas moléculas de ADN a las enzimas, anticuerpos y 5-10 nanopartículas de oro nm. Cargocan o bien ser uniforme o heterogénea, de manera que cada nanorobot contiene una mezcla de diferentes moléculas. Sensing se logra a través de dos puertas de bloqueo doble diseño helicoidal para detectar proteínas, ácidos nucleicos u otros productos químicos, basado ya sea en aptasensor 16,17 o cadena de ADN desplazamiento 18 tecnologías. Los recientes desarrollos en protocolos de selección de aptámeros 19-21 permiten el diseño de nanorobots respondera una gama cada vez mayor de las moléculas y los tipos de células.

Un trabajo anterior mostró una nanorobot que lleva un anticuerpo específico, que tras la unión a su antígeno puede transmitir o bien un inhibidor o una señal prolífico en el interior de tipos específicos de células en una población de células mixtas 15. Una característica interesante de estos nanodispositivos es su capacidad para realizar aún más tareas complejas y el control de la lógica con la introducción de diferentes subtipos nanorobot en una sola población. Recientemente hemos demostrado subtipos específicos de nanorobots que realizan, ya sea como reguladores positivos o negativos, controlando una población efectora que contiene una molécula de carga activa 22.

El protocolo que se presenta aquí describe la fabricación, purificación y obtención de imágenes de un nanorobot cerrada con secuencias de sensores aptámero que se unen selectivamente a PDGF para facilitar la apertura de la nanorobot 15,22. El proceso de fabricación descrito es similar a la nproceso de fabricación anorobot representado inicialmente por Douglas et al. 15 con los cambios destinados a reducir la duración total del proceso, al tiempo que aumenta las tasas de rendimiento y purificación.

Protocol

1. Preparación de Grapas piscina Mezcla

  1. Solicitar liofilizado ADN grapas nanorobot en placas de 96 pocillos que se enumeran en la Tabla 1 (ver Materiales) y normalizar a 10 nmol. Para obtener una descripción detallada del diseño y la arquitectura del nanorobot de ADN ver Ben-Ishay et. Al 14 y Douglas et al. 15).
  2. Reconstituir cada grapa bien con DNasa / ultrapura RNasa libre a una concentración de 100 mM. Para grapas normalizaron a 10 nmol, reconstituir con 100 l de agua ultrapura.
  3. Piscina juntos 20 l de cada grapa utilizando una pipeta multicanal y 55 ml cuenca solución estéril.
    Nota: Dado que la forma nanorobot se compone de 254 capítulos básicos (incluyendo Core, Bordes, manijas y las secuencias de Guías, Tabla 1), la concentración de cada uno de los alimentos básicos en la piscina grapas es 394 nM. Extracción de grapas de la piscina de primera necesidad, o la adición de algunos en diferentes volumes, puede reducir considerablemente el rendimiento, o de otra manera dar lugar a agregados desplegadas.

2. Preparación de la Mezcla de Reacción Fabrication

  1. Para una mezcla de reacción estándar de utilizar 40 l de M13mp18 genoma viral circular sola cadena de ADN, correspondientes a 4 pmol de ADN andamio (solución 100 nM de valores, ver Materiales). La concentración final de andamio en la mezcla de fabricación es de 20 nm, un volumen final de 200 l.
    1. Ajuste la cantidad de ADN de andamio de acuerdo a las necesidades específicas; sin embargo, mantener la concentración final de ADN de andamio en la mezcla de reacción a una constante 20 nM.
  2. Añadir grapas para llegar a un andamio a la proporción de grapas de 1 a 10, respectivamente. Para una nM concentración de ADN andamio 20, cada uno de concentración final los 254 grapas 'es 200 nM. Para un volumen final de reacción l 200 añadir 102 l de la mezcla de alimentos básicos de la piscina (sección 1.2).
    1. Añadir secuencias específicas Gate separado a the mezcla de reacción de plegado en este momento. Estos oligonucleótidos se piden por separado y requieren purificación por HPLC. Asegúrese de que los oligos Gate están presentes en un uno y diez minutos andamio para Puerta relación de secuencia, es decir, 200 nM de cada oligo para una nM concentración andamio 20. Para un volumen de reacción de plegado 200 l, añadir 0,4 l para cada uno de los oligo de cuatro Gate en un stock de concentración 100 mM.
  3. Añadir 10x tampón TAE de stock para llegar a una concentración final de 1x TAE (40 mM Tris-Acetato, EDTA 1 mM). Para un volumen de reacción de plegado 200 l, añadir 20 l de 10x TAE.
  4. Añadir 1 M de MgCl 2 a una concentración final de 10 mM. Para un volumen de reacción plegable 200 l, añadir 2 l de 1 M de MgCl2.
  5. Añadir 36 l de DNasa / RNasa libre de agua ultrapura a un alcanzar un volumen final de 200 l.
  6. Muestras Vortex y alícuota de 100 l en viales de PCR.
    Nota: Consulte la especificación termociclador con respecto a los volúmenes de reacción máximos que se utilizarán.Reducir el volumen para cumplir con estos límites no reducirá los rendimientos obtenidos. Los volúmenes de reacción por encima del máximo especificado pongan en peligro los rendimientos.

3. Temperatura de recocido Rampa de Reacción Fabrication

  1. Termociclador Programa como sigue:
    1. Rampa 85 ° C a 60 ° C a una velocidad de 5 min / ° C.
    2. Rampa de 60 ° C a 4 ° C a una velocidad de 75 min / ° C.
    3. Mantenga a 4 ° C indefinidamente.
  2. Después de la fabricación ha terminado almacenar las muestras a -20 ° C.

4. La eliminación de exceso de grapas

  1. Añadir 100 l de mezcla de reacción de plegado a un filtro de centrífuga de 0,5 ml con un MWCO de 100 kDa. Guardar una muestra de 10 l de nanorobots pre-purificación para su posterior análisis.
  2. Centrifugar durante 10 min a 9600 x g.
  3. Añadir 400 l de tampón de plegamiento (1X TAE, 10 mM de MgCl 2).
  4. Repita los pasos 4,2 y 4,3 veces más.
  5. Centrifugar durante 5 min a 9600 x g.
  6. Recuperar el concentrado colocando el filtro al revés en un tubo de microcentrífuga limpio y centrifugado durante 1 min a 9600 x g. Volúmenes finales pueden variar dependiendo del volumen inicial de mezcla de reacción de fabricación que se puso en el filtro. Típicamente se obtiene un volumen final de 25-60 l de muestra nanorobot concentrado.
  7. Medir la concentración de ADN en las muestras a través de espectrofotómetro a 260 nm. Utilice el peso molecular de 5,3 mg / pmol en el cálculo de las concentraciones molares de muestras nanorobot.
    Nota: El coeficiente de extinción molar para dsDNA, 50 g / OD 260, es suficiente para la mayoría de las aplicaciones. 48 mg / OD 260 tiene en cuenta la timina poli ssDNA se extiende a las grapas bordes.

5. agarosa electroforesis en gel de Análisis de plegado Nanorobots

  1. Preparación de TBE 0,5x (45 mM Tris-borato, EDTA 1 mM), 2% en gel de agarosa suplementado con 10 mM de MgCl 2 et al 21.):
    1. Preparar tampón TBE 0,5x diluyendo 6,25 ml de 10x TBE reserva de estabilización en 118,75 ml de ddH 2 O.
    2. Disolver 2,5 g de agarosa en 125 ml de tampón TBE 0,5x.
    3. Hervir en el microondas hasta que la agarosa se disuelva completamente.
    4. Añadir 1,25 ml de 1 M de MgCl 2 a la concentración final de 10 mM.
    5. Añadir 7 l de 10 mg / ml de bromuro de etidio.
    6. Espere a que la solución a ligeramente fresco y llenar la bandeja de gel antes de que se solidifique el gel de agarosa. Instale peine deseado inmediatamente.
    7. Preparar 1 L TBE 0,5x tampón mediante la adición de 50 ml de 10x tampón TBE Stock y 10 ml de 1 M de MgCl 2 a 940 ml de ddH 2 O.
    8. Una vez gel es complemento sólido tampón al dispositivo de electroforesis y el dispositivo puesto en un baño de hielo.
  2. Cargar 1 g de ADN total de la nanorobots pre-depuración (paso 3.2), y la purificación posterior (paso 4.7), junto a un andamioMuestra de ADN y un marcador de ADN 1 kb, sobre el gel. Un ejemplo se da en la Figura 2. Volúmenes reales de muestras dependen de las concentraciones obtenidas después de la purificación. Cada muestras se carga con tampón de carga en una proporción de 1: volumen final 6.
  3. Ajuste la fuente de poder de 80 V y ejecutar gel durante 3 horas. Ejecutar el gel en un baño lleno de hielo y agua. Nanorobots se desarrollarán y aparecer como una mancha si el gel de agarosa se calienta durante la electroforesis. Durante la electroforesis agregue hielo adicional para mantener el dispositivo de calefacción.
  4. Ver gel sobre una mesa de UV (Figura 2).

6. tinción negativa de nanorobot con uranilo-formiato

  1. Preparación de solución madre-uranilo formiato 2% (adaptado de Castro et al 23.):
    1. Pesar 100 mg de polvo de formiato de uranilo en un tubo de 15 ml.
    2. Hervir DNasa / RNasa agua ultrapura gratuita por 3 minutos para des-oxigenado.
    3. Añadir 5 ml de agua caliente desoxigenada (~ 60 ° C)en el tubo de 15 ml que contiene el polvo de uranilo-formiato (del paso anterior). Cierre bien la tapa, envoltura en papel de aluminio y agitar rigurosamente durante 10 minutos (tubo sujetar a un vórtice). Solución debería aparecer turbia con un color amarillo.
    4. Filtrar la solución a través de una jeringa de 0,2 micras fi ltro. Solución debe quedado claro.
    5. Alícuota de 200 l de la solución en tubos de microcentrífuga.
    6. Centrifugar a máxima velocidad durante 5 minutos en una centrífuga de mesa a las muestras de la piscina en la parte inferior del tubo.
  2. La carga de la muestra a la red y tinción negativa:
    1. Descongelar una alícuota de 200 l de solución de uranilo-formiato 2% (preparado en la sección 6.1). Añadir 10 l de solución 0,5 M de NaOH y agitar rigurosamente durante 3 min. Centrifugar a máxima velocidad durante 5 minutos usando una centrífuga de mesa.
    2. Mientras tanto, la rejilla de descarga luminiscente usando aire de la habitación a 0,2 mbar y 25 mA durante 30 segundos.
    3. Añadir 15 l de 2 nM muestra nanorobot después de la purificación (SECTIen 4.7) en parte superior de la rejilla (celebrada con pinzas) y dejar absorber durante 1 min. Utilice papel de filtro para drenar el exceso de líquido mediante la colocación de la rejilla en la parte superior del papel de filtro. No toque la superficie de la rejilla.
    4. Añadir 10 l de la uranilo-formiato 2% (del paso 6.2.1) en la parte superior de la rejilla (celebrada con pinzas).
    5. Utilizar rápidamente papel de filtro para drenar el exceso de líquido mediante la colocación de la rejilla en la parte superior del papel de filtro. No toque la superficie de la rejilla.
    6. Repita los pasos 6.2.4 y 6.2.5.
    7. Añadir 10 l de la uranilo-formiato 2% (del paso 6.2.1) en la parte superior de la rejilla (celebrada con pinzas). Deje solución de tinción absorber durante 30 s.
    8. Utilice papel de filtro para drenar el exceso de líquido mediante la colocación de la rejilla en la parte superior del papel de filtro. No toque la superficie de la rejilla.
    9. Deje que la parrilla se seque por completo durante al menos 30 min, boca arriba sobre un papel de filtro, antes de la inyección en el TEM.

Representative Results

Los resultados representativos se muestran en la Figura 2A. Todos los carriles contienen 1 g de ADN total, medida a través de espectrofotómetro (OD 260). En comparación con el andamio de ADN de una sola hebra circular (carril 2), nanorobots se ven obstaculizados en el gel debido a su peso molecular más alto, el resultado de grapas hibridación con el ADN de andamio (Carril 3. Red flecha). La banda de bajo peso molecular en el carril 3 representa el exceso de alimentos básicos que no se unen al ADN andamio (flecha verde). Después de la purificación mediante filtración centrífuga mayor parte del exceso grapas se eliminan (carriles 4-6) y los nanorobots son listo para ser cargado con las moléculas conjugadas de carga a las asas cadena complementaria 14,15,22. Los carriles 4-6 contienen bandas de alto peso molecular que representan dímeros nanorobot (flecha azul), una población de nanorobots que están unidos. La reducción de la concentración del andamio en el procedimiento de fabricación (ya sea 5 o 10 nM) puede potencialmente reduce la cantidad relativa de estas estructuras de alto peso molecular. Carriles 4-6 muestran nanorobots post-purificación con ligeras variaciones en el protocolo de purificación descrito, es decir, el volumen inicial de nanorobots fabricados añaden al filtro de giro (Paso 4.1 Carril 4:. 50 l; Carril 5: 100 l; Carril 6: 100 l), y el número de veces que el tampón se añadió al filtro (Paso 4.4 Carril 4: 2 veces; carril 5:. 2 veces; Carril 6: 5 veces).

Comparación de los resultados de rendimiento y purificación entre las diferentes variaciones en el protocolo (Figura 2C) muestran que la reducción del volumen inicial de robots fabricados cargados hasta el filtro centrífugo (paso 4.1) tiene poco efecto sobre las tasas de rendimiento y purificación. Por otra parte, aumentar el número de cambios de tampón y giros centrífugas (pasos 4.4) tiene una influencia marginal sobre la pureza en los nanorobots, al tiempo que reduce considerablemente el rendimiento. Por lo tanto el protocolo descrito, correspondiente a 100 lvolumen inicial y 2 adiciones de amortiguamiento (carril 5), se considera óptimo.

Estimaciones de rendimiento se basan en espectrofotómetro (OD 260) mediciones de cada muestra de post-purificación y calculan en relación a la cantidad inicial cargada en cada filtro centrífugo. La purificación se basa en el porcentaje en peso de los nanorobots de todo el ADN en la muestra, que corresponde a los nanorobots y el exceso de grapas que no se lavan a cabo durante la purificación. Estimaciones de purificación se calculan a partir de la intensidad relativa de los nanorobots (flechas rojas y azules en la figura 2A) a la del exceso de grapas (flecha verde en la Figura 2B). Los nanorobots relativos / grapas intensidades se normalizaron con la muestra previamente purificado (carril 3), en la que el peso total del ADN de los alimentos básicos (flecha verde) es ~ 4,5 veces mayor que la de los nanorobots no purificados (flecha roja), que corresponden a la inicial 10: 1 andamio pararelación molar grapas en el protocolo de fabricación.

La validación final de la integridad estructural se logra a través de microscopía electrónica de transmisión utilizando 2% de uranilo-formiato como una tinción negativa. Las fotos se presentan en la Figura 3.

Figura 1
Figura 1: Diseño esquemático del nanorobot vista (A) lateral de un nanorobot cerrado.. Puerta de doble hélice, producido por una secuencia de aptámero y una cadena complementaria, se indica mediante una flecha verde. (B) Vista frontal de un nanorobot cerrada mostrando la carga a las proteínas en el interior. (C) de sección cruzada esquemas de nanorobot cerrado producido. Manijas grapas se destacan por una flecha roja. Círculos verdes indican hélices que contienen una bisagra en un lado y una secuencia de puerta en el lado opuesto. (D) Blueprints deun nanorobot en vista lateral. Los mangos se indican con flechas rojas. Secuencias Gate se indican con flechas verdes. Por favor haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2:. Agarosa resultados de la electroforesis en gel (A) Carril 1: marcador de 1 kb. Carril 2: M13mp18 circular andamio de un solo capítulo. Carril 3: nanorobots pre-purificación. Carriles 4-6: nanorobots publicar purificaciones. Carril 4: 50 l de volumen inicial; 2 adiciones de amortiguamiento. Carril 5: 100 l de volumen inicial; 2 adiciones de amortiguamiento. Carril 6: 100 l de volumen inicial; 5 adiciones de amortiguamiento. El exceso de alimentos básicos se indican con una flecha verde nanorobots fabricados se indican con una flecha roja. Flecha azul indica dímeros nanorobot. (B) vista en 3D de la intensidad relativa de las bandas en la agarosagel. (C) el rendimiento y la purificación de las estimaciones.

Figura 3
Figura 3: Foto TEM de nanorobots de ADN tomadas de fabricaciones múltiples / procedimientos de tinción.

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> Core 141 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
Número Designación Secuencia
1 Núcleo AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
2 Núcleo GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 Núcleo TACGATATAGATAATCGAACAACA
4 Núcleo CTTTTGCTTAAGCAATAAAGCGAGTAGA
5 Núcleo GTCTGAAATAACATCGGTACGGCCGCGCACGG
6 Núcleo GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 Núcleo AAAATCACCGGAAGCAAACTCTGTAGCT
8 Núcleo CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 Núcleo CATGTAAAAAGGTAAAGTAATAAGAACG
10 Núcleo ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
11 Núcleo ATAGTCGTCTTTTGCGGTAATGCC
12 Núcleo AGTCATGGTCATAGCTGAACTCACTGCCAGT
13 Núcleo AACTATTGACGGAAATTTGAGGGAATATAAA
14 Núcleo ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
15 Núcleo AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
16 Núcleo GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
17 Núcleo GCACCGCGACGACGCTAATGAACAGCTG
18 Núcleo AACTTCATTTTAGAATCGCAAATC
19 Núcleo CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
20 Núcleo CCAATCAAAGGCTTATCCGGTTGCTATT
21 Núcleo AGAGGCGATATAATCCTGATTCATCATA
22 Núcleo CCGTAATCCCTGAATAATAACGGAATACTACG
23 Núcleo AAATGGTATACAGGGCAAGGAAATC
24 Núcleo TCCTCATCGTAACCAAGACCGACA
25 Núcleo CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
26 Núcleo ACCCGCCCAATCATTCCTCTGTCC
27 Núcleo CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
28 Núcleo CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
29 Núcleo TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
30 Núcleo
31 Núcleo AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
32 Núcleo ACATTCAGATAGCGTCCAATATTCAGAA
33 Núcleo AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
34 Núcleo GAGATGACCCTAATGCCAGGCTATTTTT
35 Núcleo TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
36 Núcleo GCCGAAAAATCTAAAGCCAATCAAGGAAATA
37 Núcleo AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
38 Núcleo ACCAATCGATTAAATTGCGCCATTATTA d>
39 Núcleo ATCTTACTTATTTTCAGCGCCGACAGGATTCA
40 Núcleo CCCTAAAAGAACCCAGTCACA
41 Núcleo GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
42 Núcleo CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
43 Núcleo TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
44 Núcleo TTCCTTATAGCAAGCAAATCAAATTTTA
45 Núcleo ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
46 Núcleo AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
48 Núcleo TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 Núcleo AAAGAAACAAGAGAAGATCCGGCT
50 Núcleo TTGAGGGTTCTGGTCAGGCTGTATAAGC
51 Núcleo TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
52 Núcleo ACGAGCGCCCAATCCAAATAAAATTGAGCACC
53 Núcleo AATAAGTCGAAGCCCAATAATTATTTATTCTT
54 Núcleo ACGAAATATCATAGATTAAGAAACAATGGAACTGA
55 Núcleo TTTCATAGTTGTACCGTAACACTGGGGTTTT
56 Núcleo AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
57 Núcleo CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
58 Núcleo TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 Núcleo ATAACGCAATAGTAAAATGTTTAAATCA
60 Núcleo ACGAATCAACCTTCATCTTATACCGAGG
61 Núcleo TAATGGTTTGAAATACGCCAA
62 Núcleo CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
63 Núcleo ATTAAAGGTGAATTATCAAAGGGCACCACGG
64 GGCAACCCATAGCGTAAGCAGCGACCATTAA
sesenta y cinco Núcleo AGAAACGTAAGCAGCCACAAGGAAACGATCTT
66 Núcleo AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 Núcleo GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
68 Núcleo TTTTAGAACATCCAATAAATCCAATAAC
69 Núcleo AAATGTGGTAGATGGCCCGCTTGGGCGC
70 Núcleo ACGGATCGTCACCCTCACGATCTAGAATTTT
71 Núcleo CGCCATAAGACGACGACAATAGCTGTCT
72 Núcleo GCGTATTAGTCTTTAATCGTAAGAATTTACLA
73 Núcleo AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
74 Núcleo AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
75 Núcleo TAATTTAGAACGCGAGGCGTTAAGCCTT
76 Núcleo ACCAGGCGTGCATCATTAATTTTTTCAC
77 Núcleo CAGCCTGACGACAGATGTCGCCTGAAAT
78 Núcleo ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 Núcleo CTCGAATGCTCACTGGCGCAT
80 Núcleo GGGCAGTCACGACGTTGAATAATTAACAACC
81 Núcleo
82 Núcleo TCAACCCTCAGCGCCGAATATATTAAGAATA
83 Núcleo ATTATACGTGATAATACACATTATCATATCAGAGA
84 Núcleo GCAAATCTGCAACAGGAAAAATTGC
85 Núcleo ATAATTACTAGAAATTCTTAC
86 Núcleo TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 Núcleo AAGTAGGGTTAACGCGCTGCCAGCTGCA
88 Núcleo CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 Núcleo TGGCGAAGTTGGGACTTTCCG
90 CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
91 Núcleo AAATCAAAGAGAATAACATAACTGAACACAGT
92 Núcleo CTGTATGACAACTAGTGTCGA
93 Núcleo ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
94 Núcleo TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
95 Núcleo ATAAGAATAAACACCGCTCAA
96 Núcleo CGTTGTAATTCACCTTCTGACAAGTATTTTAA
97 Núcleo AACCGCCTCATAATTCGGCATAGCAGCA
98 Núcleo AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
99 Núcleo CAGTATAGCCTGTTTATCAACCCCATCC
100 Núcleo TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
101 Núcleo CGTCGGAAATGGGACCTGTCGGGGGAGA
102 Núcleo AAGAAACTAGAAGATTGCGCAACTAGGG
103 Núcleo CCAGAACCTGGCTCATTATACAATTACG
104 Núcleo ACGGGTAATAAATTAAGGAATTGCGAATAGTA
105 Núcleo CCACGCTGGCCGATTCAAACTATCGGCCCGCT
106 Núcleo GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
107 CAGCATTAAAGACAACCGTCAAAAATCA
108 Núcleo ACATCGGAAATTATTTGCACGTAAAAGT
109 Núcleo CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
110 Núcleo AAATCGTACAGTACATAAATCAGATGAA
111 Núcleo TTAACACACAGGAACACTTGCCTGAGTATTTG
112 Núcleo AGGCATAAGAAGTTTTGCCAGACCCTGA
113 Núcleo GACGACATTCACCAGAGATTAAAGCCTATTAACCA
114 Núcleo AGCTGCTCGTTAATAAAACGAGAATACC
115 Núcleo CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
116 Núcleo CACCCTCTAATTAGCGTTTGCTACATAC
117 Núcleo GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
118 Núcleo GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 Núcleo ATGAAACAATTGAGAAGGAAACCGAGGATAGA
120 Núcleo GGATGTGAAATTGTTATGGGGTGCACAGTAT
121 Núcleo GGCTTGCGACGTTGGGAAGAACAGATAC
122 Núcleo TAAATGCCTACTAATAGTAGTTTTCATT
123 Núcleo TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
124 Núcleo TGACCATAGCAAAAGGGAGAACAAC
125 Núcleo CGAGCCAGACGTTAATAATTTGTATCA
126 Núcleo GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 Núcleo AGACGCTACATCAAGAAAACACTTTGAA
128 Núcleo AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 Núcleo GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
130 Núcleo GGTATTAAGGAATCATTACCGAACGCTA
131 Núcleo GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
132 Núcleo
133 Núcleo ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
134 Núcleo AACGAGATCAGGATTAGAGAGCTTAATT
135 Núcleo TACCAAGTTATACTTCTGAATCACCAGA
136 Núcleo CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 Núcleo AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
138 Núcleo TTTCAACCAAGGCAAAGAATTTAGATAC
139 Núcleo TTGAAATTAAGATAGCTTAACTAT
140 Núcleo CTATTATCGAGCTTCAAAGCGTATGCAA
Núcleo CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
142 Núcleo GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 Núcleo CGAACGTTAACCACCACACCCCCAGAATTGAG
144 Núcleo GTGTGATAAATAAGTGAGAAT
145 Núcleo GCTATATAGCATTAACCCTCAGAGA
146 Núcleo AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 Núcleo CGGCCTCCAGCCAGAGGGCGAGCCCCAA
148 Núcleo CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 Núcleo
150 Núcleo ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
151 Núcleo ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
152 Núcleo TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
153 Núcleo AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
154 Borde TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
155 Borde TTTTTTTTTTTTTTTTAATAAGAGAATA
156 Borde TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 Borde
158 Borde TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 Borde TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
160 Borde TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
161 Borde TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
162 Borde TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
163 Borde TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
164 Borde TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
165 Borde TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
166 Borde TTTTTTTTTTTTTTTACCGGATATTCA
167 Borde TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
168 Borde TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 Borde CTGAGAGAGTTGTTTTTTTTTTTTTTT
170 Borde CAATGACAACAACCATTTTTTTTTTTTTTTT
171 Borde TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
172 Borde TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 Borde
174 Borde TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
175 Borde TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
176 Borde TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 Borde CCACACAACATACGTTTTTTTTTTTTT
178 Borde TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 Borde TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
180 Borde TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 Borde TTTTTTTTTTTTTTTACGGCGGAT
182 Borde TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 Borde TTTTTTTTTTTTTTTACGATTGGCCTTGATA
184 Borde TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 Borde TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
186 Borde TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 Borde TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 Borde ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 Borde
190 Borde TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
191 Borde GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
192 Borde GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 Borde ATAACGTGCTTTTTTTTTTTTTTTTTT
194 Borde TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
195 Borde TTTTTTTTTTTTTTTACAAAATAAACA
196 Borde TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 Borde
198 Borde TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 Borde GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
200 Borde TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
201 Borde CACTAAAACACTTTTTTTTTTTTTTTT
202 Borde TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
203 Borde TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
204 Borde TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
205 Borde TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
206 Borde TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
207 Borde CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
208 Borde TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
209 Borde AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
210 Borde ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
211 Borde TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
212 Borde TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
213 CAGAACAATATTTTTTTTTTTTTTTTT
214 Borde TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
215 Borde TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
216 Borde TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
217 Borde TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
218 Borde TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 Borde AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
220 Borde CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
221 TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
222 Borde TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
223 Borde TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
224 Borde TTTTTTTTTTTTTTTCGCCCACGCATAACCG
225 Borde AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
226 Borde CAAGTTTTTTGGTTTTTTTTTTTTTTT
227 Borde TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
228 Borde TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 Borde TTTTTTTTTTTTTCATCTTTGACCC
230 Borde TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
231 Borde GATACAGGAGTGTACTTTTTTTTTTTTTTTT
232 Borde TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
233 Borde GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
234 Borde TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
235 Borde TTTTTTTTTTTTTTTATAGCAATAGCT
236 Manijas AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 Manijas ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
238 Manijas CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 Manijas CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
240 Manijas CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
241 Manijas CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
242 Manijas AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 Manijas CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
244 Manijas CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
245 Manijas TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
246 Manijas AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 Manijas GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
248 Guías AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 Guías ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
250 Guías CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
251 Guías GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
252 Guías AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
253 Guías TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
254 Guías TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
255 Remoción Guías GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
256 Remoción Guías GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 Remoción Guías TAAAACACCGTACTTTAGAACTAAATTGCTACG
258 Remoción Guías AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 Remoción Guías CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
260 Guides Remoción GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
261 Remoción Guías ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
262 Puertas Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
263 Puertas Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
264 Puertas Gate0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
265 Puertas Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

Tabla 1: Lista de secuencias de primera necesidadutilizado para construir el nanorobot. Grapas 1 a 153 son designados Core y constituyen la mayor parte de la estructura. Las grapas 154 a 235 se designan los bordes y están situados en cada uno de los extremos de las hélices 61 de la estructura. Grapas Edge contienen una cola timina poli diseñado para evitar la agregación de nanorobots. Grapas 236-247 se designan manijas y constituyen los sitios de atraque de carga. Maneja grapas tienen una región de secuencia único, conectando a su ubicación específica de la estructura, y una región de secuencia de consenso que se utiliza como sitio de acoplamiento para las moléculas de carga. Grapas 248 hasta 254 se designan las guías y coloque las dos mitades del dispositivo durante el proceso de recocido. Después de la fabricación de las guías se eliminan con la adición de Guía de eliminación de alimentos básicos desde 255 hasta 261 (paso 6), dejando el dispositivo bloqueado por los dos sensores del nanorobot. Secuencias de sensores se designan Gates. Cada uno de los dos sensores se compone de un aptámero de PDGF y una cadena complementaria. Para una más detallada EXPOSICIÓNnación ver Ben-Ishay et al. 14 y Douglas et al. 15. grapas están clasificadas comercialmente en tres placas de 96 pocillos (fondo redondo profunda). Cada cantidad de grapas se normaliza a 10 nmol. A excepción de las secuencias de puerta, que requieren la purificación por HPLC, las grapas no requieren un procedimiento especial de purificación.

Discussion

Hemos descrito la fabricación, la purificación, y la visualización del nanorobot ADN. Después de la fabricación del chasis hexagonal del dispositivo, la función de la nanorobot está programado con la simple introducción de la carga específica y hebras de detección para el robot que encontrar fácilmente su posición designada debido a la complementariedad de enlaces de hidrógeno con los sitios de conexión disponibles sola hebra 14 , 15,22.

El protocolo de fabricación descrito utiliza una rampa de recocido lento, que se utiliza generalmente en nuestro laboratorio para plegar una amplia gama de formas de origami. Si el tiempo de producción se convierte en un factor clave para otros protocolos, como el protocolo de plegado rápido descrito por Sobczak et al. 24 se puede utilizar. Este protocolo se informó de lograr plegado origami con altos rendimientos, sin embargo, requiere de calibración para cada forma de origami.

Girar la filtración se utiliza para purificar los robots de exceso de grapas. Al cargar los scolumna pin con muestras o tampón, se debe tener cuidado de no dañar la membrana con la punta de la pipeta. La membrana potencialmente puede romper lo que resulta en una disminución del rendimiento de forma espectacular. Se recomienda no desechar el flujo continuo hasta que los nanorobots se visualizan por la edad.

Para ciertas aplicaciones se desea una velocidad de purificación superior; esto puede lograrse mediante la repetición de la filtración utilizando la columna de centrifugación inicial. Para aún mayor pureza, una nueva columna de centrifugación se puede utilizar, sin embargo, esto tendrá un efecto negativo dramático en las tasas de rendimiento. Otros métodos para la purificación de ADN estructuras origami fueron probados, tales como la escisión en gel de agarosa después de la electroforesis y diálisis de un exceso de grapas. Estos métodos dieron lugar a pobre rendimiento o las tasas de purificación pobres en comparación con el protocolo descrito. Otros métodos, tales como la purificación a base de PEG 25 y la velocidad de ultracentrifugación zonal-26 no fueron probados. Estos métodos son reportados a Achivíspera altas tasas de purificación, sin embargo, ya sea como resultado rendimientos pobres (ultracentrifugación tasa zonal) o requieren la precipitación (basado-PEG) que potencialmente pueden dañar la forma nanorobot hueco.

Nanorobots se fabrican con grapas Guía que bloquean la forma en la posición cerrada con el fin de aumentar la yeilds fabricación 15. Es importante eliminar estas grapas mediante la adición de Guía de eliminación de grapas para nanorobots a efectivamente se abren en respuesta a los estímulos diseñados (PDGF en el protocolo descrito). Grapas Guía están diseñadas con un punto de apoyo sola región hebra para el atraque de Guía de grapas de mudanzas que liberan las grapas Guía a través de un proceso de desplazamiento de cadena 18 .Estos grapas deben añadirse a una proporción de 10: 1 molar al final de la purificación de exceso etapa grapas '(paso 4.7) y se incubó durante 2 horas a temperatura ambiente en un extremo sobre extremo agitador.

Visualización por TEM fue descrito, including de uranilo-formiato de tinción negativa 2%. En comparación con uranilo-acetato, formiato de uranilo-produce estructuras de grano más fino que permitan una mejor resolución de los diseños de origami de ADN. Se debe tener cuidado de uranilo-formiato como se solidificará si alícuotas se congelan durante largos períodos de tiempo. Es aconsejable usar una solución de uranilo-formiato de 2% recién preparada para la tinción. Mejores resoluciones son alcanzables con el uso de Cryo-TEM 27.

El diseño y la fabricación protocolo básico arquitectónico de la nanorobot de ADN son en última instancia, uniforme y directa. Sin embargo, una amplia gama de flexibilidad se ofrece en forma de mezclas de carga específicas y las hebras de detección. Además, en una sola población muchos subtipos pueden ser introducidos y su estequiometría relativa programados y optimizados para adaptarse a necesidades específicas. Incluso mayor ajuste fino de la cinética específicos en cada paso limitante de la velocidad se puede lograr con el aumento / reducción de la longitud de cadena doble de hibridación o laintroducción de los desajustes en las posiciones clave específicas. Este alto grado de flexibilidad con la facilidad de construcción permite para la ingeniería de dispositivos a nanoescala capaces de realizar tareas complejas muy variadas en un medio biológico relevante.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Los autores desean agradecer a S. Douglas para las discusiones y consejos muy valiosos, y todos los miembros del laboratorio Bachelet útil para los debates y el trabajo. Este trabajo es apoyado por becas de la Facultad de Ciencias de la Vida y el Instituto de Nanotecnología y Materiales Avanzados de la Universidad de Bar-Ilan.

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics