Методы для кожи телесные повреждения и анализы для заживления ответы в

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

C. Элеганс эпидермис и кутикула образует простой, но сложный слой кожи, который может исправить локализованное повреждение в результате ранения. Исследования ответов раны и ремонта в этой модели с подсветкой наше понимание цитоскелета и геномных ответов на повреждение ткани. Два наиболее часто используемые методы ранить С Элеганс взрослых кожей уколы с микроинъекции иглы и локальном лазерном облучении. Игла ранение локально разрушает кутикулу, эпидермис и внеклеточный матрикс, связанный, а также может привести к повреждению внутренних тканей. Результаты лазерного облучения в более локализованной повреждений. Ранение вызывает последовательность легко определить реакции, включая повышенной эпидермиса Ca 2+ (секунды-минуты), формирование и замыкании актин-содержащие кольца на месте раны (1-2 ч), повышенная транскрипции антимикробных генов пептид (2-24 ч), и формирование рубца. Практически все взрослые животные дикого типа выжить ранения, гдекак мутанты с дефектом в заживления раны или других ответов показывают снижением выживаемости. Подробные протоколы для иглы и лазерной ранения, и анализы для количественного и визуализации раневых реакций и процессов репарации (Ca динамики, динамики актина, антимикробной индукции пептидов и выживания) представлены.

Introduction

Кожные заживления ран механизмы основных биологических интереса и отношение к здоровью человека. Заживление ран у позвоночных и млекопитающих представляет собой сложную серию скоординированных реакций многих тканях и сигнализации 1. Многие простые генетические модели организмы также способны заживления ран кожи 2. Поэтому представляет интерес анализ генетически послушный модели кожной раны ремонта. Мы и другие начали использовать Caenorhabditis Элеганс как новая модель кожной раны исцеление 3,4. Цель этого протокола заключается в обеспечении более широкого набора исследователям использовать C. Элеганс как инструмент для исследования молекулярных и клеточных механизмов эпидермиса заживления ран.

C. Элеганс кожи включает в себя эпидермис (также известные как гиподермы) и внеклеточный кутикулу 5. Взрослые эпидермиса образуется из небольшого числа многоядерных синцитиев, из которых крупнейшим является синцитиально кNown как hyp7. Эпидермис просто эпителий, что выделяет кутикулу на вершинной поверхности. Кожа может активно защищаться от кожи, проникая патогенов и ремонта небольших ран 4. Рана ремонт С Элеганс кожа является надежным, так как почти все дикие типа животных выжить могут выжить небольшие проколы, вызванные иглами, или локальное повреждение кожи под действием лазерного облучения. C. Элеганс кожи ранение вызывает набор ответов, в том числе эпидермального врожденного иммунного ответа, заживления раны и образования рубца 4. Взрослые эпидермис постмитотическими, и заживление ран включает в себя местные клеточные реакции в отличие от распространения эпидермиса или миграции клеток. Мы показали, что кожа ранение вызывает большой и устойчивый рост в эпидермальных Ca 2+, требуя мембрана TRPM канал GTL-2 и внутренние Ca 2+ магазины 3. Сигнал эпидермального Ca 2+ необходим для формирования и закрытия F-актина колец на WOунд сайт. Ранение также вызывает врожденные иммунные реакции, которые активируют транскрипцию АМП, такие как НЛП-29. Ранений, вызванных транскрипции усилителей зависит от МДП-1 / ПМК-1 р38 МАР-киназы каскада, действующего автономно в эпидермисе 4. Дефекты в любом сигнального пути Ca 2+ или в врожденного иммунного ответа приведет к снижению выживаемости после ранения. Относительно простой структурой С. Элеганс эпидермис, его генетический уступчивость и преимущества для в естественных изображений делают его отличным систему для изучения различных аспектов заживления ран.

Здесь мы представляем протоколы для двух распространенных методов ранения: иглы ранения и лазерной ранения. Игла ранение не требует специального оборудования (кроме иглы съемника), а с опытом можно выполнить на сотни червей в день. Игла ранения осуществляется на животных, растущих на чашках с агаром. В отличие от этого, лазерное нанесение ран выполняется на Anesthetized животные установлен на агар Рамки под покровное, и подходит для живого изображения клеточных реакций на повреждение.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Следующие протоколы описывают детальную процедуру для C. Элеганс кожи ранив и анализироваться в раны ответов.

1. Игла Ранение 3,4

  1. Расти здоровыми unstarved червей на стандартный НГО (нематода среднего роста) пластин с Е. палочка OP50 бактерии, как продукты питания, поддерживаемые в 20 ° C инкубатора.
    ПРИМЕЧАНИЕ: Методы NGM пластин агара и рутинной культивирования С. Элеганс можно найти на www.wormbook.org 6.
  2. Выберите 25 L4 стадии червей только что засеянного пластина 1 сутки до ранив и культура при 20 ° CO / N.
  3. Перед ранив, тянуть иглы из капилляров с помощью иглы съемник. Иглы, используемые в ранении идентичны тем, которые используются для микроинъекции С Элеганс.
  4. Убедитесь, что все черви в молодом взрослом. Место пластины червей на льду в течение 30 мин. Охлаждение вызывает у животных будет медленным, облегчая иглы ранения.
  5. Снимите агаризованной от льда рассекает стереомикроскопа. Использование червей выбор, двигаться 25 червей в центр чашки с агаром.
  6. Поставьте иглу в пипетки 100 мкл легче держать иглу. Прокол передней или задней части тела червя с иглой, избегая гонады. В общем, пытаться наматывают между задней глотки и передней гонад, или между задней гонад и прямой кишки. Повторное использование игл много раз, пока они не сломаться.
    ПРИМЕЧАНИЕ: Убедитесь, что раны краткие, нежные уколы, что прокол кутикулы и кожи, проникая ~ 5-10 мкм в животное. Игла должна войти в Анималь приблизительно под прямым углом к ​​коже. Раны не должно вызывать видимых повреждений внутренних органов, или немедленного разрыва корпуса. Соблюдайте небольшое количество цитоплазмы, которая сочится в течение нескольких секунд после раны; Однако, если клеточного содержимого просочиться в течение длительного времени животные не выживут. Для оптимальной визуализации, ранить боковую эпидермальный синцитий (hyp7) или боковой шов.
    Примечание: Эта процедура включает в себя использование стеклянной иглы.
  7. Разрешить червей для восстановления при комнатной температуре тогда культура при 20 ° C. Судите успех иглы ранения со стороны ряда анализов, описанных ниже. Более 95% от животных дикого типа выживают 24 ч после иглы ранение в молодой взрослой стадии. Эффект ранение в личинок или пожилых людей еще не были широко проанализированы.

2. Лазерная Ранение 3

Используйте фемтосекундного лазерного излучения (800 нм) для выполнения более точного ранения.

  1. Подготовка агара рРеклама на предметное стекло с растопленным 2% агара 7. Убедитесь, что колодки похожи на чашках с площадок, используемых для живого изображения С. Элеганс.
  2. Трансфер 10 молодых взрослых червей на агарозном площадку с червячной выбор, и добавить каплю 2 мкл 12 мМ раствора левамизол. Обложка животных и жидкости с покровным. Подождите 1-2 минуты для червей, чтобы парализовать.
  3. Поместите предметное стекло на вращающийся диск конфокальной микроскопии. Перемещение на сцену, чтобы найти червей и сосредоточиться на боковых передних или задних синцитиальных эпидермиса с целью 100X (NA 1.4-1.46).
  4. Установите мощность фемтосекундного лазера до 140 мВт (измеряется до цели). Используйте фемтосекундного лазера с частотой повторения 80 МГц.
    ПРИМЕЧАНИЕ: Два импульсы 200 мс каждый (разделенных на 20 мс) являются достаточными для ранив в наших руках.
  5. Фокус на апикальной поверхности клетки эпидермального и наматывают на эпидермис. Соблюдайте локального разрушения цитоплазмы (пузырьков), или в местную отбеливания OГде: Любая флуоресцентным маркером используется.
    ПРИМЕЧАНИЕ: Следуйте соответствующим процедурам безопасности Лазерная при использовании фемтосекундного лазера. Линии или точки сканирования с использованием фемтосекундных лазеров, такие как те, в двух фотонных микроскопов должны обеспечивать достаточную мощность для лазерной ранения.
    ПРИМЕЧАНИЕ: Хотя мы не имеем непосредственный опыт использования других лазеров, в принципе ранения должна быть возможность с помощью обычных УФ лазеров (как это используется в C. Элеганс клеток абляции). Возможно, использовать флуоресценции восстановления после фотообесцвечивания модуль (FRAP) на вращающемся диске конфокальной ранить эпидермис (Н. Пуйоль, личное сообщение).

3. Визуализация эпидермальный Ca 2+ Ответы на причинение телесных повреждений,

  1. Используйте трансгенных C. Elegans штаммы, экспрессирующие Ca2 + датчики (например, те из серии GCaMP) в эпидермисе, под контролем взрослых эпидермального специфического промотора Col-19 (фиг 1A; трансгены, перечисленные в ПРИМЕЧАНИЕ: Мы использовали tdTomato в качестве внутреннего контроля для экспрессии трансгенов в флуоресценции эпидермальный tdTomato является относительно стабильным и не мешает визуализации GCaMP.
  2. И игла и лазерной ранив триггер Ca 2+ высоты в эпидермисе. Однако, как игла ранение не может быть легко выполнена на вращающемся диске конфокальной, лазерная ранение является предпочтительным для количественного анализа Ca 2+ ответа (Рисунок 1).
  3. Приобретать покадровой изображения времени в многомерном режиме сбора (интервал времени 2 сек с 114 мс возбуждения лазерного воздействия) с использованием вращающийся диск конфокальной с 100X цели (NA 1.4-1.46) и соответствующие наборы фильтров (GFP фильтры будут работать на GCaMP3).
    ПРИМЕЧАНИЕ: Приобретите ЗАМЕДЛЕННАЯ изображений каждые 30 сек около 2 часов, чтобы исследовать Ca 2+ соотвonse с ранением в течение более длительного времени, конечно.
  4. Использование программного обеспечения для анализа изображений измеряют среднюю флуоресценции GCaMP в десять приравненных к ним местностях, представляющих интерес (ROI), пять из которых сосредоточены на эпидермальный цитозоле клеток и пять в фоновом режиме.
  5. Собрать основную флуоресценции (F 0) путем усреднения флуоресценцию в 5 трансформирования в эпидермисе затем вычесть среднее 5 трансформирования в фоновом режиме, прежде чем травмы. Экспресс изменение флуоресценции; F как отношение изменения по отношению к базовой линии [(F T -F 0) / F 0].

4. Визуализация F-актина Динамика после ранения

  1. Примечание: В ответ на иглы ранения, наблюдается актина кольцо в месте раны, которые постепенно закрывает вокруг раны. В этом разделе протокол анализы закрытия раны путем измерения диаметра актина кольцо.
  2. Создание трансгенных червей, которые выражают F-актин маркер, такой как дрозофилы moesin актина связывающего домена, слитого сGFP, экспрессируется под контролем специфического промотора эпидермальной таких как Col-19 (фиг.2А) (трансгена juIs352).
    ПРИМЕЧАНИЕ: Мы получили аналогичные результаты, используя другие актин связывающий маркеры домена, таких как Lifeact или F-tractin (неопубликованные результаты).
  3. Выполните иглу ранив на стр кол-19- GFP-moesin трансгенных червей. После иглы ранения, наблюдать кольцо GFP-moesin вокруг раневой на ~ 5 мин. Актина кольцо становится меньше в диаметре, и в конечном итоге закрывает 2-3 ч после ранив в животных дикого типа (Рисунок 2А).
  4. Приготовьте 2% агара площадку на предметное стекло и передачи 10 червей на площадку в 2 мкл раствора 12 мМ левамизол. Изображение в GFP-moesin кольца 1 ч после ранения с помощью обычной конфокальной микроскопии.
    ПРИМЕЧАНИЕ: Используйте конфокальной микроскопии приобрести Z-стеки (13 х 0,5 мкм) актина колец 1 ч после ранения.
  5. Измерьте диаметр актина кольцо после ранения. Для количественного эпидермальный GFP-moesin, сначала сделайте Проекция максимальной интенсивности в Z-стека, а затем сделать 4 строки сканирования (при 45 ° друг к другу) над GFP-moesin кольца. Кольцо диаметром определяется как среднее от пика до пика расстоянии четырех сканирования линий (рис 2b). Для колец, которые уже закрыты, диаметр определяется как 0 мкм.
    ПРИМЕЧАНИЕ: F-актин кольца удобно измерять 1 ч после ранения, как это примерно на полпути через процесс заживления раны в дикого типа. F-актина кольца также может быть измерено в нескольких точках времени для получения временной ход закрытия раны. Временной интервал фильмы закрытия раны могут быть получены с помощью левамизола иммобилизованных червей и вращающийся диск конфокальной микроскопии.

5. Анализ индукции эпидермальной антимикробных пептидов

ПРИМЕЧАНИЕ: Ранение также вызывает врожденные иммунные реакции в С Элеганс кожи. Транскрипцию генов, кодирующих антимикробных пептидов (AMPS) является Induced в эпидермисе. НЛП-29 (нейропептида-подобный белок) AMP сильно индуцируется ранив 4. Для анализа как эпидермис контролирует AMP выражение после ранения, используйте трансгенных журналистам или ПЦР в реальном времени для обнаружения индивидуальные уровни транскриптов AMP.

  1. Трансгенные репортер тест для врожденного иммунного ответа на ранив 4.
  2. Выполните иглы ранения (как в протоколе 1) на взрослых животных, выражающих трансгенных репортера frIs7, который содержит P НЛП-29- GFP и P-полковник 12- DsRed в качестве внутреннего контроля. Соблюдайте единой раны взрослых животных, темно-красные или оранжевые в GFP длинный пас фильтра.
    ПРИМЕЧАНИЕ: Ранение черви дикого типа будет вызывать P НЛП-29 -GFP выражение, но не повлияет на P-полковник 12 -dsRed, в результате чего червей, которые появляются оранжевый, желтый, или зеленый под GFP длинный пас освещения. Потеря функции генов в р38 МАРК пути, такие как ПМК-1 или NSY-1 будет блокировать NLP-29 -GFPиндукция после ранения 4. P НЛП-29- GFP экспрессируется на высоких уровнях в личиночной стадии
  3. Выполните AMP индукционные анализы у молодых взрослых животных. Убедитесь, что единой раны у контрольных животных имеют низкие уровни GFP.
    Примечание: С NLP-29- выражение GFP также индуцируется осмотического стресса 8, и может быть чувствительным к другим экологическим стрессам.
  4. 6 ч после ранения, оценка число червей, которые имеют P НЛП-29 -GFP индукции (рисунок 3) 9 с помощью флуоресцентного рассекает сферу с GFP давно фильтр.
    ПРИМЕЧАНИЕ: На 1 час после ранения P НЛП-29- GFP заметно индуцированных, достигая пика около 6 ч после ранения, а затем остальные повышен до 24 ч после ранения. Количественной оценки экспрессии при помощи визуального скоринга 4,9. Кроме того, количественного определения уровней экспрессии с помощью флуоресцентного активирована червя сортировщик 4. Для червя сортировщика, по крайней мере 50 животные должны быть ранен.
  5. ПЦР в реальном времени анализ для кваntitating уровни транскрипции отдельных генов АМФ. Аналитические уровни транскриптов некоторых генов: НЛП-29, НЛП-30, ЧПУ-1, и CNC-5.
  6. Выполните иглу ранив по дикого типа или мутантных червей (см протокол 1)
  7. Соберите 50 раненых червей и 50 без единой раны червей в необходимые моменты времени (например, 3, 6, 24 ч) пост-ранения.
  8. Извлечение РНК с использованием коммерческого набора в соответствии с инструкцией завода-изготовителя.
  9. Производить обратную транскрипцию, чтобы получить общую 20 мкл кДНК с использованием коммерческого обратный набор транскриптазы.
  10. Для RT-PCR, используют 0,2 мкл кДНК (1/40) из каждого образца в сочетании с зеленым Supermix флуоресцеина и 0,2 мкМ праймеров. Для сравнения качества РНК, используйте АМА-1 или SNB-1 RT-PCR в качестве эталона; сравнить AMP относительный уровень экспрессии путем нормализации внутреннего контроля (АМА-1 или SNB-1), или сравнить индукции раз пост-ранения (индукция AMP ранеными червей / без единой раны черви) по нормеального подхода к внутреннему контролю.
    ПРИМЕЧАНИЕ: CNC-1 и ЧПУ-5 caenacin семьи антимикробные пептиды, чьи транскрипция активируется ранив 10. Как правило, иглы ранения индуцирует экспрессию (~ 500 раз для ЧПУ-1) в течение времени течение 4 ч 10. Праймеры, используемые в опубликованных работ приведены в таблице 2.

6. Анализ выживания после ранения

  1. ПРИМЕЧАНИЕ: Ранение активизирует по крайней мере, два независимых сигнальных путей в эпидермисе: Са 2+ зависит заживления ран путь и врожденную иммунную путь отклика. Оба пути необходимы для полного выживания стерильной ранения. Чтобы проверить, влияет ли мутант или лечение РНК-интерференции заживление ран, измерить выживание в 24-48 ч после ранения. Возможно, использовать обычные продолжительность жизни анализов, чтобы определить влияние ранения на продолжительность жизни 4,9.
  2. Выполните иглу ранив на молодого человека (L4 + 24 ч) черви (50 червей, повторите СевRAL раз) в соответствии с протоколом 1 выше. Поддержание эквивалентное количество единой раны червей в качестве контроля.
  3. Проверьте выживания каждые 24 ч (передача раненых червей к новому агаром каждые 24 ч). Соблюдайте ~ 50% выживаемости 24 часа после ранения в мутантов, дефектных в заживлении ран, таких как GTL-2 или TIR-1, когда нормализуется к единой раны у контрольных животных. Смерть определяется как отсутствие реакции опорно-двигательного аппарата на ощупь от червей выбор.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Лазерная или игла ранение вызовет быстрый и устойчивый подъем уровня эпидермиса Ca, как визуализировали с помощью Са датчиков, таких как GCaMPs (рис 1). Высота Ca происходит в течение нескольких секунд, и остается повышенным в течение нескольких десятков минут. Игла ранив воспроизводимо приводит к образованию F-актина колец на раневых участков (рисунок 2); они появляются в течение нескольких минут, и постепенно близко в течение 1-2 ч после ранения. Актина кольца реже образуются после более точного лазерного ранения. И игла и лазерной ранение индуцируют экспрессию эпидермального антимикробных пептидов (AMPS), таких как НЛП-29, обнаруженных с помощью транскрипционных репортеров (рисунок 3). Индукция AMP проявляется в течение 2-4 ч после ранения и длится приблизительно 24 ч. Игла ранение дикого типа, не должны существенно повлиять на жизнеспособность (измеренную при 24 ч после ранения) или срок службы.

Рисунок 1
Рисунок 1. Лазерная ранение вызывает Ca 2+ ответ в С Элеганс эпидермиса. () Эпидермального GCaMP3 флуоресценции (P кол-19 -GCaMP3 (juIs319)) уровни после фемтосекундного лазерного ранения. Боковой вид эпидермиса в передней тела; х, лазерная рана; N, эпидермальный ядро. Вращающийся диск конфокальной изображения, код интенсивности. КП: без единой раны, Вт:. Раненых (B) Количественный GCaMP3; F / F 0 в 20, 40 и 60 мкм от ран сайта; Представитель след. Пожалуйста, нажмите здесь, чтобы увидеть увеличенную версию этой цифры.

Фиг.2
Рисунок 2. Игла ранение вызывает полимеризацию актина вокруг раны. (А) кол-19- GFP-moesin (juIs352). Масштаб: 10 мкм. КП: без единой раны, Вт:.. Раненых (B) Количественный диаметром актина кольцо из линий сканирования, 4 линии сканирования каждого животного (красными пунктирными линиями на графике (), WT) Пожалуйста, нажмите здесь, чтобы увидеть увеличенную версию этой цифры.

Рисунок 3
Рисунок 3. эпидермального ранение активирует врожденный иммунный ответ. Типичные изображения (WT без ран, WT ранен + 3 ч) НЛП-29 -GFP (frIs7) индукции P после иглы ранения. Масштаб:. 200 мкм Пожалуйста, нажмите здесь, чтобы посмотретьБолее крупная версия этой фигуры.

Репортер Трансгенные Флуоресценция Аллель
Кальций Pcol-19-GCaMP3; Pcol-19-tdTomato GFP / tdTomato juIs319 X
Актин Pcol-19-GFP :: moesin GFP juIs352 Я
НЛП-29 Pnlp-29-GFP / PCOL-12-DsRed GFP / DsRed frIs7 IV

Таблица 1. трансгенов, используемые в раневых анализов реагирования. В этой таблице перечислены на хромосоме интегрированной трансгены, доступных на Caenorhabditis генетический центр (http://www.cbs.umn.edu/research/resources/cgc).

Название гена Последовательность
НЛП-29 F: cttctcgcctgcttcatggc
R: gtccgtatccaccatatcctcc
НЛП-30 F: TTCTTCTCGCCTGCTTCATGG
R: CATAACCTCTACCATATCCACCG
CNC-1 F: gccattgtcgccatttcctc
R: cctccatacattggatatcctc
CNC-5 F: CTTCTTCTAGCAATGCTCGCTC
R: GTATCCTCCACCATACCCTCC
ама-1 F: ACTCAGATGACACTCAACAC
R: GAATACAGTCAACGACGGAG
SNB-1 F: tccagcagacacaagctcagg
R: gagacaacttctgatcacgctc

Таблица 2. Праймеры, используемые для ОТ-ПЦР AMP транскриптов. Рабочая концентрация составляет 0,2 мкМ. SNB-1 служит в качестве внутреннего контроля.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Методы, представленные здесь иглой и лазерной ранения обеспечивают дополнительные подходы к оценке способности эпидермиса эпителия для ремонта повреждений. Лазерная ранение относительно локализованными и (в зависимости от лазерного конфигурации) может быть ограничен эпидермиса, в то время как игла ранение разрушает эпидермис, кутикулу и, вероятно, внутренние мембраны подвале. Игла ранение может более точно напоминают раны, нанесенные патогенов или механических повреждений в природной среде. Как правило, игла ранений требует больше практики, чтобы достичь точных раны, которые совместимы с выживание животных. Клеточные реакции на иглы и отображения лазерной ранение много общего. Тем не менее следует отметить, что формирование актиновых колец не воспроизводимо наблюдалось после фемтосекундного лазерного ранения.

Ограничение прокола, что это не точная рана: игла также повреждает внутренние ткани, чей вклад в червявыживание не были расследованы. Возможная модификация этого протокола будет сочетать систему микроинъекции микрофлюидальный на основе 11 и люминесцентные журналистам выполнять более точную физическую ранения.

Игла и лазерные методы ранении подробно здесь простой, но довольно трудоемкий, и в лучшем случае среднего пропускная способность, что затрудняет использование геномных или биохимические подходы к характеристике ответ раны. Кутикулы проникновения патогенных микроорганизмов, таких как грибы или простейшие 12,13 может быть доставлен в больших популяциях животных, и может вызвать реакции, которые перекрываются с ответом на ранения, но ввести дополнительные сложности возбудителя конкретных ответов. Дальнейшая работа будет необходимо для изучения ли другие абиотические методы, такие как баллистические бомбардировки 14 или массивов микромеханических пирсинг структур 15 могут быть адаптированы для широкомасштабного ранения.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics