طرق للبشرة إصابة وفحوصات لالردود الجرح في

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

وC. ايليجانس البشرة وبشرة تشكل طبقة الجلد بعد متطورة البسيطة التي يمكن إصلاح الأضرار المحلية الناجمة عن اصابة. لقد أضاءت الدراسات الردود الجرح وإصلاح في هذا النموذج فهمنا للهيكل الخلية وردود الجينومية إلى تلف الأنسجة. طريقتين الأكثر استخداما لالجرح C. ايليجانس الجلد البالغين من الغرزات مع الإبر حقن مكروي، وأشعة الليزر المحلي. إبرة اصابة محليا يعطل بشرة، البشرة، وما يرتبط بها من المصفوفة خارج الخلية، وأيضا قد تضر الأنسجة الداخلية. النتائج أشعة الليزر في الضرر أكثر محلية. جرح يتسبب في سلسلة من ردود يعاير بسهولة بما في ذلك البشرة مرتفعة الكالسيوم 2+ (ثواني دقيقة)، وتشكيل وإغلاق حلقة التي تحتوي على الأكتين في موقع الجرح (1-2 ساعة)، والنسخ مرتفعة من الببتيد الجينات المضادة للميكروبات (2-24 ساعة)، وتشكيل ندبة. أساسا كل نوع البرية الحيوانات الكبار البقاء على قيد الحياة جرح، حيثكما المسوخ المعيبة في إصلاح الجرح أو استجابات أخرى تظهر انخفاض البقاء على قيد الحياة. وتعرض بروتوكولات مفصلة لإبرة وجرح الليزر، وفحوصات لتحديد الكميات والتصور الردود الجروح والعمليات إصلاح (ديناميات الكالسيوم، وديناميات الأكتين، مضادات الميكروبات الببتيد الاستقراء، والبقاء على قيد الحياة).

Introduction

آليات الشفاء الجلد الجروح ذات أهمية بيولوجية أساسية وذات الصلة بصحة الإنسان. ويضم التئام الجروح في الفقاريات والثدييات سلسلة معقدة من استجابات منسقة من أنسجة متعددة ويشير 1. كثير من الكائنات نموذج الجيني بسيطة هي أيضا قادرة على شفاء الجروح الجلدية 2. ولذلك من مصلحة لتحليل نماذج الانقياد وراثيا من إصلاح الجرح الجلد. نحن وغيرنا قد بدأت في استخدام انواع معينة ايليجانس نموذجا جديدا للشفاء الجرح الجلد 3،4. والهدف من هذا البروتوكول هو تمكين مجموعة أوسع من الباحثين لاستخدام C. ايليجانس كأداة للتحقيق في الآليات الجزيئية والخلوية من البشرة التئام الجروح.

وC. ويضم ايليجانس الجلد البشرة (المعروف أيضا باسم اللحمة) وبشرة خارج الخلية 5. يتم تشكيل البشرة الكبار من عدد صغير من syncytia متعدد النوى، والتي من أكبر هو مخلى كnown كما hyp7. البشرة هي ظهارة البسيطة التي تفرز بشرة على سطحه قمي. الجلد يمكن أن يدافع بنشاط ضد مسببات الأمراض اختراق الجلد وإصلاح الجروح الصغيرة (4). إصلاح الجرح من C. ايليجانس الجلد هو قوي، وتقريبا جميع الحيوانات البرية نوع البقاء على قيد الحياة يمكن البقاء على قيد الحياة الجروح الصغيرة الناجمة عن الإبر، أو تلف الجلد المحلية التي تسببها أشعة الليزر. C. ايليجانس جرح الجلد مشغلات مجموعة من الردود، بما في ذلك البشرة استجابة فطرية المناعة، وإغلاق الجروح، وتشكيل ندبة 4. البشرة البالغين في مرحلة ما بعد الإنقسامية، وينطوي على التئام الجروح الاستجابات الخلوية المحلية في مقابل انتشار البشرة أو الهجرة الخلية. لقد أثبتنا أن جرح الجلد يتسبب في زيادة كبيرة ومطردة في البشرة الكالسيوم 2+، الأمر الذي يتطلب قناة TRPM غشاء تحويل الغاز إلى سوائل-2 والداخلية الكالسيوم 2+ مخازن 3. مطلوب البشرة الكالسيوم 2+ إشارة لتشكيل وإغلاق حلقات F-أكتين في التعليم الجامعيالموقع اوند. كما يدفع جرح الاستجابات المناعية الفطرية التي تنشط النسخ من المكاتب الإقليمية للمرأة مثل البرمجة اللغوية العصبية-29. النسخ الناجم عن جرح المكاتب الإقليمية للمرأة يعتمد على TIR-1 / PMK-1 P38 MAP كيناز سلسلة يتصرف بشكل مستقل في البشرة 4. سوف العيوب سواء في إشارة مسار الكالسيوم 2+ أو في الاستجابة المناعية الفطرية يؤدي إلى انخفاض البقاء على قيد الحياة بعد إصابة. هيكل بسيط نسبيا من C. ايليجانس البشرة، قابلية الإستطراق الجيني والمزايا لفي الجسم الحي التصوير تجعل من نظام ممتاز لدراسة جوانب متعددة من إصلاح الجرح.

هنا نقدم بروتوكولات الطرق الشائعة اثنين من جرح: جرح إبرة وجرح الليزر. جرح إبرة لا يتطلب أي معدات متخصصة (غير مجتذب إبرة)، ومع خبرة لا يمكن أن يؤديها على مئات من الديدان يوميا. يتم تنفيذ جرح إبرة على الحيوانات التي تنمو على لوحات أجار. في المقابل، يتم إجراء جرح الليزر على أنيسالحيوانات thetized التي شنت على أجار منصات تحت ساترة، ومناسب للتصوير المباشر لالاستجابات الخلوية للتلف.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

البروتوكولات التالية تصف إجراءات تفصيلية لC. ايليجانس الجلد إصابة ومعايرة ردود الجروح.

1. إبرة إصابة 3،4

  1. تنمو الديدان unstarved صحية على معيار NGM (الخيطية المتوسطة النمو) لوحات مع E. البكتيريا القولونية OP50 المواد الغذائية والاحتفاظ بها في 20 ° C الحاضنة.
    ملاحظة: طرق لNGM لوحات أجار وزراعة الروتينية للC. ايليجانس ويمكن الاطلاع على www.wormbook.org 6.
  2. اختيار 25 L4 مرحلة الديدان إلى المصنف حديثا لوحة 1 قبل يوم من اصابة والثقافة في 20 ° CO / N.
  3. قبل اصابة، وسحب الإبر من الشعيرات الدموية باستخدام مجتذب الإبرة. الإبر المستخدمة في إصابة مماثلة لتلك المستخدمة ل microinjection من C. ايليجانس.
  4. التأكد من أن جميع الديدان هي في مرحلة الشباب البالغين. وضع لوحة من الديدان على الجليد لمدة حوالي 30 دقيقة. يسبب تبريد الحيوانات ليكون بطيئا، مما يسهل إصابة الإبرة.
  5. إزالة لوحة آغار من الجليد إلى stereomicroscope تشريح. باستخدام معول دودة، نقل 25 الديدان في وسط لوحة أجار.
  6. ضع الإبرة في طرف ماصة 100 ميكرولتر لعقد أكثر سهولة الإبرة. ثقب الأمامي أو الخلفي جزء من جسم الدودة مع الإبرة، وتجنب الغدد التناسلية. بشكل عام، محاولة الجرح بين البلعوم الخلفي والأمامي الغدد التناسلية، أو بين الغدد التناسلية الخلفي والمستقيم. إعادة استخدام الإبر مرات عديدة، حتى كسر.
    ملاحظة: تأكد من الجروح وجيزة، الغرزات لطيف أن ثقب بشرة والجلد، واختراق ~ 5-10 ميكرون إلى الحيوان. يجب أن الإبرة يدخل أنيمالقاعدة في حوالي الزاوية اليمنى للجلد. الجراح لا ينبغي أن يسبب ضرر واضح في الأعضاء الداخلية، أو تمزق فوري من الجسم. مراقبة كمية صغيرة من السيتوبلازم ناز من لبضع ثوان بعد الجرح. ومع ذلك، إذا محتويات الخلوية تسرب على مدى فترة طويلة من الوقت فإن الحيوانات لا البقاء على قيد الحياة. للتصوير الأمثل، والجرح ومخلى الجانبي البشرة (hyp7) أو التماس الجانبي.
    ملاحظة: يتضمن هذا الإجراء استخدام إبرة الزجاج.
  7. السماح لاسترداد الديدان في RT ثم الثقافة عند 20 درجة مئوية. الحكم على نجاح جرح إبرة من قبل عدد من المقايسات هو موضح أدناه. أكثر من 95٪ من الحيوانات البرية نوع البقاء على قيد الحياة 24 ساعة بعد إبرة جرح في مرحلة الشباب البالغين. تأثير اصابة في اليرقات أو البالغين الأكبر سنا لم يتم تحليلها على نطاق واسع.

2. الليزر إصابة 3

استخدام أشعة الليزر الفيمتو ثانية (800 نانومتر) لأداء جرح أكثر دقة.

  1. تحضير ص أجارالإعلانات على شريحة زجاجية مع ذاب 2٪ أجار 7. ضمان منصات مماثلة لمنصات آغار المستخدمة في التصوير المباشر لC. ايليجانس.
  2. نقل 10 الديدان البالغة الشباب على لوحة الاغاروز مع دودة اختيار، وإضافة قطرة 2 ميكرولتر من 12 ملي الليفاميزول الحل. تغطية الحيوانات والسائل مع انزلاق الغطاء. الانتظار 1-2 دقائق للديدان تهدف إلى شل.
  3. ضع شريحة زجاجية على المجهر الغزل القرص مبائر. نقل المرحلة للعثور على الديدان والتركيز على الجزء الأمامي أو الخلفي المخلوي البشرة الجانبية مع الهدف 100X (NA 1،4 حتي 1،46).
  4. تعيين قوة ليزر الفيمتو ثانية إلى 140 ميغاواط (تقاس قبل الهدف). استخدام ليزر الفيمتو ثانية بمعدل تكرار 80 ميغاهرتز.
    ملاحظة: اثنان نبضات من كل 200 مللي ثانية (مفصولة 20 ميللي ثانية) كافية لاصابة في أيدينا.
  5. التركيز على السطح القمي الخلية البشرة والجرح البشرة. نلاحظ اضطراب المحلي من السيتوبلازم (محتدما)، أو تبيض المحلي سو أي علامة فلوري المستخدمة.
    ملاحظة: اتبع إجراءات السلامة المناسبة عند استخدام الليزر ليزر الفيمتو ثانية. يجب أن خط أو نقطة المسح باستخدام أشعة الليزر الفيمتو ثانية مثل تلك الموجودة في اثنين من المجاهر الفوتون توفير الطاقة الكافية لجرح الليزر.
    ملاحظة: على الرغم من أننا لا نملك خبرة مباشرة باستخدام الليزر الأخرى، في إصابة المبدأ يجب أن يكون من الممكن استخدام أشعة الليزر فوق البنفسجية التقليدية (كما تستخدم في C. ايليجانس ablations الخلية). اختياريا، واستخدام الاسترداد الإسفار بعد photobleaching من (FRAP) وحدة في الغزل مبائر القرص إلى الجرح البشرة (N. بوجول، اتصال شخصي).

3. التصور من الردود البشرة الكالسيوم 2+ إلى إصابة

  1. استخدام المعدلة وراثيا C. ايليجانس السلالات التي تعبر عن الكالسيوم 2+ أجهزة الاستشعار (مثل تلك من سلسلة GCaMP) في البشرة، تحت سيطرة المروج محدد البشرة الكبار العقيد-19 (الشكل 1A، وترد في الجينات المحورة ملاحظة: لقد استخدمنا tdTomato باعتبارها الرقابة الداخلية لالتحوير التعبير البشرة tdTomato مضان مستقرة نسبيا ولا تتداخل مع GCaMP التصوير.
  2. كلا إبرة والليزر اصابة الزناد الكالسيوم 2+ الارتفاع في البشرة. لكن، وكما جرح إبرة لا يمكن أن يؤديها بسهولة على قرص متحد البؤر الغزل وجرح الليزر هو الأفضل للتحليل الكمي من الكالسيوم 2+ استجابة (الشكل 1).
  3. الحصول على صور مرور الوقت في وضع الاستحواذ متعدد الأبعاد (الوقت الفاصل 2 ثانية مع 114 مللي ثانية التعرض ليزر الإثارة) باستخدام القرص مبائر الغزل مع الهدف 100X (NA 1،4 حتي 1،46)، ومجموعات مرشح المناسبة (الفلاتر GFP ستعمل لGCaMP3).
    ملاحظة: الحصول على صور الوقت الفاصل بين كل 30 ثانية لحوالي 2 ساعة لدراسة التركيب الكالسيوم 2+onse لاصابة خلال دورة قتا أطول.
  4. باستخدام برنامج تحليل الصور قياس متوسط ​​مضان GCaMP في عشر مناطق تعادل الفائدة (ROI)، خمسة منها تتركز على العصارة الخلوية الخلية البشرة وخمسة في الخلفية.
  5. الحصول مضان خط الأساس (F 0) عن طريق حساب متوسط ​​مضان في 5 رويس في البشرة ثم طرح المتوسط ​​من 5 رويس في الخلفية قبل الإصابة. التعبير عن التغير في مضان ΔF حيث أن نسبة التغيير فيما يتعلق خط الأساس [(F ر -F 0) / F 0].

4. التصور من F-الأكتين ديناميات بعد إصابة

  1. ملاحظة: ردا على إصابة الإبرة، ومراقبة حلقة الأكتين في موقع الجرح الذي يغلق تدريجيا حول الجرح. هذا القسم بروتوكول فحوصات الجرح إغلاق طريق قياس قطرها حلقة الأكتين.
  2. تولد الديدان المعدلة وراثيا التي تعبر عن علامة F-أكتين مثل moesin الأكتين نطاق ذبابة الفاكهة ملزم تنصهر لGFP، أعرب تحت سيطرة المروج محدد البشرة مثل عمود-19 (الشكل 2A) (التحوير juIs352).
    ملاحظة: لقد حصلنا على نتائج مماثلة باستخدام الأكتين الأخرى ملزمة علامات نطاق مثل Lifeact أو F-tractin (نتائج غير منشورة).
  3. أداء إبرة اصابة في العمود P-19--GFP moesin الديدان المعدلة وراثيا. بعد إصابة الإبرة، ومراقبة حلقة من GFP-moesin حول موقع الجرح بواسطة ~ 5 دقائق. حلقة الأكتين يصبح أصغر في قطر وفي النهاية يغلق 2-3 ساعة بعد اصابة في الحيوانات البرية نوع (الشكل 2A).
  4. إعداد لوحة أجار 2٪ على شريحة زجاجية ونقل 10 الديدان على لوحة في 2 حل ميكرولتر 12 ملي الليفاميزول. صورة حلقات GFP-moesin 1 ساعة بعد اصابة باستخدام متحد البؤر المجهري التقليدي.
    ملاحظة: استخدام المجهر متحد البؤر لاكتساب-مداخن ض (13 × 0.5 ميكرون) من حلقات الأكتين 1 ساعة بعد اصابة.
  5. قياس قطرها حلقة الأكتين بعد اصابة. ل quantitate البشرة GFP-moesin، تأكد أولا من الإسقاط كثافة الأقصى للض المكدس ثم رسم 4 بمسح الخط (في 45 ° إلى بعضها البعض) خلال حلقة GFP-moesin. ويعرف القطر الدائري حيث بلغ متوسط ​​الذروة إلى الذروة المسافة من مسح أربعة أسطر (الشكل 2B). لحلقات التي أغلقت بالفعل، ويعرف القطر ك 0 ميكرون.
    ملاحظة: F-أكتين حلقات تقاس مريح 1 ساعة بعد اصابة لأن هذا هو ما يقرب من نصف الطريق من خلال عملية إغلاق الجرح في النوع البري. كما يمكن قياس حلقات F-الأكتين في نقاط زمنية متعددة لاستخلاص دورة وقت إغلاق الجرح. الأفلام مرور الوقت من إغلاق الجرح يمكن الحصول عليها باستخدام الديدان يجمد الليفاميزول والغزل القرص المجهري متحد البؤر.

5. الفحص تحريض البشرة مضادات الميكروبات الببتيدات

يطلق إصابة أيضا الاستجابات المناعية الفطرية في C. ملاحظة: ايليجانس الجلد. نسخ من الجينات التي تكود الببتيدات المضادة للميكروبات (إس) هو دائرة الهجرة والجنسيةuced في البشرة. هو فعل من (البروتين مثل نيوروببتيد) AMP البرمجة اللغوية العصبية-29 بقوة اصابة 4. لفحص كيف تسيطر على البشرة AMP التعبير بعد جرح، استخدم صحفيين المعدلة وراثيا أو في الوقت الحقيقي PCR للكشف عن الفردية مستويات النص AMP.

  1. المعدلة وراثيا فحص مراسل الاستجابة المناعية الفطرية للاصابة 4.
  2. أداء جرح إبرة (كما في بروتوكول 1) في الحيوانات البالغة معربا عن مراسل المعدلة وراثيا frIs7، والذي يحتوي P البرمجة اللغوية العصبية-29- GFP وP-12- العقيد DsRed باعتبارها الرقابة الداخلية. مراقبة الحيوانات الكبار المعافين الظلام كما حمراء أو برتقالية في GFP تمريرة طويلة التصفية.
    ملاحظة: سوف إصابة البرية من نوع الديدان لحث P البرمجة اللغوية العصبية-29 -GFP التعبير لكنها لن تؤثر P-12 عمود -dsRed، مما أدى إلى الديدان التي تظهر البرتقالي والأصفر، أو الأخضر تحت GFP تمريرة طويلة الإضاءة. فقدان وظائف الجينات في مسار P38 MAPK، مثل PMK-1 أو nsy-1 سيتم منع البرمجة اللغوية العصبية-29 -GFPالحث بعد اصابة 4. يتم التعبير عن GFP P البرمجة اللغوية العصبية-29- عند مستويات مرتفعة في مراحل اليرقات
  3. أداء AMP المقايسات التعريفي في الحيوانات الشباب البالغين. تأكد من أن الحيوانات السيطرة المعافين لديهم مستويات منخفضة من GFP.
    هو فعل P البرمجة اللغوية العصبية-29- GFP التعبير أيضا عن طريق الضغط الاسموزي ويمكن أن تكون حساسة للضغوط البيئية الأخرى: ملاحظة.
  4. 6 ساعة بعد إصابة، يسجل أعداد الديدان التي لديها P البرمجة اللغوية العصبية-29 -GFP الاستقراء (الشكل 3) 9 باستخدام مضان تشريح النطاق مع GFP تمريرة طويلة التصفية.
    ملاحظة: في وبفعل 1 ساعة بعد اصابة P البرمجة اللغوية العصبية-29- GFP بشكل واضح، وبلغ ذروته حوالي 6 ساعة بعد إصابة ومن ثم تبقى مرتفعة تصل إلى 24 ساعة بعد إصابة. تحديد التعبير من خلال التهديف 4،9 البصري. بدلا من ذلك، تحديد مستويات التعبير باستخدام مضان تنشيط دودة فارز 4. لفارز دودة، لا بد من الجرحى لا يقل عن 50 الحيوانات.
  5. في الوقت الحقيقي PCR مقايسة للغنى عنهntitating مستويات النص من الجينات AMP الفردية. مستويات النص الفحص لعدة جينات: البرمجة اللغوية العصبية-29، البرمجة اللغوية العصبية-30، باستخدام الحاسب الآلي-1، والتصنيع باستخدام الحاسب الآلي-5.
  6. أداء إبرة اصابة في البرية من نوع أو الديدان متحولة (انظر البروتوكول 1)
  7. جمع 50 الديدان الجرحى و50 الديدان المعافين في الأوقات المطلوبة (على سبيل المثال 3، 6، 24 ساعة) بعد إصابة.
  8. استخراج الحمض النووي الريبي باستخدام طقم التجارية باتباع إرشادات الشركة المصنعة.
  9. أداء النسخ العكسي للحصول على مجموع 20 ميكرولتر [كدنا استخدام عدة الناسخ العكسي التجارية.
  10. لRT-PCR، استخدم 0.2 ميكرولتر [كدنا] (1/40) من كل عينة في توليفة مع supermix الأخضر مع فلوريسئين و 0.2 ميكرومتر الاشعال. لمقارنة جودة RNA، استخدم AMA-1 أو البنك المركزي السويسري-1 RT-PCR كمرجع. وAMP مستوى التعبير النسبي والمقارنة بينها حسب تطبيع إلى الرقابة الداخلية (AMA-1 أو البنك المركزي السويسري-1)، أو مقارنة تحريض أضعاف ما بعد جرح (AMP التعريفي في الديدان الجرحى / الديدان المعافين) من قبل القاعدةalizing إلى الرقابة الداخلية.
    ملاحظة: CNC-1 و التصنيع باستخدام الحاسب الآلي-5 وcaenacin الببتيدات المضادة للميكروبات الأسرة التي يتم تفعيلها من خلال جرح 10 النسخ. عادة، جرح إبرة يستحث التعبير (~ 500 أضعاف عن التصنيع باستخدام الحاسب الآلي-1) على مدار الساعة من 4 ساعة 10. وترد الاشعال المستخدمة في الأعمال المنشورة في الجدول 2.

6. الفحص البقاء على قيد الحياة بعد إصابة

  1. ملاحظة: إصابة ينشط اثنين على الأقل من مسارات إشارات مستقلة في البشرة: كا 2+ الجرح تعتمد إصلاح مسار ومسار الفطرية الاستجابة المناعية. كلاهما مطلوب مسارات للبقاء الكامل من إصابة معقمة. لاختبار ما إذا كان متحولة أو المعاملة رني يؤثر التئام الجروح، وقياس البقاء على قيد الحياة في 24-48 ساعة بعد إصابة. اختياريا، واستخدام المقايسات عمر التقليدية لتحديد تأثير إصابة على طول العمر 4،9.
  2. أداء إبرة إصابة على الشباب البالغين (L4 + 24 ساعة) الديدان (50 الديدان، كرر سفمرات راؤول) بعد بروتوكول 1 أعلاه. الحفاظ على عدد مساو من الديدان المعافين والضوابط.
  3. تحقق من البقاء على قيد الحياة كل 24 ساعة (نقل الديدان الجرحى إلى لوحة آغار جديدة كل 24 ساعة). نلاحظ ~٪ البقاء على قيد الحياة 50 24 ساعة بعد اصابة في المسوخ التي هي معيبة في إصلاح الجرح مثل تحويل الغاز إلى سوائل-2 أو النقل البري الدولي-1، عندما تطبيع للحيوانات السيطرة المعافين. ويعرف الموت وعدم وجود استجابة الحركي للمس من قبل دودة الاختيار.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

سوف الليزر أو جرح إبرة يؤدي الارتفاع السريع والمستمر في البشرة مستويات الكالسيوم، كما تصور مع أجهزة استشعار الكالسيوم مثل GCaMPs (الشكل 1). يحدث ارتفاع الكالسيوم في غضون ثوان، ويبقى مرتفعا لعشرات من الدقائق. إبرة اصابة بتكاثر النتائج في تشكيل حلقات F-أكتين في مواقع الجرح (الشكل 2)؛ هذه تظهر في غضون دقائق، وتدريجيا على مقربة أكثر من 1-2 ساعة بعد اصابة. وكثير من الأحيان أقل شكلت حلقات الأكتين بعد إصابة الليزر أكثر دقة. كلا إبرة والليزر جرح تحفز التعبير عن البشرة الببتيدات المضادة للميكروبات (إس) مثل البرمجة اللغوية العصبية-29، الكشف مع الصحفيين النسخي (الشكل 3). AMP تحريض واضح خلال 2-4 ساعة بعد اصابة ويستمر حوالي 24 ساعة. جرح إبرة من النوع البري لا يجب أن تؤثر تأثيرا كبيرا الجدوى (قياس في 24 ساعة بعد إصابة) أو مدى الحياة.

الشكل (1)
الشكل 1. الليزر جرح يتسبب في 2+ استجابة الكالسيوم في C. البشرة ايليجانس. (A) البشرة GCaMP3 مضان (P-19 عمود -GCaMP3 (juIs319)) مستويات بعد الفيمتو ثانية جرح الليزر. عرض الوحشي من البشرة في الأمامي للجسم. س، الجرح الليزر. N، البشرة النواة. الغزل القرص مبائر الصور، رمز الشدة. UW: المعافين، W: الجرحى (B) الكميات من GCaMP3 ΔF / F 0 في 20، 40، و 60 ميكرون من موقع الجرح. أثر تمثيلي. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2. إبرة جرح مشغلات الأكتين البلمرة حول الموقع الجروح. (A) P-19- العقيد GFP-moesin (juIs352). على نطاق و: 10 ميكرون. UW: المعافين، W:.. جريحا (B) الكميات من قطر حلقة الأكتين من مسح الخط، 4 بمسح خط لكل حيوان (منقط الخطوط الحمراء في لوحة (A)، WT) الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل 3. البشرة جرح ينشط الاستجابة المناعية الفطرية. صور الممثل (WT المعافين، وأصيب WT + 3 ساعة) من البرمجة اللغوية العصبية P-29 -GFP (frIs7) الحث بعد إصابة الإبرة. مقياس: 200 ميكرون الرجاء انقر هنا لعرضنسخة أكبر من هذا الرقم.

مراسل صحفي التحوير مضان أليل
الكلسيوم Pcol-19-GCaMP3، Pcol-19-tdTomato GFP / tdTomato juIs319 X
الأكتين Pcol-19-GFP :: moesin GFP juIs352 I
البرمجة اللغوية العصبية-29 Pnlp-29-GFP / Pcol-12-DsRed GFP / DsRed frIs7 IV

الجدول 1. الجينات المحورة المستخدمة في المقايسات استجابة الجروح. هذا الجدول يسرد صبغويا الجينات المحورة المتاحة في مركز علم الوراثة انواع معينة (http://www.cbs.umn.edu/research/resources/cgc) متكاملة.

اسم الجين تسلسل
البرمجة اللغوية العصبية-29 F: cttctcgcctgcttcatggc
R: gtccgtatccaccatatcctcc
البرمجة اللغوية العصبية-30 F: TTCTTCTCGCCTGCTTCATGG
R: CATAACCTCTACCATATCCACCG
التصنيع باستخدام الحاسب الآلي-1 F: gccattgtcgccatttcctc
R: cctccatacattggatatcctc
التصنيع باستخدام الحاسب الآلي-5 F: CTTCTTCTAGCAATGCTCGCTC
R: GTATCCTCCACCATACCCTCC
AMA-1 F: ACTCAGATGACACTCAACAC
R: GAATACAGTCAACGACGGAG
البنك المركزي السويسري-1 F: tccagcagacacaagctcagg
R: gagacaacttctgatcacgctc

الجدول 2. الاشعال تستخدم لRT-PCR النصوص AMP. تركيز العمل هو 0.2 ميكرومتر. ويقدم البنك الوطني السويسري-1 كما الرقابة الداخلية.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

الأساليب المقدمة هنا للإبرة وجرح الليزر توفر نهج تكميلية لتقييم قدرة ظهارة البشرة لإصلاح الضرر. جرح الليزر محلية نسبيا و(اعتمادا على تكوين ليزر) يمكن أن تقتصر على البشرة، في حين جرح إبرة يعطل البشرة، بشرة، والمرجح الأغشية الطابق السفلي الداخلية. إبرة جرح قد تشبه بشكل أكثر دقة الجراح التي مسببات الأمراض أو الأضرار الميكانيكية في البيئة الطبيعية التي لحقت. وكقاعدة عامة، تتطلب جرح إبرة مزيد من الممارسة لتحقيق الجروح الدقيقة التي تتوافق مع بقاء الحيوان. والاستجابات الخلوية إلى إبرة والليزر عرض جرح أوجه التشابه كثيرة. ومع ذلك فإنه تجدر الإشارة إلى أن تشكيل حلقات الأكتين لا وحظ بتكاثر بعد الفيمتو ثانية جرح الليزر.

وجود قيود على ثقب إبرة هو أنه ليس الجرح الدقيق: الإبرة أيضا الأنسجة الداخلية الأضرار التي لدودة مساهماتلم يتم التحقيق في البقاء على قيد الحياة. ومن شأن تعديل ممكن من هذا البروتوكول هو الجمع بين القائم ميكروفلويديك نظام حقن مكروي 11 و صحفيين الفلورسنت لأداء جرح المادية أكثر دقة.

الطرق جرح إبرة والليزر مفصلة هنا هي بسيطة لكنها إلى حد ما على العمالة المكثفة، وفي أحسن الأحوال المتوسطة الإنتاجية، مما يجعل من الصعب استخدام النهج الجينومية أو البيوكيميائية لتوصيف استجابة الجرح. يمكن أن يتم تسليم بشرة اختراق مسببات الأمراض مثل الفطريات أو الطفيليات 12،13 إلى السكان أكبر من الحيوانات، والتي قد تؤدي الاستجابات التي تتداخل مع الاستجابة للإصابة، بعد إدخال تعقيدات إضافية من استجابات محددة الممرض. سوف تكون هناك حاجة إلى مزيد من العمل لاستكشاف ما إذا كانت أساليب غير الحيوية الأخرى مثل القصف الباليستي 14 أو صفائف هياكل ثقب الميكرو ميكانيكية 15 يمكن تكييفها لجرح على نطاق واسع.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics