Vikning och karakterisering av en Bio-lyhörd robot från DNA Origami

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

DNA nanorobot är en ihålig hexagonal nanometrisk enhet, utformad för att öppna som svar på specifika stimuli och nuvarande last sekvestrerade inuti. Både stimuli och gods kan skräddarsys efter specifika behov. Här beskriver vi DNA nanorobot tillverkningsprotokoll, med användning av DNA-origami teknik. Proceduren initieras genom att blanda korta enkelsträngade DNA-häftklamrar i en förrådsblandning vilken sedan sättes till en lång, cirkulär, enkelsträngad DNA-byggnadsställning i närvaro av en veckningsbuffert. En standardtermocykelanordningen är programmerad för att gradvis sänka blandningsreaktionstemperaturen för att underlätta häftklamrar till byggnadsställning glödgning, som är den ledande kraften bakom vikningen av nanorobot. När väl 60 tim fällbara reaktionen är fullständig, är överskotts häftklamrar kasseras med användning av ett centrifugalfilter, följt av visualisering via agaros-gelelektrofores (AGE). Slutligen är framgångsrik tillverkning av nanorobot verifierades genom transmissionselektronmikroskopi (TEM),med användning av AUC-format som negativa fläcken.

Introduction

Användningsområdena för nukleinsyror nanoteknik är häpnadsväckande. Den spårbarhet av Watson-Crick basparning samt den lätthet och relativt låga kostnad för storskalig syntes av skräddarsydda oligos 2 har genererat en explosion av ansökningar 3 och forskning inom DNA nanoteknik. Strukturell DNA nanoteknologi, baserat på den orörliga Seeman korsning 4,5 som en grundläggande byggsten utnyttjar DNA som en självsamlande elementärenhet för konstruktion av godtyckliga former 6-8.

Den senaste tidens utveckling bygga ställning DNA origami 9 teknik möjliggör för byggandet av komplexa 2D / 3D nano arkitekturer 10-12 med sub-nanometer precision och är en effektiv väg för att bygga nya funktionella föremål med ökande komplexitet och häpnadsväckande mångfald. Byggprocessen bygger på en lång klätterställning enda DNA, vanligen härrör från en viral GENOMe, som kan vikas genom hybridisering av hundratals korta enkelsträngat DNA oligos benämnda häftklamrar. Den höga strukturella upplösning som erhålls genom denna teknik är ett direkt resultat av de naturliga dimensionerna hos DNA-dubbelspiralen, medan reproducerbarheten för tillverkningen är ett resultat av att skräddarsy de korta enkelsträngade stapel sekvenser för att underlätta maximal vätebindnings komplementaritet uppnås. Med hjälp av en långsam temperatur glödgning ramp utformade lägsta energi, termodynamiskt föredragna nanostruktur uppnås i höga utbyten och trohet. Den enkel implementering av kopplingsdesignregler i en datorkod möjliggjort utvecklingen av CAD-verktyg, såsom caDNAno 13, som extremt förenkla uppgiften att utforma stora komplexa strukturer som innehåller hundratals anslutna korsningar.

Tidigare har vi beskrivit konstruktionen av en DNA-nanorobot med hjälp av caDNAno verktyget 14,15. Här skildrar vi tillverkning ochvisualisering, via transmissionselektronmikroskop (TEM), av nanorobot, en 3D ihålig hexagonal nanoanordning, med måtten 35 x 35 x 50 nm 3, som avser att genomgå en stor strukturförändring som svar på en förutbestämd stimuli och detta särskilda last, till exempel som proteiner eller nukleinsyra oligos, binds inuti. Medan 12 laddningsstationer finns inuti den ihåliga chassi, det faktiska antalet bunden last varierar med laststorlek. Cargo molekyler varierar från små DNA-molekyler enzymer, antikroppar och 5-10 nm guldnanopartiklar. Cargocan antingen vara enhetligt eller heterogen, så att varje nanorobot innehåller en blandning av olika molekyler. Sensing sker via två dubbelspiral låsspärrarna design för att känna av proteiner, nukleinsyror eller andra kemikalier, bygger antingen på aptasensor 16,17 eller DNA-sträng förskjutning 18 tekniker. Den senaste utvecklingen inom aptamer urval protokoll 19-21 möjliggöra utformningen av nanorobotar svaratill ett ständigt ökande urval av molekyler och celltyper.

Tidigare arbete visade en nanorobot uppbär en specifik antikropp, som vid bindning till dess antigen kan förmedla antingen en hämmande eller en produktiv signal till insidan av specifika celltyper i en blandad cellpopulation 15. Ett spännande inslag i dessa nanomaskiner är deras förmåga att utföra ännu mer komplexa uppgifter och logik kontroll med införandet av olika nanorobot subtyper i en enda population. Nyligen visade vi specifika subtyper av nanorobotar utför som antingen positiva eller negativa regulatorer, styra en effektor befolkningen innehåller en aktiv last molekyl 22.

Protokollet presenteras här beskriver tillverkning, rening och avbildning av en nanorobot gated med aptamer sensor sekvenser som binder selektivt till PDGF för att underlätta öppnandet av nanorobot 15,22. Tillverkningsprocessen beskrivs liknar de nanorobot tillverkningsprocess initialt visas av al. Douglas et 15 med ändringar som syftar till att minska den totala processtiden, och samtidigt öka avkastningen och reningshastigheter.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Framställning av Staples Pool Blandning

  1. Order lyofiliserat DNA nanorobot häftklamrar på 96-brunnars plattor som anges i tabell 1 (se Material) och normalisera till 10 nmol. För en detaljerad beskrivning av design och arkitektur av DNA nanorobot se Ben-Ishay et al. 14 och Douglas et al. 15).
  2. Bered varje klämmer väl med DNas / RNas-fri ultrarent till en koncentration av 100 | iM. För klammer normaliserad till 10 nmol, rekonstruera med 100 pl av ultrarent vatten.
  3. Pool tillsammans 20 il av varje klämmer med hjälp av en multikanalspipett och en steril 55 ml lösning bassängen.
    Obs: Eftersom nanorobot formen består av 254 stapel strängar (inklusive Core, Kanter, handtag och guider sekvenser, tabell 1), koncentrationen av var och en av häftklamrar i klammer poolen är 394 nM. Ta bort häftklamrar från stapel poolen, eller lägga till några vid olika volvolymerna, kan minska avkastningen avsevärt, eller på annat sätt resultera i ovikta aggregat.

2. Beredning av Fabrication reaktionsblandning

  1. För en vanlig reaktionsblandning använda 40 il M13mp18 viralt genom cirkulär enkelsträngat DNA, motsvarande 4 pmol ställnings DNA (100 nM stamlösning, se Material). Slutlig koncentration av byggnadsställning vid tillverkningen blandningen är 20 nM, slutvolym 200 | il.
    1. Justera mängden ställningen DNA enligt särskilda behov; dock hålla den slutliga koncentrationen av byggnadsställning DNA i reaktionsblandningen vid en konstant 20 nM.
  2. Fyll på häftklamrar för att nå en byggnadsställning för häftklamrar förhållande av 1 till 10, respektive. För en 20 nM byggnadsställning DNA-koncentration, var och en av de 254 häftklamrar 'slutkoncentration är 200 nM. För en 200 pl slutlig reaktionsvolym till 102 ìl av häftklamrar pool blandningen (avsnitt 1.2).
    1. Lägg till specifika Gate sekvenser separat till the fällbara reaktionsblandningen vid denna tidpunkt. Dessa oligos beställs separat och kräver HPLC-rening. Se till att Gate oligos är närvarande i ett 1:10 byggnadsställning Gate sekvensförhållandet, det vill säga 200 nM av varje oligo för en 20 nM byggnadsställning koncentration. För en 200 l fällbara reaktionsvolym, tillsätt 0,4 pl för var och en av fyra Gate oligo på en 100 iM förrådskoncentration.
  3. Lägg 10x TAE lager buffert för att nå en slutlig koncentration av 1 x TAE (40 mM Tris-acetat, 1 mM EDTA). För en 200 l fällbara reaktionsvolym, tillsätt 20 pl 10x TAE.
  4. Lägg ett M MgCl2 till en slutlig koncentration av 10 mM. För en 200 l fällbara reaktionsvolym, tillsätt 2 pl av 1 M MgCl2.
  5. Lägg 36 | il DNas / RNas-fritt ultrarent vatten till en nå en slutlig volym av 200 | il.
  6. Vortex och delprov 100 ul prover i PCR-rör.
    Obs! Konsultera termocykler specifikationen som de maximala reaktionsvolymer som ska användas.Att minska volymen för att möta dessa gränser kommer inte att minska de erhållna utbytena. Reaktionsvolymer ovanför högsta värde som anges äventyrar utbytena.

3. Temperatur Glödgning Ramp av Fabrication Reaktion

  1. Program termocykler som följer:
    1. Ramp 85 ° C till 60 ° C vid en hastighet av 5 min / ° C.
    2. Ramp 60 ° C till 4 ° C med en hastighet av 75 min / ° C.
    3. Håll vid 4 ° C på obestämd tid.
  2. Efter tillverkningen har avslutats lagra proverna vid -20 ° C.

4. Borttagande av överskott Staples

  1. Tillsätt 100 ni vikning reaktionsblandningen till en 0,5 ml centri-filter med en MWCO av 100 kDa. Spara ett prov av nanorobotar för-rening för senare analys 10 | il.
  2. Centrifugera i 10 minuter vid 9600 x g.
  3. Tillsätt 400 ul av veckningsbuffert (1x TAE, 10 mM MgCl2).
  4. Upprepa steg 4,2 och 4,3 gånger mer.
  5. Centrifugera i 5 minuter vid 9600 x g.
  6. Återvinna koncentratet genom att placera filtret upp och ner i ett rent mikrocentrifugrör och centrifugera i 1 min vid 9600 x g. Slutliga volymer kan variera beroende på den ursprungliga volymen av tillverkningsreaktionsblandning som sattes i filtret. Vanligtvis en 25-60 il slutlig volym koncentrerad nanorobot prov erhålls.
  7. Mät koncentration av DNA i proverna genom spektrofotometer vid 260 nm. Använd molekylvikt på 5,3 mikrogram / pmol vid beräkning molkoncentrationer av nanorobot prover.
    Obs: Den molära extinktionskoefficienten för dsDNA, 50 ug / OD 260, är tillräcklig för de flesta tillämpningar. 48 mikrogram / ​​OD 260 beaktar poly tymin ssDNA sträcker vid kanterna häftklamrar.

5. Agarosgelelektrofores Analys av Vikta nanorobotar

  1. Framställning av 0,5 x TBE (45 mM Tris-borat, 1 mM EDTA), 2% -ig agarosgel kompletterat med 10 mM MgCl2 et al. 21):
    1. Bered 0,5x TBE-buffert genom att späda 6,25 ml av 10x TBE lager buffert i 118,75 ml DDH 2 O.
    2. Lös 2,5 g agaros i 125 ml 0,5x TBE-buffert.
    3. Koka i mikrovågsugn tills agarosen är fullständigt upplöst.
    4. Lägg 1,25 ml av 1 M MgCl2 till en slutkoncentration av 10 mM.
    5. Lägg 7 pl av 10 mg / ml etidiumbromid.
    6. Vänta lösning till något kallt och fyll gelbricka innan agarosgelen stelnar. Installera önskad kam omedelbart.
    7. Bered en L 0,5x TBE löpbuffert genom tillsats av 50 ml av 10 x TBE-lager buffert och 10 ml 1 M MgCl2 till 940 ml DDH 2 O.
    8. När gelén är fast tillägg löpbufferten till elektroforesanordningen och sätta enheten i ett isbad.
  2. Belastning 1 | ig totalt DNA av nanorobotar för-rening (steg 3,2), och efter rening (steg 4,7), vid sidan av en byggnadsställningDNA-prov och en 1 kb DNA-markör, på gelén. Ett exempel ges i figur 2. Faktiska volymer av prover beror på koncentrationerna erhållna efter rening. Varje sampel är laddad med laddningsbuffert vid en 1: 6 slutlig volymförhållande.
  3. Ställ strömkälla till 80 V och den körda gel för tre timmar. Kör gelen i ett bad fyllt med is och vatten. Nanorobotar kommer utvecklas och visas som en fläck om agarosgelen värms upp under elektrofores. Under elektrofores lägga till ytterligare is för att hålla enheten från uppvärmning.
  4. Se gelén på en UV tabell (figur 2).

6. negativa Stain av nanorobot med AUC-format

  1. Framställning av 2% AUC-formiat stamlösning (anpassad från Castro et al. 23):
    1. Väg upp 100 mg av AUC-formiat pulvret i en 15 ml-rör.
    2. Koka DNas / RNas fritt ultrarent vatten under 3 minuter för att de-syre.
    3. Tillsätt 5 ml deoxygenerad varmt vatten (~ 60 ° C)i 15 ml röret med AUC-format pulver (från föregående steg). Tätt stäng locket, linda in i aluminiumfolie och vortexa rigoröst för 10 min (Fäst röret till en virvel). Lösningen skall vara grumlig med en gul färg.
    4. Filter lösningen genom ett 0,2 ìm spruta fi lter. Lösningen bör vara klar.
    5. Alikvot 200 ul av lösningen i mikrocentrifugrör.
    6. Centrifugera vid max hastighet i 5 min i en bordscentrifug till pool prover på botten av röret.
  2. Lastning av prov till elnätet och negativ färgning:
    1. Frosta en 200 pl alikvot av 2% AUC-formiat lösning (framställd i avsnitt 6.1). Tillsätt 10 | il 0,5 M NaOH-lösning och vortexa rigoröst för 3 minuter. Centrifugera vid max hastighet under 5 minuter med en bordscentrifug.
    2. Samtidigt glödurladdning nätet med hjälp av rumsluft vid 0,2 mbar och 25 mA under 30 sekunder.
    3. Tillsätt 15 | il av 2 nM nanorobot provet efter rening (avspå 4,7) på ovansidan av gallret (som hölls med pincett) och låt absorbera under 1 min. Använd lter papper för att dränera överskottsvätska genom att placera gallret ovanpå filterpapperet. Rör inte gallerytan.
    4. Tillsätt 10 pl av 2% AUC-format (från steg 6.2.1) på ovansidan av gallret (som hölls med pincett).
    5. Snabbt använda lter papper för att dränera överskottsvätska genom att placera gallret ovanpå filterpapperet. Rör inte gallerytan.
    6. Upprepa steg 6.2.4 och 6.2.5.
    7. Tillsätt 10 pl av 2% AUC-format (från steg 6.2.1) på ovansidan av gallret (som hölls med pincett). Låt färgningslösningen absorbera under 30 sekunder.
    8. Använd lter papper för att dränera överskottsvätska genom att placera gallret ovanpå filterpapperet. Rör inte gallerytan.
    9. Låt gallret torka helt under minst 30 minuter, framsidan upp på ett filterpapper, innan det sprutas in i TEM.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Representativa resultat visas i figur 2A. Alla banorna innehåller en pg av totalt DNA, mätt via spektrofotometer (OD 260). Jämfört med den cirkulära enkelsträngade DNA-byggnadsställning (bana 2), är nanorobotar hindras i gelén på grund av sin högre molekylvikt, resultatet av häftklamrar hybridisering till ställningen-DNA (spår 3. Röd pil). Den lågmolekylära bandet i Bana 3 representerar överskotts häftklamrar som inte band till schavotten DNA (grön pil). Efter rening via centrifugalfiltrering mesta av överskottet häftklamrar avlägsnas (Lanes 4-6) och de nanorobotar är redo att laddas med last molekyler konjugerade till handtagen komplementär sträng 14,15,22. Banorna 4-6 innehåller högmolekylära band som representerar nanorobot dimerer (blå pil), en befolkning nanorobotar som är sammanbundna. Minska koncentrationen av byggnadsställningen i tillverkningsproceduren (antingen 5 eller 10 nM) kan potentiellt reduce den relativa mängden av dessa högmolekylära strukturer. Lanes 4-6 show nanorobotar efter rening med smärre variationer av den beskrivna reningsprotokollet, nämligen den ursprungliga volymen av fabricerade nanorobotar sattes till spinnfiltret (Steg 4,1 Bana 4:. 50 | il, bana 5: 100 | il, bana 6: 100 il), och antalet gånger bufferten tillsattes till filtret (Steg 4,4 Bana 4: 2 gånger, bana 5:. 2 gånger, bana 6: 5 gånger).

Jämförelse av avkastningen och reningsresultat mellan de olika varianter av protokollet (Figur 2C) visar att reducera den ursprungliga volymen av tillverkade robotar laddade åt centrifugalfilter (Steg 4.1) har liten effekt på avkastnings och reningshastigheter. Dessutom ökar antalet buffertutbyten och centrifug spins (steg 4.4) har marginell inverkan på renheten på nanorobotar, samtidigt avsevärt reducera avkastningen. Därav beskrivna protokollet, motsvarande 100 | alursprungliga volymen och 2-additioner buffert (Lane 5), anses vara optimalt.

Yield uppskattningar bygger på spektrofotometer (OD 260) mätningar av varje prov efter rening och beräknas i förhållande till det ursprungliga beloppet laddas i varje centrifugalfilter. Rening är baserad på viktprocent av de nanorobotar från hela DNA i provet, som motsvarar de nanorobotar och överskott häftklamrar som inte tvätta ut under rening. Renings uppskattningar beräknas från den relativa intensiteten av nanorobotar (röda och blå pilar i figur 2A) och att de överskjutande häftklamrar (grön pil i figur 2B). De relativa nanorobotar / Staples intensiteter normaliserades med pre-renat prov (spår 3), där den totala DNA vikten av häftklamrar (grön pil) är ~ 4,5 gånger den orenade nanorobotar (röd pil), vilket motsvarar den inledande 10: en byggnadsställning för atthäftklamrar molförhållande vid tillverkningen protokollet.

Slutlig validering av strukturell integritet uppnås via transmissionselektronmikroskopi användning av 2% AUC-formiat som en negativ fläck. Bilder presenteras i figur 3.

Figur 1
Figur 1: Utforma schema över nanorobot (A) från sidan av en sluten nanorobot.. Gate dubbelspiral, som produceras av en aptamer sekvens och en komplementär sträng, indikeras av en grön pil. (B) framifrån av en sluten nanorobot visar protein last bunden inuti. (C) Tvärsnitt scheman för slutna nanorobot produceras. Hanterar klammer markeras med en röd pil. Gröna cirklar indikerar helixar som innehåller ett gångjärn på en sida och en grindsekvens vid den motsatta sidan. (D) Ritningar aven nanorobot på sidan. Handtag indikeras med röda pilar. Gate-sekvenser indikeras med gröna pilar. Klicka här för att se en större version av denna siffra.

Figur 2
Figur 2:. Agarosgelelektrofores resultat (A) Spår 1: 1 kb markör. Spår 2: M13mp18 cirkulär enkelsträngad schavotten. Bana 3: nanorobotar för-rening. Banorna 4-6: nanorobotar posta reningar. Spår 4: 50 il initial volym; 2 buffert tillägg. Spår 5: 100 pl initial volym; 2 buffert tillägg. Spår 6: 100 pl initial volym; 5 buffert tillägg. Överskott klamrar indikeras med en grön pil Tillverkade nanorobotar indikeras med en röd pil. Blå pil indikerade nanorobot dimerer. (B) 3D-vy av den relativa intensiteten av banden i agarosengel. (C) Yield och renings uppskattningar.

Figur 3
Figur 3: TEM bild av DNA nanorobotar som tagits från flera Fabrications / färgningsförfaranden.

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> Kärn 141 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
Antal Beteckning Sekvens
1 Kärna AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
2 Kärna GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 Kärna TACGATATAGATAATCGAACAACA
4 Kärna CTTTTGCTTAAGCAATAAAGCGAGTAGA
5 Kärna GTCTGAAATAACATCGGTACGGCCGCGCACGG
6 Kärna GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 Kärna AAAATCACCGGAAGCAAACTCTGTAGCT
8 Kärna CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 Kärna CATGTAAAAAGGTAAAGTAATAAGAACG
10 Kärna ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
11 Kärna ATAGTCGTCTTTTGCGGTAATGCC
12 Kärna AGTCATGGTCATAGCTGAACTCACTGCCAGT
13 Kärna AACTATTGACGGAAATTTGAGGGAATATAAA
14 Kärna ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
15 Kärna AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
16 Kärna GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
17 Kärna GCACCGCGACGACGCTAATGAACAGCTG
18 Kärna AACTTCATTTTAGAATCGCAAATC
19 Kärna CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
20 Kärna CCAATCAAAGGCTTATCCGGTTGCTATT
21 Kärna AGAGGCGATATAATCCTGATTCATCATA
22 Kärna CCGTAATCCCTGAATAATAACGGAATACTACG
23 Kärna AAATGGTATACAGGGCAAGGAAATC
24 Kärna TCCTCATCGTAACCAAGACCGACA
25 Kärna CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
26 Kärna ACCCGCCCAATCATTCCTCTGTCC
27 Kärna CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
28 Kärna CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
29 Kärna TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
30 Kärna
31 Kärna AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
32 Kärna ACATTCAGATAGCGTCCAATATTCAGAA
33 Kärna AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
34 Kärna GAGATGACCCTAATGCCAGGCTATTTTT
35 Kärna TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
36 Kärna GCCGAAAAATCTAAAGCCAATCAAGGAAATA
37 Kärna AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
38 Kärna ACCAATCGATTAAATTGCGCCATTATTA d>
39 Kärna ATCTTACTTATTTTCAGCGCCGACAGGATTCA
40 Kärna CCCTAAAAGAACCCAGTCACA
41 Kärna GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
42 Kärna CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
43 Kärna TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
44 Kärna TTCCTTATAGCAAGCAAATCAAATTTTA
45 Kärna ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
46 Kärna AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
48 Kärna TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 Kärna AAAGAAACAAGAGAAGATCCGGCT
50 Kärna TTGAGGGTTCTGGTCAGGCTGTATAAGC
51 Kärna TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
52 Kärna ACGAGCGCCCAATCCAAATAAAATTGAGCACC
53 Kärna AATAAGTCGAAGCCCAATAATTATTTATTCTT
54 Kärna ACGAAATATCATAGATTAAGAAACAATGGAACTGA
55 Kärna TTTCATAGTTGTACCGTAACACTGGGGTTTT
56 Kärna AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
57 Kärna CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
58 Kärna TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 Kärna ATAACGCAATAGTAAAATGTTTAAATCA
60 Kärna ACGAATCAACCTTCATCTTATACCGAGG
61 Kärna TAATGGTTTGAAATACGCCAA
62 Kärna CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
63 Kärna ATTAAAGGTGAATTATCAAAGGGCACCACGG
64 GGCAACCCATAGCGTAAGCAGCGACCATTAA
65 Kärna AGAAACGTAAGCAGCCACAAGGAAACGATCTT
66 Kärna AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 Kärna GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
68 Kärna TTTTAGAACATCCAATAAATCCAATAAC
69 Kärna AAATGTGGTAGATGGCCCGCTTGGGCGC
70 Kärna ACGGATCGTCACCCTCACGATCTAGAATTTT
71 Kärna CGCCATAAGACGACGACAATAGCTGTCT
72 Kärna GCGTATTAGTCTTTAATCGTAAGAATTTACen
73 Kärna AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
74 Kärna AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
75 Kärna TAATTTAGAACGCGAGGCGTTAAGCCTT
76 Kärna ACCAGGCGTGCATCATTAATTTTTTCAC
77 Kärna CAGCCTGACGACAGATGTCGCCTGAAAT
78 Kärna ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 Kärna CTCGAATGCTCACTGGCGCAT
80 Kärna GGGCAGTCACGACGTTGAATAATTAACAACC
81 Kärna
82 Kärna TCAACCCTCAGCGCCGAATATATTAAGAATA
83 Kärna ATTATACGTGATAATACACATTATCATATCAGAGA
84 Kärna GCAAATCTGCAACAGGAAAAATTGC
85 Kärna ATAATTACTAGAAATTCTTAC
86 Kärna TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 Kärna AAGTAGGGTTAACGCGCTGCCAGCTGCA
88 Kärna CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 Kärna TGGCGAAGTTGGGACTTTCCG
90 CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
91 Kärna AAATCAAAGAGAATAACATAACTGAACACAGT
92 Kärna CTGTATGACAACTAGTGTCGA
93 Kärna ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
94 Kärna TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
95 Kärna ATAAGAATAAACACCGCTCAA
96 Kärna CGTTGTAATTCACCTTCTGACAAGTATTTTAA
97 Kärna AACCGCCTCATAATTCGGCATAGCAGCA
98 Kärna AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
99 Kärna CAGTATAGCCTGTTTATCAACCCCATCC
100 Kärna TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
101 Kärna CGTCGGAAATGGGACCTGTCGGGGGAGA
102 Kärna AAGAAACTAGAAGATTGCGCAACTAGGG
103 Kärna CCAGAACCTGGCTCATTATACAATTACG
104 Kärna ACGGGTAATAAATTAAGGAATTGCGAATAGTA
105 Kärna CCACGCTGGCCGATTCAAACTATCGGCCCGCT
106 Kärna GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
107 CAGCATTAAAGACAACCGTCAAAAATCA
108 Kärna ACATCGGAAATTATTTGCACGTAAAAGT
109 Kärna CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
110 Kärna AAATCGTACAGTACATAAATCAGATGAA
111 Kärna TTAACACACAGGAACACTTGCCTGAGTATTTG
112 Kärna AGGCATAAGAAGTTTTGCCAGACCCTGA
113 Kärna GACGACATTCACCAGAGATTAAAGCCTATTAACCA
114 Kärna AGCTGCTCGTTAATAAAACGAGAATACC
115 Kärna CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
116 Kärna CACCCTCTAATTAGCGTTTGCTACATAC
117 Kärna GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
118 Kärna GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 Kärna ATGAAACAATTGAGAAGGAAACCGAGGATAGA
120 Kärna GGATGTGAAATTGTTATGGGGTGCACAGTAT
121 Kärna GGCTTGCGACGTTGGGAAGAACAGATAC
122 Kärna TAAATGCCTACTAATAGTAGTTTTCATT
123 Kärna TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
124 Kärna TGACCATAGCAAAAGGGAGAACAAC
125 Kärna CGAGCCAGACGTTAATAATTTGTATCA
126 Kärna GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 Kärna AGACGCTACATCAAGAAAACACTTTGAA
128 Kärna AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 Kärna GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
130 Kärna GGTATTAAGGAATCATTACCGAACGCTA
131 Kärna GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
132 Kärna
133 Kärna ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
134 Kärna AACGAGATCAGGATTAGAGAGCTTAATT
135 Kärna TACCAAGTTATACTTCTGAATCACCAGA
136 Kärna CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 Kärna AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
138 Kärna TTTCAACCAAGGCAAAGAATTTAGATAC
139 Kärna TTGAAATTAAGATAGCTTAACTAT
140 Kärna CTATTATCGAGCTTCAAAGCGTATGCAA
Kärna CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
142 Kärna GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 Kärna CGAACGTTAACCACCACACCCCCAGAATTGAG
144 Kärna GTGTGATAAATAAGTGAGAAT
145 Kärna GCTATATAGCATTAACCCTCAGAGA
146 Kärna AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 Kärna CGGCCTCCAGCCAGAGGGCGAGCCCCAA
148 Kärna CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 Kärna
150 Kärna ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
151 Kärna ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
152 Kärna TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
153 Kärna AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
154 Kant TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
155 Kant TTTTTTTTTTTTTTTTAATAAGAGAATA
156 Kant TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 Kant
158 Kant TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 Kant TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
160 Kant TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
161 Kant TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
162 Kant TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
163 Kant TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
164 Kant TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
165 Kant TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
166 Kant TTTTTTTTTTTTTTTACCGGATATTCA
167 Kant TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
168 Kant TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 Kant CTGAGAGAGTTGTTTTTTTTTTTTTTT
170 Kant CAATGACAACAACCATTTTTTTTTTTTTTTT
171 Kant TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
172 Kant TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 Kant
174 Kant TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
175 Kant TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
176 Kant TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 Kant CCACACAACATACGTTTTTTTTTTTTT
178 Kant TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 Kant TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
180 Kant TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 Kant TTTTTTTTTTTTTTTACGGCGGAT
182 Kant TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 Kant TTTTTTTTTTTTTTTACGATTGGCCTTGATA
184 Kant TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 Kant TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
186 Kant TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 Kant TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 Kant ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 Kant
190 Kant TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
191 Kant GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
192 Kant GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 Kant ATAACGTGCTTTTTTTTTTTTTTTTTT
194 Kant TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
195 Kant TTTTTTTTTTTTTTTACAAAATAAACA
196 Kant TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 Kant
198 Kant TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 Kant GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
200 Kant TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
201 Kant CACTAAAACACTTTTTTTTTTTTTTTT
202 Kant TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
203 Kant TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
204 Kant TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
205 Kant TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
206 Kant TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
207 Kant CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
208 Kant TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
209 Kant AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
210 Kant ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
211 Kant TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
212 Kant TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
213 CAGAACAATATTTTTTTTTTTTTTTTT
214 Kant TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
215 Kant TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
216 Kant TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
217 Kant TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
218 Kant TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 Kant AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
220 Kant CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
221 TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
222 Kant TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
223 Kant TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
224 Kant TTTTTTTTTTTTTTTCGCCCACGCATAACCG
225 Kant AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
226 Kant CAAGTTTTTTGGTTTTTTTTTTTTTTT
227 Kant TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
228 Kant TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 Kant TTTTTTTTTTTTTCATCTTTGACCC
230 Kant TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
231 Kant GATACAGGAGTGTACTTTTTTTTTTTTTTTT
232 Kant TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
233 Kant GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
234 Kant TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
235 Kant TTTTTTTTTTTTTTTATAGCAATAGCT
236 Handtag AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 Handtag ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
238 Handtag CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 Handtag CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
240 Handtag CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
241 Handtag CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
242 Handtag AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 Handtag CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
244 Handtag CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
245 Handtag TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
246 Handtag AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 Handtag GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
248 Guider AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 Guider ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
250 Guider CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
251 Guider GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
252 Guider AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
253 Guider TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
254 Guider TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
255 Guides Borttagande GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
256 Guides Borttagande GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 Guides Borttagande TAAAACACCGTACTTTAGAACTAAATTGCTACG
258 Guides Borttagande AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 Guides Borttagande CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
260 Guides Borttagande GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
261 Guides Borttagande ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
262 Gates Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
263 Gates Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
264 Gates Gate0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
265 Gates Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

Tabell 1: Förteckning över stapel sekvenseranvänds för att konstruera nanorobot. häftklamrar 1-153 betecknas Core och utgör huvuddelen av strukturen. Häftklamrar 154-235 betecknas kanter och är belägna vid var och en av ändarna hos de 61 helixar av strukturen. Edge häftklamrar innehåller en poly tymin svans syftar till att undvika aggregering av nanorobotar. Staples 236-247 betecknas Handtag och göra upp lastdockningsplatser. Handtag häftklamrar har en unik sekvensregion, som förbinder dem till deras specifika platsen i strukturen, och en konsensussekvens region som används som dockningsställe för last molekylerna. Staples 248-254 betecknas guider och fäst de två halvorna av anordningen under härdningsprocessen. Efter tillverkning guiderna tas bort med tillägg av Guide Removal häftklamrar 255-261 (steg 6), lämnar enheten låst av de två sensorer av nanorobot. Sensor sekvenser betecknas Gates. Var och en av de två sensorerna består av en PDGF-aptamer och en komplementär sträng. För en mer detaljerad instuktionernanation se al. Ben-Ishay et 14 och al. Douglas et 15. häftklamrar beställs kommersiellt på tre 96-brunnsplattor (djup rund botten). Varje stapel belopp normaliseras till 10 nmol. Med undantag för de Gate sekvenser, som kräver HPLC-rening, inte häftklamrar inte kräver en speciell reningsprocedur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Vi beskrev tillverkning, rening, och visualisering av DNA nanorobot. Efter tillverkningen av sexkantiga chassi enheten är funktionen hos nanorobot programmerats med enkel introduktion av specifik last och avkänning strängar till roboten som lätt finner sin utsedda läge på grund av vätebindnings kompletterar med tillgängliga enkelsträngsdockningsplatser 14 , 15,22.

Tillverknings protokoll som beskrivits använder en långsam glödgning ramp, som i allmänhet används i vårt labb att vika ett brett spektrum av origami former. Om produktionstiden blir en nyckelfaktor andra protokoll, såsom den snabba fällbara protokollet beskrivet av Sobczak et al. 24 kan användas. Detta protokoll rapporteras att uppnå origami vikning i höga utbyten, men det kräver kalibrering för varje origami form.

Spin filtrering används för att rena robotarna från överskott häftklamrar. När du laddar de spin-kolonn med prover eller buffert, bör man inte skadar membranet med pipettspetsen. Membranet kan potentiellt brista vilket resulterar i dramatiskt minskad avkastning. Det är lämpligt att inte kasta genomströmning tills nanorobotar visualiseras av AGE.

För vissa program en högre reningshastighet önskas; detta kan uppnås genom upprepning av filtrering med användning av den ursprungliga spinnkolonn. För ännu högre renhet, kan en ny spinnkolonn användas, men detta kommer att ha en dramatisk negativ inverkan på avkastningspriser. Andra metoder för rening av DNA origami strukturer testades, såsom excision från agarosgel efter elektrofores och dialys av överskott häftklamrar. Dessa metoder ledde till antingen dåligt utbyte eller dålig reningshastigheter jämfört med den beskrivna protokollet. Andra metoder, såsom PEG-baserad rening 25 och hastighets zonal ultracentrifugering 26 testades inte. Dessa metoder har rapporterats achiEve hög renings priser, men de antingen resultera i dåliga utbyten (hastighets zoner ultracentrifugering) eller kräva nederbörd (PEG-baserad) som potentiellt kan skada den ihåliga nanorobot form.

Nanorobotar är tillverkade med Guide häftklamrar som låser formen i det stängda läget i syfte att öka tillverknings yeilds 15. Det är viktigt att ta bort dessa klamrar genom att lägga Guide borttagning häftklamrar för nanorobotar för att effektivt öppna som svar på de utformade stimuli (PDGF i den beskrivna protokollet). Guide häftklamrar är utformade med en toehold enkelsträngad region för dockning av Guide Removal häftklamrar som frisätter Guide häftklamrar genom en process av strängförskjutning 18 .Dessa häftklamrar bör tillsättas i en 10: 1 molärt förhållande vid slutet av reningen av överskott häftklamrar 'stadiet (steg 4,7) och inkuberades under 2 h vid rumstemperatur på en ände över ände skakapparat.

Visualisering av TEM beskrevs, including AUC-format 2% negativ färgning. Jämfört med AUC-acetat, producerar AUC-formiat finare kornstrukturer som möjliggör bättre upplösning av DNA-origami mönster. Försiktighet bör iakttas som AUC-format kommer att stelna om portioner fryses under långa tidsperioder. Det är lämpligt att använda en nygjord 2% AUC-formiat lösning för färgning. Bättre upplösning kan uppnås med hjälp av Cryo-TEM 27.

Den grundläggande arkitektonisk design och tillverkning protokoll för DNA-nanorobot är ytterst jämn och okomplicerad. Emellertid är ett brett utbud av flexibilitet som erbjuds i form av särskilda lastblandningar och avkänning strängar. Dessutom i en enda population många subtyper kan införas och deras relativa stökiometrin programmeras och optimeras för att passa specifika behov. Ännu större finjustering av de särskilda kinetiken vid varje hastighetsbegränsande steget kan uppnås med ökande / minska längden på dubbelsträngad hybridisering ellerInförandet av felpassningar vid specifika nyckelpositioner. Denna höga grad av flexibilitet med enkel konstruktion möjliggör konstruktion av nanoskala enheter som kan utföra mycket varierande komplexa uppgifter i ett biologiskt relevant miljö.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att lämna ut.

Acknowledgments

Författarna vill tacka S. Douglas för extremt värdefulla diskussioner och råd, och alla medlemmar i Bachelet labbet för hjälpsamma diskussioner och arbete. Detta arbete stöds av bidrag från fakulteten för biovetenskap och Institutet för Nanoteknik och Advanced Materials vid Bar-Ilan University.

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics