Methoden voor de huid De verwondingen en Testen voor Wond Reacties in

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De C. elegans epidermis en cuticula vormen een eenvoudige, maar verfijnde huidlaag die gelokaliseerde schade als gevolg van het verwonden kan repareren. Studies wond reacties en reparatie dit model hebben ons begrip van het cytoskelet en genomische respons op weefselbeschadiging verlicht. De twee meest gebruikte methoden wond C. elegans volwassen huid prikt met micro-injectie naalden, en lokale laser bestraling. Naald verwonden plaatselijk verstoort de cuticula, epidermis en bijbehorende extracellulaire matrix, en kunnen ook interne weefsels beschadigen. Laser bestraling resulteert in meer gelokaliseerde schade. Verwonding veroorzaakt een opeenvolging van gemakkelijk getest reacties ontvangen, waaronder verhoogde epidermale Ca 2+ (seconden-minuten), de vorming en de sluiting van een actine-bevattende ring op de wond (1-2 uur), verhoogde transcriptie van antimicrobiële peptide genen (2-24 hr) en littekenvorming. In wezen zijn alle wild type volwassen dieren overleven verwonding, waarals mutanten defect in de wond reparatie of andere reacties tonen verminderde overleving. Gedetailleerde protocollen voor naald en laser verwonden en assays voor kwantificering en visualisatie van wond reacties en herstelprocessen (Ca dynamiek, actine dynamiek, antimicrobiële peptide inductie en overleving) gepresenteerd.

Introduction

Huid wondgenezing mechanismen zijn van fundamentele biologische interesse en voor de menselijke gezondheid relevant. Wondgenezing in gewervelde dieren en zoogdieren bestaat uit een complexe reeks gecoördineerde reacties van verschillende weefsels en signalering 1. Veel eenvoudige genetische model organismen zijn ook in staat om helende huidwonden 2. Het is daarom van belang genetisch handelbaar modellen huid wondheling analyseren. Wij en anderen hebben begonnen Caenorhabditis elegans als nieuw model voor de huid wondgenezing 3,4. Het doel van dit protocol is om een bredere reeks van onderzoekers aan C. gebruiken mogelijk elegans als een instrument om de moleculaire en cellulaire mechanismen van epidermale wondgenezing te onderzoeken.

De C. elegans huid omvat de epidermis (ook bekend als hypodermis) en het extracellulaire cuticula 5. De volwassen epidermis gevormd uit een klein aantal meerkernige syncytia, waarvan de grootste de syncytium known als hyp7. De epidermis is een eenvoudige epitheel dat de cuticula van het apicale oppervlak afscheidt. De huid kan actief verdedigen tegen-huid doordringende ziekteverwekkers en repareren kleine wondjes 4. Wondherstel van de C. elegans huid is robuust, aangezien bijna alle wild type dieren overleven kunnen kleine wondjes veroorzaakt door naalden, of lokale beschadiging van de huid veroorzaakt door laser bestraling overleven. C. elegans huid verwonding veroorzaakt een reeks van reacties, met inbegrip van een epidermale aangeboren immuunrespons, wondsluiting en littekenvorming 4. De volwassen epidermis post-mitotische en wondheling omvat lokale cellulaire responsen in tegenstelling tot epidermale proliferatie of celmigratie. We hebben aangetoond dat de huid verwonding veroorzaakt een aanzienlijke en aanhoudende groei van epidermale Ca2 +, waarbij het ​​membraan TRPM kanaal GTL-2 en interne Ca2 + stores 3. De epidermale Ca2 + signaal nodig voor oprichting en sluiting van F-actine ringen aan de wound website. Verwonding induceert ook aangeboren immuunrespons dat de transcriptie van AMPs zoals NLP-29 te activeren. De verwonding geïnduceerde transcriptie van AMPs is afhankelijk van een TIR-1 / PMK-1 p38 MAP kinase cascade autonoom handelen in de epidermis 4. Defecten in ofwel de Ca 2+ signaleringsroute of in de aangeboren immuunrespons zal leiden tot lagere overleving na de verwonding. De relatief eenvoudige structuur van het C. elegans epidermis, zijn genetische handelbaarheid en voordelen voor in vivo beeldvorming maakt het een uitstekend systeem om meerdere aspecten van wondheling te bestuderen.

Hier presenteren we protocollen voor de twee gebruikelijke methoden van verwonding: naald verwonden en laser verwonden. Naald verwonding vereist geen speciale apparatuur (met uitzondering van de naald trekker), en met ervaring kan worden uitgevoerd op honderden wormen per dag. Naald verwonding wordt uitgevoerd op dieren groeien op agarplaten. Daarentegen wordt laser verwonding uitgevoerd op anesthetized dieren aangebracht op agar kussentjes onder een dekglaasje en is geschikt voor levende beeldvorming van de cellulaire respons op beschadiging.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

De volgende protocollen beschrijven gedetailleerde procedure voor C. elegans huid verwonden en voor het analyseren wond reacties.

1. Naald Verwonden 3,4

  1. Groeien gezonde unstarved wormen op standaard NGM (nematode groeimedium) platen met E. coli OP50 bacteriën als voedsel, onderhouden in een 20 ° C incubator.
    OPMERKING: Methoden voor NGM agarplaten en routine teelt van C. elegans is te vinden op www.wormbook.org 6.
  2. Pick 25 L4 stadium wormen met een vers gezaaid plaat 1 dag vóór het verwonden en cultuur bij 20 ° CO / N.
  3. Voordat verwonden, trek naalden uit haarvaten behulp van een naald trekker. De naalden die in verwonding zijn identiek aan die voor micro-injectie van C. elegans.
  4. Zorg ervoor dat alle wormen zijn op jonge volwassen stadium. Plaats de plaat van wormen op ijs voor ongeveer 30 min. Koeling zorgt ervoor dat de dieren worden traag, het vergemakkelijken van de naald verwonden.
  5. Verwijder de agar plaat uit het ijs om een ​​dissectie stereomicroscoop. Met behulp van een worm pick verplaatst 25 wormen in het midden van de agar plaat.
  6. Plaats de naald in een 100 ul pipet tip om gemakkelijker te houden van de naald. Prik de voorste of achterste deel van het lichaam van de worm met de naald, het vermijden van de gonaden. In het algemeen proberen te verwonden tussen de achterste keelholte en de voorste gonad, of tussen de achterste gonaden en de endeldarm. Hergebruik naalden vele malen, totdat ze breken.
    OPMERKING: Zorg ervoor dat de wonden zijn korte, zachte prikt dat de cuticula en de huid te prikken, doordringende ~ 5-10 micrometer in het dier. De naald moet de anim voerenal ongeveer haaks op de huid. De wonden niet zichtbare schade aan inwendige organen of onmiddellijke breuk van het lichaam. Observeer een kleine hoeveelheid cytoplasma sijpelen uit voor een paar seconden nadat de wond; indien echter celinhoud lekken gedurende langere tijd de dieren niet overleven. Voor een optimale beeldvorming, wond de laterale epidermale syncytium (hyp7) of de zijdelingse naad.
    OPMERKING: Deze procedure omvat het gebruik van een glazen naald.
  7. Laat wormen om te herstellen bij RT toen cultuur op 20 ° C. Beoordeel het succes van naald verwonding door verschillende assays die hieronder worden beschreven. Meer dan 95% van de wild-type dieren overleven 24 uur na naald verwonden in de jonge volwassen stadium. Het effect van verwonden larven of oudere volwassenen nog niet uitgebreid onderzocht.

2. Laser Verwonden 3

Gebruik femtosecondelaser bestraling (800 nm) om precies te verwonden voeren.

  1. Bereid agar padvertenties op een glasplaatje met gesmolten 2% agar 7. Zorg ervoor dat de pads zijn vergelijkbaar met de agar pads gebruikt voor live beeldvorming van C. elegans.
  2. Transfer 10 jonge volwassen wormen op de agarose pad met worm pick, en voeg een 2 pl daling van 12 mM Levamisole oplossing. Bedek de dieren en de vloeistof met een dekglas. Wacht 1-2 min voor de wormen te verlammen.
  3. Plaats het glaasje op een draaiende schijf confocale microscoop. Verplaats het podium om de wormen te vinden en zich richten op de laterale voorste of achterste syncytieel epidermis met een 100x objectief (NA 1,4-1,46).
  4. Stel de kracht van de femtosecondlaser tot 140 mW (gemeten voor de doelstelling). Gebruik de femtosecondelaser een herhalingssnelheid van 80 MHz.
    OPMERKING: Twee pulsen van 200 msec per stuk (gescheiden door 20 msec) zijn voldoende voor het verwonden in onze handen.
  5. Focus op het apicale oppervlak van de epidermale cel en wond de opperhuid. Observeren lokale verstoring van het cytoplasma (borrelen), of lokale bleken of tl-marker gebruikt.
    OPMERKING: Volg de juiste laser procedures veiligheid bij het gebruik van de femtoseconde laser. Lijn of bijzondere scans met femtoseconde lasers zoals twee foton microscopen moet voldoende stroom leveren voor laser verwonden.
    OPMERKING: Hoewel we niet de directe ervaring van het gebruik van andere lasers hebben, in principe verwonding moet mogelijk zijn met behulp van conventionele UV-lasers (zoals gebruikt in C. elegans cel ablaties). Optioneel gebruik maken van een fluorescentie herstel na Photobleaching (FRAP) module op draaiende schijf confocale aan de epidermis (N. Pujol, persoonlijke communicatie) wond.

3. Visualisatie van epidermale Ca 2+ Reacties met choquerende

  1. Gebruik transgene C. elegans stammen die Ca2 + sensoren (zoals die van de GCaMP serie) in de epidermis tot expressie, onder controle van de volwassen epidermale promoter col-19 (Figuur 1A transgenen in opgesomd OPMERKING: We hebben tdTomato gebruikt als een interne controle voor transgenexpressie epidermale tdTomato fluorescentie relatief stabiel is en niet interfereert met GCaMP beeldvorming.
  2. Zowel naald en laser verwonden trekker Ca 2+ verhoging in de opperhuid. Aangezien naald verwonding niet gemakkelijk kan worden uitgevoerd op een draaiende schijf confocale laser verwonding voorkeur voor kwantitatieve analyse van de Ca2 + respons (Figuur 1).
  3. Verwerven time lapse beelden in multi-dimensionale overname modus (interval tijd 2 sec met 114 msec excitatie laser blootstelling) met behulp van een draaiende schijf confocale met 100X doelstelling (NA 1,4-1,46) en geschikte filter sets (GFP filters zal werken voor GCaMP3).
    OPMERKING: Acquire time-lapse beelden elke 30 seconden voor ongeveer 2 uur om de Ca 2+ resp onderzoekenonse te verwonden over een langere tijd natuurlijk.
  4. Met behulp van beeldanalyse software meet de gemiddelde GCaMP fluorescentie in tien gelijkwaardige gebieden van belang (ROI), waarvan er vijf zijn gericht op de epidermale cel cytosol en vijf op de achtergrond.
  5. Verkrijgen basislijn fluorescentie (F 0) door het gemiddelde fluorescentie in 5 ROI in de epidermis vervolgens aftrekken van de gemiddelde van 5 ROI op de achtergrond voor schade. Druk de verandering in fluorescentie AF als de verhouding tussen ten opzichte van de basislijn [(t F ​​-F 0) / F 0].

4. Visualisatie van F-actine Dynamics na verwonding

  1. LET OP: In antwoord op de naald verwonden, te observeren een actine ring aan de wond die geleidelijk sluit rond de wond. Dit protocol sectie assays wondsluiting door het meten van het actine ring diameter.
  2. Genereren van transgene wormen die een F-actine marker te drukken, zoals de Drosophila Moesin actine-bindende domein gefuseerd metGFP expressie onder controle van een epidermale specifieke promoter zoals col-19 (figuur 2A) (transgen juIs352).
    LET OP: Wij hebben soortgelijke resultaten met behulp van andere actine-bindende domein markers zoals Lifeact of F-tractin (niet gepubliceerde resultaten) verkregen.
  3. Voeren naald verwonden op P col-19- GFP-Moesin transgene wormen. Na naald verwonden, te observeren een ring van GFP-Moesin rondom de wond door ~ 5 min. De actine ring wordt kleiner in diameter en uiteindelijk sluit 2-3 uur na het verwonden in wild type dieren (Figuur 2A).
  4. Bereid een 2% agar pad op een glasplaatje en overdragen 10 wormen op het pad in 2 pl 12 mM Levamisole oplossing. Afbeelding de GFP-Moesin ringen 1 uur na verwonding met conventionele confocale microscopie.
    OPMERKING: Gebruik confocale microscopie om z-stacks (13 x 0,5 micrometer) van actine ringen verwerven 1 uur na verwonding.
  5. Meet de actine ring diameter na verwonding. Epidermale G kwantificerenFP-Moesin, eerst een maximale intensiteit projectie van de z-stack en dan trekken 4 lijnscans (bij 45 ° met elkaar) over de GFP-Moesin ring. Ring diameter wordt gedefinieerd als de gemiddelde piek tot piek afstand van de vier lijnaftastingen (figuur 2B). Voor ringen die al zijn gesloten, wordt de diameter gedefinieerd als 0 micrometer.
    OPMERKING: F-actine ringen zijn gunstig gemeten 1 uur na het verwonden als dit is ongeveer de helft weg door de wonden in proces in het wild type. F-actine ringen kunnen ook worden gemeten op verschillende tijdstippen een tijdsverloop van wondsluiting leiden. Time lapse filmpjes van wondsluiting kan worden verkregen met behulp van levamisol geïmmobiliseerd wormen en draaiende schijf confocale microscopie.

5. Inductie Assay van Epidermale antimicrobiële peptiden

OPMERKING: De verwondingen veroorzaakt ook aangeboren immuunrespons bij de C. elegans huid. Transcriptie van genen die coderen voor antimicrobiële peptiden (AMPs) is induced in de epidermis. De NLP-29 (neuropeptide-achtig eiwit) AMP wordt sterk geïnduceerd door verwonden 4. Om te testen hoe de epidermis regelt AMP uitdrukking na verwonding, gebruik transgene reporters of real-time PCR individuele AMP transcriptniveaus detecteren.

  1. Transgene reporter assay voor aangeboren immuunrespons te verwonden 4.
  2. Voeren naald verwonding (zoals in protocol 1) op volwassen dieren de uiting van de transgene verslaggever frIs7, die P NLP-29- GFP en P col-12- DsRed bevat als een interne controle. Observeren gewonde volwassen dieren zo donker rood of oranje in een GFP lange pass filter.
    OPMERKING: Verwonden wild-type wormen zullen P NLP-29-GFP expressie te induceren, maar heeft geen invloed op P col-12 -dsRed, wat resulteert in wormen die oranje, geel of groen verschijnen onder GFP lange pass verlichting. Verlies van de functie van genen in het p38 MAPK route, zoals PMK-1 of NSY-1 zal blokkeren NLP-29-GFPinductie na verwonding 4. P NLP-29- GFP wordt uitgedrukt op een hoog niveau in larvale stadia
  3. Voeren AMP inductie assays bij jonge volwassen dieren. Ervoor te zorgen dat gewonde controle dieren hebben lage niveaus van GFP.
    OPMERKING: P NLP-29- GFP expressie wordt ook veroorzaakt door osmotische stress 8, en kunnen gevoelig zijn voor andere milieu-invloeden zijn.
  4. 6 uur na verwonding score het aantal wormen die P nlp-29 GFP inductie (figuur 3) 9 met fluorescentie- dissectie scope met GFP lange-pass filter hebben.
    OPMERKING: Bij 1 uur na de verwonding P NLP-29- GFP wordt zichtbaar geïnduceerd, met een piek ongeveer 6 uur na verwonding en vervolgens de resterende verhoogd tot 24 uur na verwonding. Kwantificeren expressie door visuele scoren 4,9. Als alternatief kwantificeren expressie niveaus met behulp van een fluorescentie-geactiveerde worm sorteerder 4. Voor de worm sorteerder, moeten ten minste 50 dieren worden verwond.
  5. Real-time PCR-test voor quantitating transcript niveaus van de afzonderlijke AMP genen. Assay transcriptniveaus voor verschillende genen: NLP-29, nlp-30, cnc-1, en ​​cnc-5.
  6. Voeren naald verwonden op wild-type of mutant wormen (zie protocol 1)
  7. Verzamel 50 gewonden wormen en 50 gewonde wormen op de gewenste tijden (bijvoorbeeld 3, 6, 24 uur) na de verwonding.
  8. Extraheer RNA met een commercieel kit volgens de instructies van de fabrikant.
  9. Voeren reverse transcriptie aan de totale 20 pi cDNA te krijgen met behulp van een commercieel reverse transcriptase kit.
  10. Voor RT-PCR, een 0,2 pi cDNA (1/40) van elk monster in combinatie met een groene Supermix met fluoresceïne en 0,2 uM primers. Te vergelijken RNA kwaliteit, gebruiken ama-1 of SNB-1 RT-PCR als referentie; vergelijken de AMP relatieve expressie niveau door het normaliseren van de interne controle (ama-1 of SNB-1), of vergelijken voudige inductie na de verwonding (AMP-inductie bij gewonde wormen / gewonde wormen) door normalizing om de interne controle.
    OPMERKING: cnc-1 en cnc-5 zijn caenacin familie antimicrobiële peptiden waarvan de transcriptie wordt geactiveerd door verwonden 10. Typisch, naald verwonding induceert expressie (~ 500 voudig voor cnc-1) over een tijdsverloop van 4 uur 10. Primers gebruikt in gepubliceerde werk zijn vermeld in tabel 2.

6. Assay Survival na verwonding

  1. OPMERKING: De verwondingen activeert ten minste twee onafhankelijke signaalwegen in de epidermis: de Ca 2+ afhankelijk wondheling route en de aangeboren immuunrespons pad. Beide routes zijn vereist om overleving van steriele verwonding. Om te testen of een mutant of RNAi behandeling van invloed op de wondgenezing, meten overleving na 24-48 uur na verwonding. Optioneel gebruik van conventionele levensduur assays om het effect van het verwonden op levensduur 4,9 bepalen.
  2. Voeren naald verwonden op jong volwassen (L4 + 24 uur) wormen (50 wormen, herhaalt several keer) volgens het protocol van 1 hierboven. Handhaaf een equivalent aantal gewonde wormen als controlegroep.
  3. Controleer overleven elke 24 uur (transfer gewond wormen naar een nieuwe agarplaat elke 24 uur). Observeren ~ 50% overlevingskans 24 uur na verwonding in mutanten die defect in wondheling zijn zoals GTL-2 of TIR-1, bij normalisatie-gewonde controle dieren. De dood wordt gedefinieerd als een gebrek aan motorische respons te raken door worm pick.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Laser of naald verwonding zal een snelle en aanhoudende verhoging veroorzaken in epidermale Ca niveaus, zoals zichtbaar gemaakt met Ca sensoren zoals GCaMPs (figuur 1). De Ca verhoging plaatsvindt binnen seconden en blijft gedurende tientallen minuten. Naald reproduceerbaar verwonding resulteert in de vorming van F-actine ringen aan wondplaatsen (figuur 2); deze verschijnen binnen enkele minuten, en geleidelijk aan dicht dan 1-2 uur na verwonding. Actine ringen zijn minder vaak gevormd na nauwkeuriger laser verwonden. Zowel naald en laser verwonden induceren expressie van epidermale antimicrobiële peptiden (AMPs) zoals nlp-29 gedetecteerd met transcriptionele reporters (figuur 3). AMP inductie blijkt binnen 2-4 uur na verwonding en duurt ongeveer 24 uur. Naald verwonden van de wild-type mag geen significante invloed op de levensvatbaarheid (gemeten op 24 uur na verwonding) of levensduur.

Figuur 1
Figuur 1. Laser verwonding veroorzaakt een Ca2 + respons in de C. elegans epidermis. (A) Epidermal GCaMP3 fluorescentie (P col-19 -GCaMP3 (juIs319)) niveaus na femtosecondelaser verwonding. Zijaanzicht van epidermis in anterior-lichaam; x, laser wond; N, epidermale kern. Draaiende schijf confocale beelden, intensiteit code. UW: gewonde, W:. Gewonden (B) Kwantificering van GCaMP3 AF / F 0 op 20, 40 en 60 micrometer uit de wond; representatieve trace. Klik hier om een grotere versie van deze afbeelding te bekijken.

Figuur 2
Figuur 2. Naald verwonden triggers actine polymerisatie rond de wond. (A) col-19- GFP-Moesin (juIs352). Scale: 10 pm. UW: gewonde, W:.. Gewonden (B) Kwantificering van actine ring met een diameter van lijn scans, 4 lijn scans per dier (gestippelde rode lijnen in het paneel (A), WT) Klik hier om een grotere versie van deze afbeelding te bekijken.

Figuur 3
Figuur 3. Epidermal verwonden activeert aangeboren immuunrespons. Vertegenwoordiger beelden (WT ongedeerd, WT gewond + 3 uur) van P NLP-29-GFP (frIs7) inductie na naald verwonding. Schaal:. 200 pm Klik hier om een fotogrotere versie van deze figuur.

Verslaggever Transgene Fluorescentie Allel
Calcium Pcol-19-GCaMP3; Pcol-19-tdTomato GFP / tdTomato juIs319 X
Actine Pcol-19-GFP :: Moesin GFP juIs352 I
NLP-29 Pnlp-29-GFP / Pcol-12-DsRed GFP / DsRed frIs7 IV

Tabel 1. transgenen gebruikt wond reactie assays. Deze tabel geeft chromosomaal geïntegreerd transgenen verkrijgbaar bij de Caenorhabditis Genetics Center (http://www.cbs.umn.edu/research/resources/cgc).

Gene naam Opeenvolging
NLP-29 F: cttctcgcctgcttcatggc
R: gtccgtatccaccatatcctcc
NLP-30 F: TTCTTCTCGCCTGCTTCATGG
R: CATAACCTCTACCATATCCACCG
cnc-1 F: gccattgtcgccatttcctc
R: cctccatacattggatatcctc
cnc-5 F: CTTCTTCTAGCAATGCTCGCTC
R: GTATCCTCCACCATACCCTCC
ama-1 F: ACTCAGATGACACTCAACAC
R: GAATACAGTCAACGACGGAG
SNB-1 F: tccagcagacacaagctcagg
R: gagacaacttctgatcacgctc

Tabel 2. Primers gebruikt voor RT-PCR van AMP transcripten. Werken concentratie is 0,2 uM. SNB-1 dient als interne controle.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

De hier gepresenteerde van naald en laser verwonding werkwijzen complementaire werkwijzen om het vermogen van de epidermale epitheel schade te herstellen. Laser verwonding is relatief gelokaliseerde en (afhankelijk van de laser configuratie) kan worden beperkt tot de epidermis, terwijl naald verwonding verstoort de opperhuid, cuticula, en waarschijnlijk interne basaalmembranen. Naald verwonding kan nauwkeuriger lijken wonden toegebracht door pathogenen of mechanische schade in de natuurlijke omgeving. In de regel naald verwonding vereist meer praktijk nauwkeuriger wonden die geschikt dieroverleving worden getild. De cellulaire reacties op naald en laser verwonden vertonen veel gelijkenissen. Er moet echter worden opgemerkt dat de vorming van actine ringen is niet reproduceerbaar waargenomen na femtosecondelaser verwonding.

Een beperking van de naald punctie is dat het niet een precieze wonde: de naald ook schade aan interne weefsels van wie de bijdragen aan wormoverleving zijn niet onderzocht. Een eventuele wijziging van dit protocol zou zijn om-microfluïdische gebaseerde micro-injectie systeem 11 en TL-reporters combineren om nauwkeuriger lichamelijke verwonding uit te voeren.

De naald en laser verwonding hier beschreven methoden zijn eenvoudig maar tamelijk arbeidsintensief, en in het beste middelgrote doorvoer, waardoor het een uitdaging om genomische of biochemische benaderingen karakterisering van de wond respons. Cuticula indringende pathogenen zoals schimmels of protozoa 12,13 kan worden geleverd aan grotere populaties van dieren, en kunnen leiden tot reacties die overlappen met de reactie op de verwonding, maar introduceren bijkomende complexiteit van pathogeen specifieke antwoorden. Verdere werkzaamheden zullen verplicht worden om te onderzoeken of andere abiotische methoden zoals ballistische bombardement 14 of arrays van micromechanische piercing structuren 15 kan worden aangepast voor grootschalige verwonden.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics