Metoder til Hud sårbarhed og Analyser for Wound Svar i

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

C. elegans epidermis og neglebånd danner en enkel, men sofistikeret hudlag, der kan reparere lokaliserede skader som følge af såret. Undersøgelser af sår svar og reparation i denne model har belyst vores forståelse af cytoskeletal og genomiske reaktioner på vævsskade. De to mest almindeligt anvendte metoder til at vikles C. elegans voksen hud er prikker med mikroinjektion kanyler og lokal laser bestråling. Needle sårede lokalt forstyrrer kutikula, epidermis og tilhørende ekstracellulær matrix, og kan også beskadige de indvendige væv. Laser bestråling giver mere lokaliseret skade. Sårdannelse udløser en række let analyseres svar inklusive forhøjet epidermal Ca 2+ (sekunder-minutter), dannelse og lukning af en actin-holdige ring på sårstedet (1-2 timer), forhøjet transkription af antimikrobielle peptid gener (2-24 HR) og ardannelse. Hovedsagelig alle vildtype voksne dyr overlever sårdannelse, hvorsom mutanter defekte i sår reparation eller andre reaktioner viser nedsat overlevelse. Detaljerede protokoller for nål og laser såret, og assays til kvantificering og visualisering af sår svar og reparation processer (Ca dynamik, actin dynamik, antimikrobielle peptid induktion og overlevelse) præsenteres.

Introduction

Hud sårheling mekanismer er af grundlæggende biologisk interesse og relevans for menneskers sundhed. Sårheling i hvirveldyr og pattedyr omfatter en kompleks serie af koordinerede responser af flere væv og signalanlæg 1. Mange simple genetiske model organismer er også i stand til healing hudsår 2. Det er derfor af interesse at analysere genetisk medgørlige modeller af hudsår reparation. Vi og andre er begyndt at bruge Caenorhabditis elegans som ny model for huden sårheling 3,4. Målet med denne protokol er at gøre det muligt for et bredere sæt forskere til at bruge C. elegans som et redskab til at undersøge molekylære og cellulære mekanismer epidermal sårheling.

C. elegans hud omfatter epidermis (også kendt som hypodermis) og det ekstracellulære kutikula 5. De voksne epidermis er dannet af et lille antal multinucleate syncytia, hvoraf den største er syncytium Known som hyp7. Epidermis er en simpel epithel, som udskiller kutikula på dens apikale overflade. Huden kan aktivt forsvare sig mod hud-gennemtrængende patogener og reparere små sår 4. Sårheling af C. elegans hud er robust, da næsten alle vildtype dyr overlever kan overleve små stiksår forårsaget af kanyler eller lokal hudskader forårsaget af laser bestråling. C. elegans hud såret udløser en suite af svarene, herunder et immunrespons epidermal medfødte, sårlukning, og ardannelse 4. De voksne epidermis er post-mitotiske, og sårheling indebærer lokale cellulære reaktioner i modsætning til epidermal proliferation eller celle migration. Vi har vist, at huden såret udløser en stor og vedvarende stigning i epidermal Ca2 +, som kræver membranen TRPM kanal GTL-2 og interne Ca 2 + butikker 3. Der kræves epidermal Ca 2+ signal for dannelse og lukning af F-actin ringe på wound site. Anskydning inducerer også medfødte immunrespons, der aktiverer transkriptionen af AMP'er såsom NLP-29. Såret-induceret transkription af AMP'er er afhængig af en TIR-1 / PMK-1 p38 MAP-kinase kaskade handler autonomt i epidermis 4. Defekter i enten Ca2 + signalvejen eller i medfødte immunreaktion vil føre til lavere overlevelse efter sårdannelse. Den relativt enkle struktur af C. elegans epidermis, dets genetiske sporbarhed og fordele til in vivo imaging gør det et fremragende system til at studere flere aspekter af sårheling.

Her præsenterer vi protokoller for de to almindelige metoder til sårdannelse: nål sårdannelse og laser sårdannelse. Needle såring kræver ingen specialudstyr (bortset nålen aftrækker), og med erfaring kan udføres på flere hundrede orme per dag. Needle såring udføres på dyr vokser på agarplader. I modsætning hertil er laser såring udført på Anesthetized dyr monteret på agar puder under et dækglas, og er velegnet til billeddannelse af de cellulære reaktioner på skader.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Følgende protokoller beskriver den detaljerede procedure for C. elegans hud sårdannelse og til analyse sår reaktioner.

1. Needle Anskydning 3,4

  1. Grow sunde unstarved orme på standard NGM (nematode vækstmedium) plader med E. coli OP50 bakterier som mad, holdes i et 20 ° C inkubator.
    BEMÆRK: Metoder til NGM agarplader og rutinemæssig dyrkning af C. elegans kan findes på www.wormbook.org 6.
  2. Pick 25 L4 stage orme til en frisk seedet plade 1 dag før sårede og kultur ved 20 ° CO / N.
  3. Før sårede, træk nåle fra kapillærer ved hjælp af en nål aftrækker. De nåle, der anvendes i sårdannelse er identiske med dem, der anvendes til mikroinjektion C. elegans.
  4. Sørg for, at alle de orme er på unge voksne stadium. Pladen anbringes orme på is i ca. 30 min. Afkøling bevirker, at dyrene er træg, letter nål sårdannelse.
  5. Fjern agarplade fra isen til en dissekere stereomikroskop. Ved hjælp af en orm pick flytte 25 orme i midten af ​​agarpladen.
  6. Placer nålen i en 100 pi pipette tip til lettere holde nålen. Punkter forreste eller bageste del af kroppen af ​​ormen med nålen, undgå gonaden. Generelt forsøger at viklet mellem den bageste pharynx og forreste gonade, eller mellem den bageste gonade og endetarmen. Genbrug nåle mange gange, indtil de knækker.
    BEMÆRK: Sørg for sårene er korte, blide prikker der punktere neglebånd og hud, gennemtrængende ~ 5-10 um i dyret. Nålen skal indtaste animal på ca. en ret vinkel i forhold til huden. Sårene bør ikke føre til synlige skader på indre organer eller øjeblikkelig brud på korpus. Observer en lille mængde cytoplasma siver ud for et par sekunder efter såret; Men hvis cellulære indhold sive ud i længere tid dyrene vil ikke overleve. For optimal billeddannelse, sår den laterale epidermal syncytium (hyp7) eller den laterale søm.
    BEMÆRK: Denne procedure omfatter brug af et glas nål.
  7. Tillad orme at inddrive ved stuetemperatur derefter kultur ved 20 ° C. Judge succes nålen såret af en række assays, der er beskrevet nedenfor. Mere end 95% af vildtype dyr overlever 24 timer efter nålen sårdannelse i unge voksne stadium. Virkningen af ​​sårdannelse i larver eller ældre voksne endnu ikke blevet grundigt analyseret.

2. Laser Anskydning 3

Brug femtosekund laser bestråling (800 nm) til at udføre mere præcise sårdannelse.

  1. Forbered agar pannoncer på en glasplade med smeltet 2% agar 7. Sørg puderne ligner agar puder, der anvendes til direkte billedvisning af C. elegans.
  2. Overfør 10 unge voksne orme på agarose pad med orm pick, og tilføje en 2 pi dråbe 12 mM Levamisol løsning. Dæk dyr og væsken med et dækglas. Vent 1-2 min for orme at lamme.
  3. Anbring objektglasset på en roterende skive konfokalt mikroskop. Flyt scenen for at finde orme og fokusere på de laterale forreste eller bageste syncytial epidermis med et 100X objektiv (NA 1,4-1,46).
  4. Indstil magt femtosekund laser til 140 mW (målt før mål). Brug femtosekund laser på en gentagelse på 80 MHz.
    BEMÆRK: To pulser af 200 ms hver (adskilt med 20 ms) er tilstrækkelige til sårede i vores hænder.
  5. Fokus på den apikale overflade af epidermal celle og viklet epidermis. Overhold lokal forstyrrelse af cytoplasmaet (bobler), eller lokalt blegning of noget fluorescerende markør anvendes.
    BEMÆRK: Følg passende laser sikkerhedsprocedurer ved brug af femtosekund laser. Linje eller punkt scanninger med femtosekund lasere som de i to foton mikroskoper bør give tilstrækkelig strøm til laser sårdannelse.
    BEMÆRK: Selvom vi ikke har direkte erfaring med at anvende andre lasere, bør i princippet såret være muligt ved hjælp af konventionelle UV-lasere (som anvendt i C. elegans celle ablationer). Eventuelt bruge en Fluorescence Recovery Efter Fotoblegning (FRAP) modul på spinning disk konfokal at sår overhuden (N. Pujol, personlig kommunikation).

3. Visualisering af epidermale Ca 2+ Responses sårdannelse

  1. Brug transgene C. elegans stammer, der udtrykker Ca2 + sensorer (såsom dem af GCaMP serien) i epidermis, under kontrol af den voksne epidermal promotor col-19 (figur 1A; transgener er anført i BEMÆRK: Vi har brugt tdTomato som en intern kontrol til transgen ekspression som epidermal tdTomato fluorescens er relativt stabil og ikke forstyrrer GCaMP billeddannelse.
  2. Både nålen og laser sårede trigger Ca 2+ elevation i epidermis. Da nålen såring ikke let kan udføres på en roterende skive konfokal laser såring foretrækkes til kvantitativ analyse af Ca 2+ respons (figur 1).
  3. Acquire tid bortfalder billeder i multi-dimensional erhvervelse tilstand (interval tid 2 sek med 114 ms excitation laser eksponering) ved hjælp af en roterende skive konfokal med 100X mål (NA 1,4-1,46), og passende filtersæt (GFP filtre vil arbejde for GCaMP3).
    BEMÆRK: Anskaf time-lapse billeder hver 30 sek i ca. 2 timer til at undersøge Ca 2+ hhvonse at såre over en længere tidsforløb.
  4. Brug af billedanalyse software måler den gennemsnitlige GCaMP fluorescens i ti tilsvarende områder af interesse (ROI), hvoraf fem er centreret om den epidermale cellecytosolen og fem i baggrunden.
  5. Opnå baseline fluorescens (F 0) ved at midle fluorescens i 5 ROI'er i epidermis derefter trække gennemsnittet af 5 ROI'er i baggrunden, før skaden. Udtryk ændringen i fluorescens bf som forholdet mellem ændringen i forhold til baseline [(F t -F 0) / F 0].

4. Visualisering af F-actin Dynamics Efter Anskydning

  1. BEMÆRK: Som svar på nål såret, observere en actin ring i såret, som gradvist lukker omkring såret. Denne protokol afsnit assays sårlukning ved at måle actin ring diameter.
  2. Generere transgene orme, der udtrykker en F-actin markør, såsom Drosophila moesin actin-bindende domæne fusioneret tilGFP udtrykt under kontrol af en epidermal specifik promotor, såsom col-19 (figur 2A) (transgen juIs352).
    BEMÆRK: Vi har opnået lignende resultater ved hjælp af andre actin bindende domæne markører, såsom Lifeact eller F-tractin (upublicerede resultater).
  3. Udfør nål sårede på P col-19- GFP-moesin transgene orme. Efter nålen sårdannelse, observere en ring af GFP-moesin omkring sårstedet med ~ 5 min. Den actin ring bliver mindre i diameter og til sidst lukker 2-3 timer efter sårdannelse i vildtype dyr (figur 2A).
  4. En 2% agar pad på et objektglas og overføre 10 orme på puden i 2 pi 12 mM Levamisol løsning. Billede af GFP-moesin ringe 1 time efter sårede anvendelse af konventionel konfokal mikroskopi.
    BEMÆRK: Brug konfokal mikroskopi til at erhverve z-stakke (13 x 0,5 um) af actin ringe 1 time efter sårdannelse.
  5. Mål actin ring diameter efter sårdannelse. At kvantificere epidermal GFP-moesin, først lave en maksimal intensitet fremskrivning af z-stakken og derefter trække 4 liniescanninger (ved 45 ° til hinanden) over GFP-moesin ring. Diameter Ring er defineret som den gennemsnitlige top til top afstand af de fire linjer scanninger (figur 2B). For ringe, der allerede har lukket, er diameteren defineret som 0 um.
    BEMÆRK: F-actin ringe bekvemt målt 1 time efter sårdannelse som dette er omtrent halvvejs gennem sårlukning proces i vildtypen. Kan også måles F-actin ringe på forskellige tidspunkter for at udlede et tidsforløb for sårlukning. Time Lapse film af sårlukning kan erhverves ved hjælp af levamisol-immobiliserede orme og spinning disk konfokal mikroskopi.

5. Assay Induktion af Epidermale antimikrobielle peptider

BEMÆRK: Anskydning udløser også medfødte immunrespons i C. elegans hud. Transkription af gener, der koder antimikrobielle peptider (ampere) er induced i epidermis. NLP-29 (neuropeptid-lignende protein) AMP er stærkt fremkaldt af såret 4. For at analysere hvordan overhuden styrer AMP udtryk efter sårdannelse, brug transgene reportere eller real-time PCR til påvisning af enkelte AMP transkriptniveauer.

  1. Transgene reporter assay for reaktion på såret 4 medfødte immunforsvar.
  2. Udfør nål såring (som i protokol 1) om voksne dyr, der udtrykker den transgene reporter frIs7, som indeholder P NLP-29- GFP og P col-12- DsRed som en intern kontrol. Overhold læderet voksne dyr som mørk rød eller orange i en GFP lang pass filter.
    BEMÆRK: At såre vildtype orme vil inducere P NLP-29 -GFP udtryk, men vil ikke påvirke P col-12 -dsRed, hvilket resulterer i orme, der vises orange, gul eller grøn under GFP lang pasning belysning. Tab af funktion af gener i p38 MAPK-vejen, såsom PMK-1 eller nsy-1 blokerer NLP-29 -GFPinduktion efter sårede 4. P NLP-29- GFP udtrykkes ved høje niveauer i larvestadier
  3. Udfør AMP induktion assays hos unge voksne dyr. Sørg for, at læderet kontroldyr har lave niveauer af GFP.
    BEMÆRK: P NLP-29- GFP-ekspression er også induceret af osmotisk stress 8, og kan være følsomme over for andre miljømæssige belastninger.
  4. 6 timer efter sårdannelse, score antallet af orme, der har P NLP-29 GFP induktion (figur 3) 9 ved anvendelse af en fluorescens dissektionsmikroskop med GFP langpasfilter.
    BEMÆRK: Ved 1 time efter sårdannelse P NLP-29- GFP er synligt induceret og nåede et højdepunkt omkring 6 timer efter sårdannelse og derefter resterende forhøjet op til 24 timer efter sårdannelse. Kvantificer ekspression ved visuel scoring 4,9. Alternativt kvantificere ekspressionsniveauer ved anvendelse af en fluorescens-aktiveret orm sorteringsanlæg 4. For ormen sorteringsanlæg, skal såret mindst 50 dyr.
  5. Real-time PCR assay for quantitating transcript niveauer af de individuelle AMP gener. Assay transkriptniveauer i flere gener: NLP-29, NLP-30, cnc-1, og cnc-5.
  6. Udfør nål sårede på vildtype eller mutant orm (se protokol 1)
  7. Saml 50 sårede orme og 50-læderet orme til ønsket tid (f.eks 3, 6, 24 timer) efter sårdannelse.
  8. Uddrag RNA under anvendelse af et kommercielt kit ifølge producentens anvisninger.
  9. Udfør revers transkription for at få i alt 20 pi cDNA under anvendelse af et kommercielt revers transkriptase-kit.
  10. For RT-PCR, bruge 0,2 pi cDNA (1/40) fra hver prøve i kombination med en grøn Supermix med fluorescein og 0,2 pM primere. At sammenligne RNA kvalitet, brug ama-1 eller SNB-1 RT-PCR som reference; sammenligne relative ekspressionsniveau AMP ved at normalisere til intern kontrol (AMA-1 eller SNB-1), eller sammenligne fold induktion efter sårdannelse (AMP induktion i sårede orme / læderet orme) efter normenalizing til intern kontrol.
    BEMÆRK: cnc-1 og cnc-5 er caenacin familie antimikrobielle peptider, hvis transkription aktiveres ved såret 10. Typisk nål såring inducerer ekspression (~ 500 fold til CNC-1) over et tidsforløb på 4 timer 10. Primere anvendt i offentliggjort arbejde er anført i tabel 2.

6. Assay overlevelse efter Anskydning

  1. BEMÆRK: Beskadigelse aktiverer mindst to uafhængige signalveje i epidermis: Ca2 + afhængige sårheling pathway og medfødte immunreaktion pathway. Der kræves både veje for fuld overlevelse sterilt sårdannelse. For at teste, om en mutant eller RNAi behandling påvirker sårheling, måle overlevelse ved 24-48 timer efter sårdannelse. Eventuelt bruge konventionelle levetids-analyser for at fastslå virkningen af såre på levetid 4,9.
  2. Udfør nål sårede på unge voksne (L4 + 24 timer) orme (50 orme Gentag SeveRAL gange) følgende protokol 1 ovenfor. Opretholde et tilsvarende antal læderet orme som kontroller.
  3. Tjek overlevelse hver 24 timer (overførsel sårede orme til en ny agarplade hver 24 timer). Observer ~ 50% overlevelse 24 timer efter sårdannelse i mutanter, der er defekte i sårheling såsom GTL-2 eller tir-1, når normaliseres til læderet kontroldyr. Døden er defineret som manglende bevægelsesreaktion at røre ved orm pick.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Laser eller nål såring vil udløse en hurtig og vedvarende stigning i epidermale Ca niveauer, som visualiseret med Ca sensorer såsom GCaMPs (figur 1). Ca elevation sker inden sekunder og forbliver forhøjet ti minutter. Needle sårede reproducerbart resulterer i dannelsen af F-actin ringe på sårsteder (figur 2); disse vises inden for få minutter, og efterhånden tæt over 1-2 timer efter sårdannelse. Actin ringe mindre ofte dannet efter mere præcis laser sårdannelse. Både nål og laser såret inducere ekspression af epidermale antimikrobielle peptider (ampere) som NLP-29, detekteret med transkriptionelle journalister (Figur 3). AMP induktion fremgår inden for 2-4 timer efter sårede og varer cirka 24 timer. Needle såring af vildtype bør ikke påvirke levedygtigheden (målt ved 24 timer efter sårdannelse) eller levetid.

Figur 1
Figur 1. Laser sårdannelse udløser en Ca2 + reaktion i C. elegans epidermis. (A) Epidermal GCaMP3 fluorescens (P col-19 -GCaMP3 (juIs319)) niveauer efter femtosekund laser sårdannelse. Sidebillede af epidermis i anterior-organ; x, laser sår; N, epidermal kerne. Spinning disk konfokal billeder, intensitet kode. UW:-læderet, W:. Såret (B) Kvantificering af GCaMP3 bf / F 0 ved 20, 40, og 60 pm fra sår sted; repræsentative spor. Klik her for at se en større udgave af dette tal.

Figur 2
Figur 2. Nål såret udløser actinpolymerisation omkring sår site. (A) col-19- GFP-moesin (juIs352). Scale: 10 um. UW:-læderet, W:.. Såret (B) Kvantificering af actin ring diameter fra liniescanninger, 4 line scanninger per dyr (stiplede røde linjer i panelet (A), WT) Klik her for at se en større udgave af dette tal.

Figur 3
Figur 3. Epidermal sårdannelse aktiverer medfødte immunreaktion. Repræsentative billeder (WT-læderet, WT sårede + 3 timer) af P NLP-29 -GFP (frIs7) induktion efter nål sårdannelse. Skala:. 200 um Klik her for at se enstørre version af denne figur.

Reporter Transgene Fluorescens Allel
Calcium PCOL-19-GCaMP3; pCOL-19-tdTomato GFP / tdTomato juIs319 X
Actin PCOL-19-GFP :: moesin GFP juIs352 I
NLP-29 Pnlp-29-GFP / pCOL-12-DsRed GFP / DsRed frIs7 IV

Tabel 1. Transgener anvendes i sår respons assays. Denne tabel viser kromosomalt integrerede transgener rådighed på Caenorhabditis Genetik Center (http://www.cbs.umn.edu/research/resources/cgc).

Gene navn Sekvens
NLP-29 F: cttctcgcctgcttcatggc
R: gtccgtatccaccatatcctcc
NLP-30 F: TTCTTCTCGCCTGCTTCATGG
R: CATAACCTCTACCATATCCACCG
cnc-1 F: gccattgtcgccatttcctc
R: cctccatacattggatatcctc
cnc-5 F: CTTCTTCTAGCAATGCTCGCTC
R: GTATCCTCCACCATACCCTCC
AMA-1 F: ACTCAGATGACACTCAACAC
R: GAATACAGTCAACGACGGAG
SNB-1 F: tccagcagacacaagctcagg
R: gagacaacttctgatcacgctc

Tabel 2. Primere anvendt til RT-PCR af AMP-transkripter. Arbejde koncentration er 0,2 um. SNB-1 fungerer som intern kontrol.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

De metoder, der præsenteres her for nål og laser såret giver komplementære tilgange til vurdering af, om den epidermale epitel at udbedre skader. Laser såring er relativt lokaliseret og (afhængig af laser konfiguration) kan begrænses til overhuden, mens nålen såret forstyrrer overhuden, neglebånd og sandsynlige interne basalmembraner. Needle såring kan mere præcist ligne sår påført af patogener eller mekaniske skader på det naturlige miljø. Som regel nål såret kræver mere øvelse at opnå præcise sår, der er kompatible med dyr overlevelse. De cellulære reaktioner på nåle- og laser såret mange ligheder. Det skal dog bemærkes, at dannelsen af ​​actin ringe ikke reproducerbart observeret efter femtosekundlaser sårdannelse.

En begrænsning af nålestik, er, at det ikke er en præcis sår: nålen også skader indre væv, hvis bidrag til ormoverlevelse er ikke blevet undersøgt. En eventuel ændring af denne protokol vil være at kombinere mikrofluid-baserede mikroinjektion systemet 11 og fluorescerende reportere til at udføre mere præcise fysisk sårdannelse.

Nålen og laser sårede beskrevne metoder her er enkle endnu temmelig arbejdskrævende, og i bedste mellemlang gennemløb, hvilket gør det svært at anvende genomisk eller biokemiske metoder til karakterisering af såret respons. Cuticle gennemtrængende patogener som svampe eller protozoer 12,13 kan leveres til større bestande af dyr, og kan udløse reaktioner, der overlapper med svaret sårdannelse, men indføre yderligere kompleksitet patogen specifikke reaktioner. Yderligere arbejde vil være forpligtet til at undersøge, om andre abiotiske metoder såsom ballistisk bombardement 14 eller rækker af mikromekaniske piercing strukturer 15 kan tilpasses for storstilet sårdannelse.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics